Research
Finding Linked Markers to En for Efficient Selection of Pea Enation Mosaic Virus Resistance in Pea Shalu Jain, Norman F. Weeden, Lyndon D. Porter, Sanford D. Eigenbrode, and Kevin McPhee*
ABSTRACT Pea enation mosaic virus (PEMV) causes an important disease of cool-season food legumes, resulting in significant yield loss worldwide. The present investigation was carried out to study the inheritance and identify the molecular markers linked with the PEMV resistance gene (En) in field pea (Pisum sativum L.) using an F7–derived mapping population developed from the cross ‘Lifter’ (resistant)/‘Radley’ (susceptible). Three hundred ninety-three recombinant inbred lines (RILs) were phenotyped for reaction to PEMV in the field under natural inoculation and in the greenhouse using artificial inoculation. The RILs segregated in the expected 1:1 ratio for resistance and susceptibility in the field and greenhouse evaluations. Sequence tagged site markers were developed through an intron targeted amplified polymorphism approach based on comparative mapping with Medicago truncatula Gaertn. and a targeted region amplified polymorphism approach was also used to enrich the genomic region segregating for the En gene. Our results demonstrate that resistance to PEMV in pea is governed by a single gene, En, located on linkage group III between markers CNGC (2.5 cM) and tRNAMet2 (1.3 cM) with many other closely associated markers. These two markers in combination predict the presence of En with 99.4% accuracy in the Lifter/Radley mapping population and have implications for markerassisted selection for PEMV resistance in pea improvement breeding programs.
S. Jain and K. McPhee, Dep. of Plant Sciences, North Dakota State Univ., Fargo, ND 58108; N.F. Weeden, Dep. of Plant Sciences and Plant Pathology, Montana State Univ., Bozeman, MT 59717; L.D. Porter, Vegetable and Forage Crops Research Unit, USDA–ARS, Prosser, WA 99350; S.D. Eigenbrode, College of Agricultural and Life Sciences, University of Idaho, Moscow, ID 83844. Received 2 Apr. 2013. *Corresponding author: (
[email protected]). Abbreviations: EST, expressed sequence tags; MAS, marker-assisted selection; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; PEMV, Pea enation mosaic virus; RAPD, random amplification of polymorphic DNA; RIL, recombinant inbred line; SSR, simple sequence repeat; STS, sequence tagged site; TRAP, target region amplified polymorphism.
P
ea (Pisum sativum L.) is a self-pollinating diploid (2n = 2x = 14) and ranks second only to dry bean among grain pulses and fourth after soybean [Glycine max (L.) Merr.], peanut (Arachis hypogaea L.), and dry beans among food legumes for global production (FAO, 2012). Pea serves as a key component of human diets as well as animal feed. Pea is a cool-season legume crop with numerous health benefits, including fiber, protein, and microand macronutrients (Messina, 1999). In addition, it serves as a rotational crop to break the disease cycle and increase soil fertility by fixing the atmospheric nitrogen (Bremer et al., 1988; Stevenson et al., 1995). Dry pea production suffers worldwide from yield loss and reduced seed quality due to various abiotic and biotic stresses. The disease caused by Pea enation mosaic virus (PEMV) is one of the most destructive and widely distributed. Pea enation mosaic virus causes yield losses of 10 to 100%, especially if the pea plant
Published in Crop Sci. 53:1–8 (2013). doi: 10.2135/cropsci2013.04.0211 © Crop Science Society of America | 5585 Guilford Rd., Madison, WI 53711 USA All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permission for printing and for reprinting the material contained herein has been obtained by the publisher. crop science, vol. 53, november– december 2013
www.crops.org 1
is infected early in the season (Hull, 1981; de Zoeten and Skaf, 2001; Stokes and Eigenbrode, personal communication, 2012). Pea enation mosaic virus is spread by the pea aphid (Acyrthosiphon pisum) and to a much lesser extent by the green peach aphid (Myzus persicae) in a persistent manner and has a wide host range, including Cicer arietinum L., Lathyrus odoratus L., Lens culinaris Medik., Medicago arabica (L.) Huds., Pisum sativum L., Trifolium incarnatum L., Vicia faba L., and Vicia sativa L. (Hagedorn et al., 1964). Visual symptoms of PEMV infection include hyaline local lesions with enations, mosaic, puckering, and vein clearing. Pea plants infected by PEMV are severely stunted and develop pods distorted in shape with few and smaller seeds of reduced seed quality. Aphid populations carrying PEMV can be controlled by insecticide sprays; however, this increases the production costs and creates a negative impact on the environment. Use of a high-yielding pea variety with resistance to PEMV is recommended for long-term control of the disease ( Jain et al., 2012). Resistance to PEMV has been reported in pea lines and is inherited as a single dominant gene (En) which was mapped on linkage group III with anchor loci st, uni, and Adh-1 (Schroeder and Barton, 1958; Gritton and Hagedorn, 1980; Baggett and Hampton, 1983; Marx et al., 1985). The isozyme locus Adh-1 is about 5 cM from En and cannot be considered an ideal marker for marker-assisted selection (MAS) (Weeden and Provvidenti, 1988). Two random amplification of polymorphic DNA (RAPD)–derived markers, P256_900 and B500_400, were also mapped approximately 5 to 10 cM from En (Yu et al., 1995) and have limited utility for MAS. Identifying tightly linked markers for agronomically important traits in pea continues to be an important goal to facilitate MAS in breeding. In recent years, a large number of markers for pea have been developed from genomic DNA libraries and expressed sequence tags (EST) with the goal of providing sufficient sequence resources for developing dense genetic maps (De Caire et al., 2012; Mishra et al., 2012). Comparative genomics is a valuable tool to develop molecular markers for one species based on information from the model species. Model legume plants differ in genome size, chromosome number, ploidy level, and self-compatibility from other species; however, they show considerable conservation of synteny with other legume crop species (Zhu et al., 2005; Choi et al., 2004; Bordat et al., 2011). Comparative mapping is a feasible approach for molecular tagging of En due to a single gene conferring resistance to PEMV. Gene coding sequences of Medicago truncatula Gaertn. are usually highly conserved in many pulse crops such as pea, bean (Phaseolus vulgaris L.), chickpea, alfalfa (Medicago sativa L.), and red and white clover (Trifolium pratense L. and T. repens L., respectively) (Zhu et al., 2003; Kalo et al., 2004; Aubert et al., 2006; Phan et al., 2007; Ellwood et al., 2008). Expressed sequence tags or gene-based molecular markers using the M. truncatula 2
genomic resources through an intron-targeted amplified polymorphic approach have been developed with the longterm goal of tagging disease resistance genes in pea (Brauner et al., 2002; Choi et al., 2004; Eujayl et al., 2004; Phan et al., 2007). Likewise, target region amplified polymorphism (TRAP) markers have been found useful for mapping and tagging disease resistance genes successfully in other plants (Hu and Vick, 2003; Liu et al., 2005; Miklas et al., 2006). Recently, Randhawa and Weeden (2009) used M. truncatula 2.0 data as a template for identifying sequence tagged site (STS) markers that are closer to En and identified Prx1, Mnsod, Npac, and Cngc, positioned closer to En than any of the previously identified molecular markers using a mapping population of 62 F4 lines. The objective of this study is to further design novel STS markers in the region of En and identify a more tightly linked marker for En.
MATERIAL AND METHODS Plant Material and DNA Extractions A mapping population of 393 pea recombinant inbred lines (RILs) derived from the cross Lifter/Radley and advanced to the F7 through single-seed descent was used in this study. Lifter has normal leaf type and is resistant to PEMV, bean leaf roll virus, powdery mildew, and Fusarium wilt Race 1 (McPhee and Muehlbauer, 2002). Radley is a semileafless type with resistance to Fusarium wilt Race 2 and has partial resistance to Ascochyta blight. DNA was isolated from 100 mg of leaf tissue from 15-dold plants grown under controlled greenhouse conditions using a modified cetyltrimethylammonium bromide method (Rogers and Bendich, 1985). The quality and concentration of the DNA samples were checked by a spectrophotometer (SpectraMax Plus, Molecular Devices Corp., Sunnyvale, CA) and on 1% agarose gels. A portion of the DNA was diluted to 50 ng mL –1 and used in polymerase chain reaction (PCR) for marker analysis.
Development of Sequence Tagged Site Markers The M. truncatula contig assembly (Mt3.0) region on chromosome 3 homologous to the region on pea linkage group III containing En was inspected for genes that had at least one intron longer than 100 bp for developing STS markers. When such genes were identified, primers were designed to complement sequences in coding regions flanking one or more introns and were positioned to amplify a segment 300 to 1200 bp in length based on the M. truncatula genomic sequence. Primers were designed by importing sequences into Primer-BLAST (www.ncbi.nlm.nih.gov/ tools/primer-blast/ [accessed 12 July 2012]) and selecting primers 18 to 24 bp long with annealing temperatures of 55 to 65°C.
Polymerase Chain Reaction Product Detection and Analysis Five novel STS markers developed in this study along with one simple sequence repeat (SSR) marker, AD57 (Loridon et al., 2005), and two STS markers, CNGC and Prx1 (Randhawa and Weeden, 2009), were tested for polymorphism between parental lines Lifter and Radley and polymorphic markers
www.crops.org
crop science, vol. 53, november– december 2013
Figure 1. Symptoms of Pea enation mosaic virus (PEMV): (a–b) translucent flecking and windowing, and (c) enation as demonstrated in susceptible recombinant inbred lines with a positive reaction to PEMV.
were amplified in RILs. The PCR reaction was conducted in a 20-mL volume containing 50 ng of genomic DNA template, final concentrations of 0.2 mM of both forward and reverse primers, 2.5 mM of MgCl , 200 mM of dNTPs, 1× Taq buf2 fer (New England BioLabs, Inc., Beverly, USA) and 0.5 U Taq DNA polymerase. The PCR reaction was performed in a Veriti 96-Well Fast Thermal Cycler (Applied Biosystems, USA) using the following profile: initial denaturation at 94°C for 3 min followed by 35 cycles of 94°C for 30 sec, 52 to 65°C for 50 sec (according to primer’s annealing temperature), 72°C for 50 sec, and a final extension at 72°C for 10 min. Amplified products were resolved on 2% agarose or 8% polyacrylamide gel (polyacrylamide gel electrophoresis [PAGE]) using a mega-gel highthroughput vertical unit model C-DASG-400-50 to detect the polymorphism (Wang et al., 2003). The PCR products were visualized by ethidium bromide staining under ultraviolet light and scored manually. If length polymorphism was not detected, PCR products were digested with four base cutter restriction enzymes (New England BioLabs, Inc., Beverly, USA) to generate cleaved amplified polymorphic sequences markers and run on 2% agarose gels to detect polymorphism. Polymorphic markers were analyzed among the RILs.
Development of Target Region Amplified Polymorphism Markers The TRAP markers were amplified using one fixed primer taken from the previously described primers designed from ESTs associated with PEMV resistance and a second arbitrary primer designed to anneal with either an intron or exon sequence as described by Hu and Vick (2003). The TRAP PCR reactions were according to the protocol mentioned in Hu and Vick (2003). Each reaction was carried out in a 15-mL reaction volume, with 50 ng of template DNA, 0.2 mM of fixed and arbitrary primers, 200 mM dNTPs, 2.5 mM MgCl 2, 1× PCR buffer, and 0.5 U Taq DNA polymerase using the following PCR profile in Veriti 96-Well Fast Thermal Cycler (Applied Biosystems, USA): initial denaturation at 94°C for 4 min followed by five cycles at 95°C for 45 sec, 35°C for 45 sec, 72°C for 1 min and 35 cycles at 94°C for 45 sec, 51°C for 45 sec, 72°C for 1 min, and a final extension at 72°C for 10 min. The amplification products were resolved on 8% polyacrylamide gel (PAGE) using a mega-gel high-throughput vertical unit model C-DASG-400-50 (Wang et al., 2003). crop science, vol. 53, november– december 2013
Mechanical Inoculation of Pea Enation Mosaic Virus in Greenhouse All 393 RILs, parents of the population, and control lines with four replications were mechanically inoculated with PEMV under controlled greenhouse conditions following the protocol described by Larsen and Porter (2010). Four seeds of a single RIL were sown in one pot and pots were arranged in a completely randomized design in each test. Screening tests were conducted in greenhouse with temperatures ranging from 25 to 15°C with an 11:13 h day:night photoperiod. Plants were scored as susceptible/resistant on the basis of their symptoms such as translucent flecks or windows, mosaic leaf pattern, enations, yellowing, chlorosis, and stunting (Fig. 1). In a number of RILs where disease scores appeared inconsistent, screening was repeated two or more times with four replications to confirm the data.
Field Screening of Pea Enation Mosaic Virus In the spring of three consecutive years (2010–2012), all 393 RILs along with parents of the population were planted in a field nursery in Corvallis, OR, where aphids carrying PEMV naturally infect plants. The population was planted using a nonreplicated design with 80 seeds plot−1 along with parents and controls. Plants were scored as susceptible and resistant according to the presence of PEMV symptoms. The PEMV screening data were not collected in 2011 due to poor disease incidence in the field.
Data Analysis All markers were scored manually from gel images. Each segregating marker and phenotypic score was tested for goodnessof-fit to the expected 1:1 ratio using the chi-square test. Initial ordering of markers was performed using QUIKMAP (Weeden and Barnard, 1994). Final ordering was performed manually to minimize the number of recombinants and MapChart (Voorrips, 2002) was used to draw the map around the En region. In a number of cases where data were questionable or appeared inconsistent with the initial order, DNA genotypes or disease phenotyping was repeated to confirm the data. Once the data were finalized, recombination frequencies between adjacent markers were calculated using the equation r = R/(2 − 2R) (Burr et al., 1988).
www.crops.org 3
Table 1. Details on primer sequences, amplification, and polymorphism assessment of markers used in present study for fine mapping of the En gene. Marker tRNAMeT
BAC‡ designation
Remarks
Primer sequence (5¢–3¢)
Tm
Type of polymorphism
Band size
F:GGTCCATGATAAGCATAGTACGA
°C 57
Length§, CAPS¶ (MseI)#
bp 550
CU012043
Developed in this study
†
R:GATTCGTTTGGAAGTGATTCTTC Rp26S
F:GCCATGTCAAGTTCATCCG R:GTGCTTGACCAGGCTGACC
57
CAPS (HinfI/RsaI)§#
1000
CU468247
Developed in this study
BCDH
F:TTGTGCTTGTTGGACCCATAATG R:CAAACAATGGACACTATCTTCTATG
58
CAPS (MnlI)§#
1000
CU012051
Developed in this study
TLDC
F:GTGACCATTCGCCACCATGC R:TTCTCAGGTGAATCCTCCCAG
58
CAPS (DpnII)#
400
AC137836
Developed in this study
Lka2
F:GAAACCTTGTTCCTCTACTG R:CCAAATCAGAGACTCTGGC
55
CAPS (HinfI)§#
300
CU019605
Developed in this study
F:CCAGATTGAAGGGCATCAAGG R:GCATGGGCTGGAGCTGCATT
65
Length§, CAPS (RsaI)#
1000
CT573028
Randhawa and Weeden, 2009
F:CGCTTGTTCTTCCACGATTGC
58
Length§, CAPS (HinfI)#
900
AC202572
Randhawa and Weeden, 2009
51
Simple sequence repeat§#
320
Loridon et al., 2005
CNGC
Prx-1
R:CACCTTGCTTGTCCAATTGTGTG AD5
F:GTTTTCATGATGGTTAAAGGTG R:GAGTAAGCAAAGTGACTAGTGGA
†
Tm = melting temperature.
‡
BAC = Bacterial Artificial Chromosome.
§
Polymorphism between Lifter and Radley.
¶
CAPS = cleaved amplified polymorphic sequences.
#
Polymorphism in some different pea lines.
Figure 2. Amplification profile of the closest marker, tRNAMet, in resistant (R) and susceptible (S) recombinant inbred lines from a cross between Lifter/Radley on 8% polyacrylamide gel.
RESULTS
1. One primer pair, tRNAMet, showed length polymorphism on 8% polyacrylamide gels (Fig. 2).
Five novel primer pairs were designed from pea ESTs with significant similarity to M. truncatula gene calls (exons flanking one or more introns) in the region having conserved synteny with pea and containing En (Table 1). All five primers successfully resulted in PCR amplification and generated PCR products ranging in size from 300 to 1000 bp with 1 to 2 bands marker−1 when tested on parental genotypes, Lifter and Radley. Four primer pairs (Rp26S, BCDH, TLDC, LKA2) gave a single band, but were polymorphic after restriction digestion between Lifter and Radley, except for TLDC as mentioned in Table
Development of Target Region Amplified Polymorphism Markers
Development of Sequence Tagged Site Markers through Comparative Mapping
4
One fixed primer from this study and previously used En-linked markers (Randhawa and Weeden, 2009) were combined with the arbitrary primers to test the polymorphism between the parental lines. Ten polymorphic TRAP primer pairs amplified a total of 27 loci ranging from one to six polymorphic DNA fragments in each primer pair in the parents and RILs (Table 2). The TRAP markers were identified and scored on the basis of the presence or absence among RILs, while some of them were also scored
www.crops.org
crop science, vol. 53, november– december 2013
Table 2. Fixed primers from expressed sequence tag (EST) sequences and arbitrary primers for target region amplification polymorphism (TRAP) marker development in pea. Marker NapcFGA5 NpacRGA5 MnSODTRAP3 NpacFTRAP3 NpacRTRAP3 MnsodRTRAP4 NapcFTRAP4 NpacRTRAP4 PRX1TRAP13 LKA2TRAP
Conserved EST primer
Arbitrary primer
Loci
GAGGACGATGATGAACAAGGAAG CCCATTGTGAGTCTTGAGAGC GAACATGCCTACTACTTACAG GAGGACGATGATGAACAAGGAAG CCCATTGTGAGTCTTGAGAGC CTCTCTTTCTCATATACTTCAC GAGGACGATGATGAACAAGGAAG CCCATTGTGAGTCTTGAGAGC CACCTTGCTTGTCCAATTGTGTG GAA ACC TTG TTC CTC TAC TG
GGAACCAAACACATGAAGA GGAACCAAACACATGAAGA CGTAGCGCGTCAATTATG CGTAGCGCGTCAATTATG CGTAGCGCGTCAATTATG CGTAGTGATCGAATTCTG CGTAGTGATCGAATTCTG CGTAGTGATCGAATTCTG GCGCGATGATAAATTATC CGTAGCGCGTCAATTATG
1 1 1 3 5 4 6 3 1 2
Figure 3. Segregation pattern of target region amplification polymorphism (TRAP) from the NapcRTRAP3 primer pair. M = marker lane; P1 = Lifter; P2 = Radley; RILS = recombinant inbred lines derived from the cross between Lifter/Radley.
on the basis of size variation. Figure 3 represents the pattern of TRAP markers detected in polyacrylamide gels. The conserved EST primers were from the En-specific primers on linkage group III; however, only six loci (22%) were assigned to linkage group III at a distance >10 cM from En, while the remaining markers were assigned on different linkage groups (data not shown).
Phenotyping of Recombinant Inbred Lines for Pea Enation Mosaic Virus Reaction All 393 RILs were screened as resistant or susceptible based on field evaluations over 2 yr. Virus reaction was also confirmed by mechanical inoculations in controlled crop science, vol. 53, november– december 2013
greenhouse tests. The two parents, Lifter and Radley, showed uniform expression in all screenings. Radley demonstrated a high incidence of infection (90–100%), whereas Lifter remained uninfected. The RIL population was consistently scored either susceptible (S) or resistant (R) based on disease symptoms. All 393 RILs showed a goodness of fit to a 1:1 ratio for a resistant and susceptible reaction based on chi-square analysis in each of three separate experiments, c2 = 0.186 (p = 0.66), 0.23 (p = 0.63), and 0.083 (p = 0.773), respectively, indicating that a single gene, En, controls PEMV resistance (Table 3).
www.crops.org 5
Table 3. Segregation of 393 recombinant inbred lines (RILs) from Lifter/Radley based on reaction to Pea enation mosaic virus. Reaction† Experiment I II III¶
Year
R
S
M
Chi-square test‡
p§
Field Greenhouse Field
2010 2011 2012
208 192 211
182 181 177
3 20 4
0.186759 0.230519 0.083003
0.663 0.632 0.773
R = resistant, S = susceptible, M = mixed R and S responses.
† ‡
Location
Chi-square test for goodness of fit to an expected allelic 1:1 ratio.
§
p-value is the probability (p > 0.05).
¶
Data for one RIL are missing in Experiment III.
Fine Mapping of En on Linkage Group III Out of the mapping population, 382 RILs were genotyped with polymorphic markers designed in this study, an SSR marker, AD57 (Loridon et al., 2005), and two STS markers, CNGC and Prx1 (Randhawa and Weeden, 2009). Nine lines either gave inconsistent data, particularly for disease reaction, or were found to be heterozygous in the region of interest. Therefore, 373 RILs were included in the final mapping analysis. Five STS markers (BCDH, Lka2, Prx1, tRNAMet, and CNGC) and one SSR (AD57) were found to be closely linked to the En phenotype. En was placed between CNGC (2.5 cM) and tRNAMet (1.3 cM) (Fig. 4).
DISCUSSION Pea is one of the most important pulse crops of temperate regions in the world, and PEMV is an important virus of pea with worldwide distribution. Therefore, there is an urgent need to develop high-yielding varieties with resistance to PEMV with greater yield stability. Finding a linked marker may serve as an alternative to field screening procedures and shorten the duration of a breeding program aimed at introgression of resistance genes associated with phenotypic analysis. Those markers previously identified for MAS of PEMV resistance, including the morphological marker Uni, the isozyme marker Adh1 (Weeden and Provvidenti, 1988), and two RAPD-derived markers (Yu et al., 1995), are 5 to 8 cM from En, and are somewhat distant from the targeted gene. Recent developments in molecular marker and sequencing technologies have allowed comparing the coding sequence information among crops and identifying syntenic regions between related genera. Furthermore, a potential application of EST data sets is to conduct a comparative analysis of genomes between less studied crops such as pea and well-studied model plants such as M. truncatula to develop gene-based markers for mapping and tagging economically important traits. Medicago truncatula ESTs were aligned with the genomic sequences of Arabidopsis homologs to design intron-targeting primers for developing EST-based markers and then used to construct a genetic map of M. truncatula (Choi et al., 2004). Since introns are generally more polymorphic than exons, 6
Figure 4. Linkage map showing distance between En and linked markers on linkage group III. Markers in red are novel markers developed in this study. Distance is given in centimorgans.
EST-specific primers amplify PCR products spanning introns and exhibit size or presence/absence polymorphisms. In the present study, we exploited the similar strategy and developed markers considering intraspecific DNA polymorphisms within introns after comparing functional gene-related genomic sequences in M. truncatula with the pea EST sequences. Development of five candidate STS markers in pea was achieved using specific gene calls from the homologous region of M. truncatula having one or more introns (Weeden and Moffett, 2007; Randhawa and Weeden, 2009). With the exception of TLDC, four of these markers resulted in polymorphism in Lifter and Radley. Segregation of four novel STS polymorphic markers was not significantly different from expected 1:1 ratio (p > 0.05) in 382 RILs. In this study, we also designed TRAP markers in which fixed primers were used from markers associated with PEMV resistance and generated one to six loci per primer combination.
www.crops.org
crop science, vol. 53, november– december 2013
The difference in the average number of TRAP markers generated in different studies reflects the degree of polymorphism between the parental lines as 17 to 30.7 markers were observed in different studies (Li et al., 2006; Xu et al., 2003). The TRAP markers might have a higher intrinsic error rate than the original STS markers. Possibly for this reason, we found that none mapped particularly close to En and were not useful for the generation of a finer scale map of the region. Similar concerns were raised by Hu et al. (2005) where only 1% of TRAP fragments showed homology with the targeted EST sequence, as demonstrated by Southern hybridization. Six markers were closely associated with disease reaction in individual RILs, with the exception of Rp26S, and showed good fit to a 1:1 ratio based on the chi-square test. Our results confirm that En is located on linkage group III between markers CNGC (2.5 cM) and tRNAMet2 (1.3 cM) with other closely associated markers. These two markers in combination segregate with En with 99.4% accuracy in the Lifter/Radley mapping population. tRNAMet, developed in this study, is the closest marker (1.3 cM) to En that has been identified to date. It is a codominant STS marker that can be directly run on agarose/PAGE gels unlike markers reported in Randhawa and Weeden (2009) that require an additional restriction digestion step, making genotyping costly and time-consuming. The marker tRNAMet developed in this study provides a basis for MAS in pea breeding programs for selecting PEMV-resistant genotypes. Acknowledgments Authors are grateful for funding (grant no. 2008-511010-4522) by the RAMP (Risk Assessment and Mitigation Program) of NIFA (National Institute for Food and Agriculture). Authors also thank Dr. Jim Myers, Oregon State University, Corvallis, OR, Deven Styczynski, North Dakota State University Fargo, ND, and Virginia A. Coffman, USDA–ARS, Prosser, WA, for their help in field and greenhouse screening. Authors also thank Drs. Ted C. Helms and Farhad Ghavami, North Dakota State University Fargo, ND, for critical reading of the manuscript.
References Aubert, G., J. Morin, F. Jacquin, K. Loridon, M. Quillet, A. Petit, C. Rameau, I. Lejeune-Henaut, T. Huguet, and J. Burstin. 2006. Functional mapping in pea, as an aid to the candidate gene selection and for investigating synteny with the model legume Medicago truncatula. Theor. Appl. Genet. 112:1024– 1041. doi:10.1007/s00122-005-0205-y Baggett, J.R., and R.O. Hampton. 1983. Pea enation mosaic virus: Variation in resistance conferred by En. Pisum Newsl. 15:3–6. Bordat, A., V. Savois, M. Nicolas, J. Salse, A. Chauveau, M. Bourgeois, J. Potier, H. Houtin, C. Rond, F. Murat, P. Marget, G. Aubert, and J. Burstin. 2011. Translational genomics in legumes allowed placing in silico 5460 unigenes on the pea functional map and identified candidate genes in Pisum sativum L. G3: Genes, Genomes, Genet. 1:93–103. crop science, vol. 53, november– december 2013
Brauner, S., R.L. Murphy, J.G. Walling, J. Przyborowski, and N.F. Weeden. 2002. STS markers for comparative mapping in legumes. J. Am. Soc. Hortic. Sci. 127:616–622. Bremer, E., R.J. Rennie, and D.A. Rennie. 1988. Dinitrogen fixation of lentil, field pea and fababean under dryland conditions. Can. J. Soil Sci. 68:553–562. doi:10.4141/cjss88-053 Burr, B., A.F. Burr, K.H. Thompson, M.C. Alberson, and C.W. Stuber. 1988. Gene mapping with recombinant inbreds in maize. Genetics 118:518–526. Choi, H.K., J.H. Mun, D.J. Kim, H. Zhu, J.M. Baek, J. Mudge, B. Roe, N. Ellis, J. Doyle, G.B. Kiss, N.D. Young, and D.R. Cook. 2004. Estimating genome conservation between crop and model legume species. Proc. Natl. Acad. Sci. USA 101:15289–15294. doi:10.1073/pnas.0402251101 De Caire, J.D., C.J. Coyne, S. Brumett, and J.L. Shultz. 2012. Additional pea EST-SSR markers for comparative mapping in pea (Pisum sativum L.). Plant Breed. 131:222–226. doi:10.1111/ j.1439-0523.2011.01917.x de Zoeten, G.A., and J.S. Skaf. 2001. Pea enation mosaic virus and the vagaries of a plant virus. Adv. Virus Res. 57:323–350. doi:10.1016/S0065-3527(01)57007-4 Ellwood, S.R., H.T.T. Phan, M. Jordan, J. Hane, A.M. Torres, C.M. Avila, S. Cruz-Izquierdo, and R.P. Oliver. 2008. Construction of a comparative genetic map in faba bean (Vicia faba L.); conservation of genome structure with Lens culinaris. BMC Genomics 9:380. doi:10.1186/1471-2164-9-380 Eujayl, I., M.K. Sledge, L. Wang, G.D. May, K. Chekhovskiy, J.C. Zwonitzer, and M.A.R. Mian. 2004. Medicago truncatula ESTSSRs reveal cross-species genetic markers for Medicago spp. Theor. Appl. Genet. 108:414–422. FAO. 2012. Crops. FAO. http://faostat.fao.org/site/567/Desktop Default.aspx?PageID=567#ancor (accessed 11 May 2012). Gritton, E.T., and D.J. Hagedorn. 1980. Linkage of the En and st genes in pea. Pisum Newsl. 12:26–27. Hagedorn, D.J., E.C. Layre, and E.G. Ruppel. 1964. Host range of pea enation mosaic virus and use of Chenopodium album as a local lesion host. Phytopathology 54:843–849. Hu, J., O.E. Ochoa, M.J. Truco, and B.A. Vick. 2005. Application of the TRAP technique to lettuce (Lactuca sativa L.) genotyping. Euphytica 144:225–235. doi:10.1007/s10681-005-6431-1 Hu, J., and B. Vick. 2003. Target region amplification polymorphism: A novel marker technique for plant genotyping. Plant Mol. Biol. Rep. 21:289–294. doi:10.1007/BF02772804 Hull, R. 1981. Pea enation mosaic virus. In: E. Kurstak, editor, Handbook of plant virus infections and comparative diagnosis. Elsevier/North-Holland Biomedical Press, Amsterdam. p. 239–256. Jain, S., K. McPhee, A. Kumar, R.R. Mir, and R. Singh. 2012. Virus resistance breeding in cool season food legumes: Integrating traditional and molecular approaches. In: G.S. Bhullar and N.K. Bhullar, editors, Agricultural sustainability—Progress and prospects of crop research. Elsevier/ Academic Press, San Diego. p. 221–244. Kalo, P., A. Seres, S.A. Taylor, J. Jakab, Z. Kevei, A. Kereszt, G. Endre, T.H.N. Ellis, and G.B. Kiss. 2004. Comparative mapping between Medicago sativa and Pisum sativum. Mol. Gen. Genomics 272:235–246. doi:10.1007/s00438-004-1055-z Larsen, R.C., and L.D. Porter. 2010. Identification of novel sources of resistance to Pea enation mosaic virus in chickpea germplasm. Plant Pathol. 59:42–47. doi:10.1111/j.1365-3059.2009.02198.x Li, J., D.L. Klindworth, F. Shireen, X. Cai, J. Hu, and S.S. Xu. 2006. Molecular characterization and chromosome-specific
www.crops.org 7
TRAP-marker development for Langdon durum D-genome disomic substitution lines. Genome 49:1545–1554. doi:10.1139/g06-114 Liu, Z.H., J.A. Anderson, J. Hu, T.L. Frriesen, J.B. Rasmussen, and J.D. Faris. 2005. A wheat intervarietal genetic linkage map based on microsatellite and targeted region amplified polymorphism markers and its utility for detecting quantitative trait loci. Theor. Appl. Genet. 111:782–794. doi:10.1007/ s00122-005-2064-y Loridon, K., K. McPhee, J. Morin, P. Dubreuil, M.L. PiletNayel, G. Aubert, C. Rameau, A. Baranger, C. Coyne, I. Lejeune-He`naut, and J. Burstin. 2005. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). Theor. Appl. Genet. 111:1022–1031. doi:10.1007/s00122-005-0014-3 Marx, G.A., N.F. Weeden, and R. Provvidenti. 1985. Linkage relationships among markers in chromosome 3 and En, a gene conferring virus resistance. Pisum Newsl. 17:57–60. McPhee, K.E., and F.J. Muehlbauer. 2002. Registration of ‘Lifter’ green dry pea. Crop Sci. 42:1377–1378. doi:10.2135/cropsci2002.1377 Messina, M.J. 1999. Legumes and soybeans: Overview of their nutritional profiles and health effects. Am. J. Clin. Nutr. 70(suppl):439S–450S. Miklas, P.N., J. Hu, N.J. Grunwald, and K.M. Larsen. 2006. Potential application of TRAP (Targeted region amplified polymorphism) markers for tagging disease resistance traits in common bean. Crop Sci. 46:910–916. doi:10.2135/cropsci2005.08-0242 Mishra, R.K., B.H. Gangadhar, A. Nookaraju, S. Kumar, and S.W. Park. 2012. Development of EST-derived SSR markers in pea (Pisum sativum) and their potential utility for genetic mapping and transferability. Plant Breed. 131:118–124. doi:10.1111/ j.1439-0523.2011.01926.x Phan, H.T.T., S.R. Ellwood, J.K. Hane, R. Ford, M. Materne, and R.P. Oliver. 2007. Extensive macrosynteny between Medicago truncatula and Lens culinaris ssp. culinaris. Theor. Appl. Genet. 114:549–558. doi:10.1007/s00122-006-0455-3 Randhawa, H., and N.F. Weeden. 2009. Refinement of the position of En on LG III and identification of closely linked DNA markers. Pisum Genet. 41:33–35. Rogers, S.O., and A.J. Bendich. 1985. Extraction of DNA from milligram amounts of fresh, herbarium, and mummified plant tissues. Plant Mol. Biol. 5:69–76. doi:10.1007/BF00020088 Schroeder, W.T., and D.W. Barton. 1958. The nature and
8
inheritance of resistance to the Pea enation mosaic virus in garden pea, Pisum sativum L. Phytopathology 48:628–632. Stevenson, F.C., J.D. Knight, and C. van Kessel. 1995. Dinitrogen fixation in pea: Controls at the landscape- and microscale. Soil Sci. Soc. Am. J. 59:1603–1611. doi:10.2136/ sssaj1995.03615995005900060014x Voorrips, R.E. 2002. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 93:77–78. doi:10.1093/jhered/93.1.77 Wang, D., J. Shi, S.R. Carlson, P.B. Cregan, R.W. Ward, and B.W. Diers. 2003. A low cost, high-throughput polyacrylamide gel electrophoresis system for genotyping with microsatellite DNA markers. Crop Sci. 43:1828–1832. doi:10.2135/cropsci2003.1828 Weeden, N.F., and J. Barnard. 1994. QUIKMAP: A Microsoft Excel spreadsheet for making a quick comparison between markers in a linkage group and a new marker. N. Y. Agric. Res. Stn. Geneva Comput. Cent. Tech. Rep. 20:2. Weeden, N.F., and M.D. Moffett. 2007. List of genes postulated to be on pea LG III between Fed 1 and just distal to Egl 1. Pisum Genet. 39:45–64. Weeden, N.F., and R. Provvidenti. 1988. A marker locus, Adh-1, for resistance to pea enation mosaic virus in Pisum sativum. J. Hered. 79:128–130. Xu, S.S., J. Hu, and J.D. Faris. 2003. Molecular characterization of Langdon durum-Triticum dicoccoides chromosome substitution lines using TRAP (target region amplification polymorphism) markers. In: Proceedings of the 10th International Wheat Genetics Symposium. Vol. 1. Istituto Sperimentale per la Cerealicoltura, Rome. p. 91–94. Yu, J., W.K. Gu, R. Provvidenti, and N.F. Weeden. 1995. Identifying and mapping two DNA markers linked to the gene conferring resistance to Pea enation mosaic virus. J. Am. Soc. Hortic. Sci. 120:730–733. Zhu, H., H.K. Choi, D.R. Cook, and R.C. Shoemaker. 2005. Bridging model and crop legumes through comparative genomics. Plant Physiol. 137:1189–1196. doi:10.1104/ pp.104.058891 Zhu, H., D. Kim, J. Baek, H. Choi, L. Ellis, H. Küester, W. McCombie, H. Peng, and D.R. Cook. 2003. Syntenic relationships between Medicago truncatula and Arabidopsis reveal extensive divergence of genome organization. Plant Physiol. 131:1018–1026. doi:10.1104/pp.102.016436
www.crops.org
crop science, vol. 53, november– december 2013
