First Assessment of Mitochondrial DNA Diversity in the ... - BioOne

222

CHELONIAN CONSERVATION

AND

BIOLOGY, Volume 8, Number 2 – 2009

Chelonian Conservation and Biology, 2009, 8(2): 222–226 g 2009 Chelonian Research Foundation

First Assessment of Mitochondrial DNA Diversity in the Endangered Nile Softshell Turtle, Trionyx triunguis, in the Mediterranean ¨ ZGU¨R GU¨ÇLU¨1, CELAL ULGER1, O OG˘UZ TU¨RKOZAN1, RICHARD GEMEL2, MICHAEL REIMANN3, YANIV LEVY4, SERAP ERGENE5, AS¸KIN HASAN UÇAR6, AND CEMIL AYMAK5 1

Adnan Menderes University, Faculty of Science and Arts, Department of Biology, 09010 Aydın, Turkey [[email protected]]; 2 Naturhistorisches Museum Wien, Herpetologische Sammlung, Burgring 7, A-1010 Wien, Austria; 3 Neuweg 1, D-55595 Braunweiler, Germany; 4 Sea Turtle Rescue Center, Israel National Nature and Parks Authority, Mevoot Yam, Mikhmoret 40297 Israel; 5 Mersin University, Faculty of Science and Arts, Department of Biology, 33342 Mersin, Turkey; 6 Osmaniye Korkut Ata University, Faculty of Science and Arts, Department of Biology, Osmaniye, 80010 Turkey

ABSTRACT. – We assessed mitochondrial DNA diversity in Trionyx triunguis from the Mediterranean basin (22 samples) and continental Africa (4 samples). The continental African group comprised 4 different and newly described haplotypes, while the Mediterranean group consisted of only 1 previously known haplotype, with the nucleotide divergence between the 2 groups being 1.5% ± 0.7%. Trionyx triunguis is the only species of Trionyx, the genus from which the Linnaean family name Trionychidae is formed. Molecular studies show that T. triunguis is

most closely related to other ‘‘giant’’ softshells that persist in eastern Asia (Engstrom et al. 2004). Giant softshells are all endangered (Praschag and Gemel 2002; Moll and Moll 2004) because they require large rivers and estuaries, fragile habitats that also happen to be heavily occupied and fished by humans. Trionyx triunguis is heavily exploited because of its meat, and its habitats have been degraded by pollution and dam construction. Accidental capture and intentional killing also affect the survival of most populations (Gramentz 2005; Tu¨rkozan 2007). In fact, T. triunguis has been eradicated from the Nile Delta as well as the rest of Egypt (Schleich et al. 1996; Nada 2002; Baha el Din 2006). The Mediterranean population of T. triunguis has been listed by IUCN as critically endangered (European Reptile and Amphibian Specialist Group 1996) (category CR C2A) and estimated at fewer than 1000 adults (Kasparek 2001; Venizelos and Kasparek 2006). Around the eastern Mediterranean, this species persists in Egypt, Israel, Lebanon, Syria, and especially Turkey, where the largest populations are found. Important nesting populations have been recorded along the Mediterranean coast between Dalyan and Samandag˘ (Atatu¨r 1979; Gramentz 1993; Kasparek 1994; Tu¨rkozan 2009). Studies on T. triunguis are very limited and restricted mainly to distribution, ecology, ethology, and reproductive ecology studies (Leshem and D’miel 1986; Kasparek and Kinzelbach 1991; Gramentz 1993, 1994; van der Winden et al. 1994; Gidis¸ and Kaska 2004; Tu¨rkozan et al. 2006). However, the need for improved knowledge of the conservation biology of the declining populations prompted us to initiate applied studies that can help guide the management and survival of the species. The aim of this study is to provide a preliminary assessment of the genetic variation in mitochondrial DNA (mtDNA) of T. triunguis in order to guide conservation strategies. Methods. — Tissue samples were collected either from dead hatchlings or live adults between 2005 and 2008. A total of 26 samples were studied from 6 different populations (Fig. 1). Of these sampling localities, 4 were from Turkey, namely Dalyan (DL) (3 specimens), Dalaman (DM) (6 specimens), Anamur (AN) (4 specimens), and Kazanlı (KZ) (3 specimens). Furthermore, we collected tissues from Israel (IS-Alexander river) (6 specimens) and were provided tissue samples from adult captive animals that apparently originated from the subSaharan African continent (AF) (4 specimens). The precise localities of the African samples were unknown; however, the partial cytochorome b (cyt b) gene sequences of museum materials (Paris Natural History Museum, France) originating from Gabon and Congo confirmed that our African samples were apparently from sub-Saharan Africa rather than the Nile drainage. We did not use these Gabon and Congo specimens in our study because of problems with degraded DNA; we were not able to obtain whole gene sequences for these samples as we did for the rest of our specimens.

NOTES AND FIELD REPORTS

223

Figure 1. Map of Mediterranean basin showing sampling sites, mtDNA haplotypes, and observed number of haplotypes.

We used partial sequences of both cyt b and NAD 4 (also commonly abbreviated ND4) genes of mtDNA that have been used in other phylogenetic studies of trionychids (Weisrock and Janzen 2000; Engstrom et al. 2004). These relatively rapidly evolving markers have been used in order to determine the genetic diversity within and among populations. Genomic DNA was extracted by standard phenol/ chloroform techniques (Sambrook and Russell 2001) using a commercial DNA extraction kit (Invitrogen Inc.). Two mitochondrial genes (ND4 and cyt b) were amplified via the polymerase chain reaction (PCR) using the following primers: ND4—ND4 4672 (F) (59-TGACTACCAAAAGCTCATGTAGAAGC-39) (Engstrom et al. 2002), Hist (R) (59-CCTATTTTTAGAGCCACAGTCTAATG -39) (Arevalo et al. 1994), and cyt b—DW 2000 (F) (59-ACAGGCGTAATCCTACTAA-39) (Weisrock and Janzen 2000), DW 1594 (R) (59-TCATCTTCGGTTTACAAGAC-39) (Shaffer et al. 1997). PCR amplifications were performed in 50-mL volumes containing 1X KCl PCR buffer (Fermantas), 1.5 mM MgCl2 (Fermantas), 2.5 mM each dNTP, 0.5 mM each primer (1 mM for cyt b), 1.0 units of Taq polymerase (Fermantas), and 1– 2 mL (50 ng DNA) of template DNA. Amplicons were

purified using the PCR Purification Kit (Invitrogen). Amplicons were analyzed on an AB3700 or 3730xl automatic sequencer (Macrogen, Applied Biosystems) using the same primers mentioned previously. Sequence analyses were aligned using BioEdit 7.0.9 (Hall 1999). Multiple-sequence alignments were done with CLUSTALW (Thompson et al. 1994) using the default parameters. The computer-generated alignment was further adjusted manually. Genealogical relationships among haplotypes were constructed using TCS (Clement et al. 2000), with statistical parsimony algorithm described by Templeton et al. (1992) to estimate the number of differences among haplotypes as a result of a single substitution with a 90% statistical confidence as the parsimony connection limit and also the most probable ancestral haplotype. For this analysis, combined mtDNA cyt b and ND4 genes were used to construct an unrooted parsimony network. We estimated net nucleotide divergence (Da) and standard deviations between phylogroups (Nei 1987) with the Jukes–Cantor correction (Jukes and Cantor 1969) in the Dnasp program (Rozas et al. 2003). Results. — The cyt b and ND4 fragments amplified in 26 T. triunguis samples had nucleotide lengths of 805 and

224


AND


Table 1. Variable sites of combined ND4 and cyt b mtDNA genes sequences in 26 individuals of Trionyx triunguis. DL: Dalyan, DM: Dalaman, AN: Anamur, KZ: Kazanlı, IS: Israel, AF: Africa. Polymorphic sites

Haplotypes

(TT-A1) (TT-A2) (TT-A3) (TT-A4) (TT-A5)

11111111111 1244445556788911222344445 179003350225725367168801491 232252600257657638487522641 AATGGATTAAGGGGGGGAAGGAATCGT GCCAA.CC.GAAAAAAAGGAAGCCTAC GCCAAGCC..AAAAAAA.G.AGCCTAC GCCAAGCC..AAAAAAAGG.AGCCTAC GCCAA.CCG.AAAAAAAGG.AGCCTAC

732 base pairs, respectively. Five mitochondrial DNA haplotypes were found, 4 of which are reported here for the first time (TT-A2-GU003980 for ND4, GU003977 for cyt b; TT-A3-GU003981 for ND4, GU003978 for cyt b; TT-A4-GU003981 for ND4, GU003979 for cyt b; TT-A5GU003982 for ND4, GU003979 for cyt b), while haplotype TT-A1 was identical with one previously reported by Engstrom et al. (2004). The identified new haplotypes have been deposited in GenBank. Nucleotide and haplotype diversity was 0.004 and 0.29, respectively. Twenty-seven polymorphic sites were detected, consisting of 25 transitions and 2 transversions (Table 1). According to the network analysis (Fig. 2) of 5 haplotypes (Posada and Crandall 2001), 2 highly divergent groups of haplotypes were supported. Of these, the African group (AF) comprised 4 different and newly described haplotypes, while the Mediterranean group (DL, DM, AN, KZ, IS) consisted of only 1 haplotype, TTA1. Apparently, haplotype TT-A1 is fixed to the Mediterranean region. Haplotype TT-A3 was identified as ancestral based on root probability density criterion (Templeton 1998). The nucleotide divergence between populations from the Mediterranean basin and continental Africa was 1.5% ± 0.7%. Discussion. — Our study represents the first assessment of genetic variation within T. triunguis. The existence of a single haplotype in the Mediterranean likely reflects migration among river systems through the sea, with gene flow among the populations studied. In fact, there are many records of T. triunguis being found well out to sea from the coasts of Africa and Turkey, in the Aegean and Mediterranean (Pritchard 1979; Tas¸kavak et al. 1999; Oruç 2001; Tas¸kavak and Akçınar 2008). The apparent interconnectedness of Turkish populations of T. triunguis may benefit regional conservation efforts since the translocation of individuals in headstarting or other release efforts may not suffer from inadvertent genetic pollution. Nevertheless, future studies using rapidly evolving markers from the nuclear genome (microsatellites) will be necessary to clarify this pattern. Maternally inherited markers showed strong population structure, suggesting isolation between Africa and the Mediterranean. This differentiation, as well as that among African

D L 3

D M 6

A N 4

K Z 3

I S 6

A F 1 1 1 1

populations, may reflect nest site fidelity, as is seen in various species of sea turtles (Bowen and Karl 1996). In sea turtles, females show strong philopatry (as evidenced by mtDNA), but this is not reflected in bisexually inherited nuclear markers. Additional studies using nuclear markers as well as known-provenance specimens from the sub-Saharan African continent are sorely needed. The recognition of distinct mitochondrial

Figure 2. Genealogical relationships among 5 haplotypes of T. triunguis estimated by TCS (Clement et al. 2000). Small, white circles represent hypothetical haplotypes not found in the sample.

NOTES AND FIELD REPORTS haplotypes from African specimens suggests that, with known locality material, it may be possible to genetically identify the provenance of trade specimens. In conclusion, all Mediterranean individuals of T. triunguis belong to same population, and these specimens are clearly different from those of ‘‘continental Africa’’ of unknown origin. Considering the widespread distribution of T. triunguis in large parts of Africa and the biogeographical circumstances there, the species may have more isolated populations, some possibly more isolated than the Mediterranean sample presented in this study, such as the Lake Turkana population. ACKNOWLEDGMENTS This study was supported by Adnan Menderes University, Institute of Natural Sciences Research Grant (FBE-08032). This research was approved by Adnan Menderes University Animal Experiments Ethic Committee. Specimens were collected with permission from the Republic of Turkey Ministry of Environment and Forestry. We would like to thank Paris Natural History Museum, France, especially Roger Bour, for providing us with T. triunguis specimens from Africa. The authors would like to thank James Parham for his valuable comments on an earlier version of the manuscript. LITERATURE CITED AREVALO, E., DAVIS, S.K., AND SITES, J.W. 1994. Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in central Mexico. Systematic Biology 43:387–418. ATATU¨R, M.K. 1979. Investigations on the morphology and osteology, biotope and distribution in Anatolia of Trionyx triunguis (Reptilia, Testudines) with some observations on its biology. Ege University Faculty of Science Monographs, Izmir, Turkey 18:1–75. BAHA ELDIN, S. 2006. A guide to the reptiles and amphibians of Egypt. American University in Cairo Press, 359 pp. BOWEN, B.W. AND KARL, S.A. 1996. Population structure, phylogeography, and molecular evolution. In: Lutz, P.L. and Musick, J.A. (Eds.). The Biology of Sea Turtles. Boca Raton, FL: CRC Press, pp. 29–50. CLEMENT, M., POSADA, D., AND CRANDALL K.A. 2000. TCS: a computer program to estimate gene genealogies. Molecular Ecology, 9:1657–1659. ENGSTROM, T.N., SHAFFER, H.B., AND MCCORD, W.P. 2002. Phylogenetic diversity of endangered and critically endangered southeast Asian softshell turtles (Trionychidae: Chitra). Biological Conservation, 104:173–179. ENGSTROM, T.N., SHAFFER, H.B., AND MCCORD, W.P. 2004. Multiple datasets, high homoplasy and the phylogeny of softshell turtles. Systematic Biology 53(5):693–710. EUROPEAN REPTILE AND AMPHIBIAN SPECIALIST GROUP. 1996. Trionyx triunguis. In: IUCN. 2008 IUCN Red List of Threatened Species. www.iucnredlist.org (24 November 2008). GIDIS¸, M. AND KASKA, Y. 2004. Population size, reproductive ecology and heavy metals in the nile soft-shelled turtle

225

(Trionyx triunguis) around thermal Ku¨ku¨rtlu¨ lake, Mug˘laTurkey. Fresenius Environmental Bulletin 13(5):405–412. GRAMENTZ, D. 1993. Beobachtungen und Untersuchungen zur ¨ kologie von Trionyx triunguis in WestEthologie und O Anatolien. Salamandra 29:16–43. GRAMENTZ, D. 1994. Zur thermoregulation von Trionyx triunguis am Ku¨ku¨rt Go¨lu¨ in West Anatolien. Salamandra 30:143–154. GRAMENTZ, D. 2005. Die Nilweichschildkro¨te Trionyx triunguis. Chimaira Vol. 24, Frankfurt am Main Edition. 166 pp. HALL, T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/ NT. Nucleic Acids Symposium Series 41:95–98. JUKES, T.H. AND CANTOR, C.R. 1969. Evolution of protein molecules. In: Munro, H.N. (Ed.). Mammalian Protein Metabolism. New York: Academic Press, pp. 21–132. KASPAREK, M. 1994. Die Nil-Weichschildkro¨te-eine stark bedrohte Reptilienart im Mittelmeergebiet. Herpetofauna 16:8– 13. KASPAREK, M. 2001. Towards an action plan for the conservation of the Nile soft-shelled turtle, Trionyx triunguis in the Mediterranean. Unpublished report to Council of Europe, Bern Convention, commissioned by MEDASSET. KASPAREK, M. AND KINZELBACH, R. 1991. Distribution and bionomics of the Nile soft-shelled turtle, Trionyx triunguis, in the eastern Mediterranean. Zeitschrift fu¨r angewandte Zoologie 78:137–159. LESHEM, A. AND D’mIEL, R. 1986. Water loss from Trionyx triunguis eggs incubating in natural nests. Herpetological Journal 1:115–117. MOLL, D. AND MOLL, E.O. 2004. The Ecology, Exploitation, and Conservation of River Turtles. Oxford: Oxford Univ. Press, 393 pp. NADA, M. 2002. An assessment of the Nile soft-shelled turtle, Trionyx triunguis, in the Nile Delta and its lagoons, Egypt. Commissioned by The Mediterranean Association to Save the Sea Turtles and supported by the British Chelonian Group. Final Report, 13 pp. NEI, M. 1987. Molecular Evolutionary Genetics. New York: Columbia Univ. Press. ORUÇ, A. 2001. Trawl fisheries in the eastern Mediterranean and their impact on marine turtles. Zoology in the Middle East 24: 119–125. POSADA, D. AND CRANDALL, K.A. 2001. Intraspecific gene genealogies: trees grafting into networks. Trends in Ecology and Evolution 16:37–44. PRASCHAG, P. AND GEMEL, R. 2002. Identity of the black soft-shell turtle Aspideretes nigricans (Anderson, 1875), with remarks on related species. Faunistische Abhandlungen 23:87–116. PRITCHARD, P.C.H. 1979. Encyclopedia of Turtles. Neptune, NJ: TFH Publications. ROZAS, J., SAŃCHEZ-DELBARRIO, J.C., MESSEGUER, X., AND ROZAS, R. 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19:2496–2497. SAMBROOK, J. AND RUSSELL, D.W. 2001. Molecular Cloning: A Laboratory Manual. Third edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. SCHLEICH, H.H., KA¨STLE, W., AND KABISCH, K. 1996. Amphibians and Reptiles of North Africa. Koenigstein: Koeltz, 627 pp. SHAFFER, H.B., MEYLAN, P., AND MCKNIGHT, M.L. 1997. Tests of turtle phylogeny: Molecular, morphological, and paleontological approaches. Systematic Biology 46:235–268. TAS¸KAVAK, E. AND AKÇINAR, S.C. 2008. Marine records of the Nile soft-shelled turtle, Trionyx triunguis from Turkey. JMBA2-Biodiversity Records (Published online, www.mba. ac.uk/jmba/pdf/6027.pdf).

226


AND


TAS¸KAVAK, E., REIMANN, M.J., AND POLDER, W.N. 1999. First record of Trionyx triunguis from Kos Island, Greece, with comments on its occurrence in the eastern Mediterranean. Chelonian Conservation and Biology 3(3):510–512. TEMPLETON, A.R. 1998. Nested clade analyses of phylogeographic data: testing methods about gene flow and population history. Molecular Ecology 7:381–397. TEMPLETON, A.R., CRANDALL, K.A., AND SING, C.F. 1992. A cladistic analysis of phenotypic associations with haplotypes inferred from restriction endonuclease mapping and DNA sequence data III. Cladogram estimation. Genetics 132:619–633. THOMPSON, J.D., HIGGINS, D.G. AND GIBSON, T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice. Nucleic Acids Research 22:4673–4680. TU¨RKOZAN, O. 2007. Trionyx triunguis, the Nile softshell turtle. Reptilia 55:17–23. TU¨RKOZAN, O. 2009. Status and conservation of the soft-shell turtle, Trionyx triunguis, in Turkey. Seventh Annual Symposium on Conservation and Biology of Tortoises and Freshwater Turtles, 5–8 August 2009, St. Louis, MO.

TU¨RKOZAN, O., ILGAZ, C ¸ ., AND YILMAZ, C. 2006. Reproductive ecology and hatchling morphology of the Nile soft shell turtle, Trionyx triunguis (Forsska˚l 1775), at Dalyan beach, Turkey. Russian Journal of Herpetology 13(1):47–52. VAN DER WINDEN, J., BOGAERTS, S., STRIJBOSCH, H., AND VAN DEN BERK, V. 1994. The Nile soft-shelled turtle, Trionyx triunguis, in the Go¨ksu Delta, Turkey. Zoology in the Middle East 10: 57–62. VENIZELOS, L. AND KASPAREK, M. 2006. Trionyx triunguis: the brackish water turtle that also lives in the Mediterranean Sea. In: Frick, M., Panagopoulou, A., Rees, A., and Williams, K. (Eds). Book of Abstracts—26th Annual Symposium on Sea Turtle Biology and Conservation, p. 168. WEISROCK, D.W. AND JANZEN, F.J. 2000. Comparative molecular phylogeography of North American softshell turtles (Apalone): implications for regional and wide-scale historical evolutionary forces. Molecular Phylogenetics and Evolution 14(1):152–164. Received: 10 August 2009 Revised and Accepted: 28 September 2009