Biosensors and Bioelectronics 49 (2013) 312–317
Contents lists available at SciVerse ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
Fluorogenic substrate screening for G-quadruplex DNAzyme-based sensors Yang Cai a, Nan Li a, De-Ming Kong a,b,n, Han-Xi Shen b a b
State Key Laboratory of Medicinal Chemical Biology, Nankai University, Tianjin 300071, PR China Key Laboratory of Functional Polymer Materials, Ministry of Education, Nankai University, Tianjin 300071, PR China
art ic l e i nf o
a b s t r a c t
Article history: Received 12 April 2013 Received in revised form 16 May 2013 Accepted 20 May 2013 Available online 29 May 2013
Due to the inherent higher sensitivity of fluorescence detection than colorimetric detection, it is necessary to screen out a suitable fluorogenic substrate for G-quadruplex DNAzymes to improve the sensitivities of G-quadruplex DNAzyme-based sensors. Herein, seven candidates were tested to determine the possibilities of them as fluorogenic substrates. Among these candidates, tyramine hydrochloride gave the maximum signal-to-background ratio for the sensing systems with and without G-quadruplexes, and thus was recommended as the fluorogenic substrate for the sensors that are developed on the basis of target-triggered G-quadruplex formation or destruction. 10-acetyl-3,7dihydroxyphenoxazine gave the maximum fluorescence signal change between the sensing systems without and with H2O2, thus was recommended as the fluorogenic substrate for the sensors targeting the detection of H2O2 or H2O2-related analytes. In a model system of G-quadruplex DNAzyme-based Cu2+ sensor, fluorescence detection using tyramine hydrochloride as fluorogenic substrate could decrease the detection limit from 4 nM to 0.7 nM compared with the colorimetric detection. & 2013 The Authors. Published by Elsevier B.V. Open access under CC BY license.
Keywords: G-quadruplex DNAzyme Fluorogenic substrate Screening Hemin
1. Introduction G-quadruplex DNAzymes, formed by nucleic acid Gquadruplexes binding with hemin, can exhibit peroxidase-like catalytic activity. Compared with traditional protein enzymes, such as horseradish peroxidase (HRP), G-quadruplex DNAzymes have the advantages of high thermal stability, cost-effectiveness and ease of modification. These advantages, combining with the flexibility of designing DNAzyme structure, make the DNAzymes be widely utilized in developing bio-analytical platforms. So far, Gquadruplex DNAzymes have been applied in analysis of metal ions (Kong et al., 2010a; Li et al., 2009a, 2009c, 2010; Lin et al., 2011; Zhou et al., 2010), DNA or RNA (Pavlov et al., 2004; Weizmann et al., 2006; Xiao et al., 2004), small molecules (Zhang et al., 2010; Li et al., 2007), proteins or enzymes (Li et al., 2008; Leung et al., 2011), and other analytes successfully. In these G-quadruplex DNAzyme-based sensors, colorimetric detection is the most common detection strategy. In general, G-quadruplex DNAzymes catalyze the H2O2-mediated oxidation of 2,2′-azinobis(3-ethylbenzothiozoline)-6-sulfonic acid (ABTS), and
n Corresponding author at: State Key Laboratory of Medicinal Chemical Biology, Nankai University, Tianjin 300071, PR China. Tel.: +86 22 23500938; fax: +86 22 23502458. E-mail address:
[email protected] (D.-M. Kong).
0956-5663 & 2013 The Authors. Published by Elsevier B.V. Open access under CC BY license. http://dx.doi.org/10.1016/j.bios.2013.05.034
the product ABTS●+ can be easily detected by measuring its absorbance at 420 nm (Li et al., 2009b). Although colorimetric detection is easy to be operated, and low cost UV-visible spectrophotometers make it acceptable by a broader spectrum of users, the color fading caused by the disproportionation of ABTS●+ (Kong et al., 2010b) and intrinsic lower sensitivity of colorimetric assay than fluorescence assay (Nakayama and Sintim, 2010) makes ABTS not a perfect substrate for G-quadruplex DNAzymes. Screening a suitable fluorogenic substrate is still necessary for developing highly sensitive G-quadruplex DNAzyme-based sensors. Fluorescence assay has been widely used in HRP-based sensors (Gorris and Walt, 2009; Ohta et al., 1992). G-quadruplex DNAzymes share the similar structure with HRP and also have peroxidase-like catalytic activity (Khan et al., 2009; Nakayama et al., 2011; Qiu et al., 2011; Zhang et al., 2011; Zhou et al., 2009). However, most of the fluorogenic substrates of HRP are not suitable for G-quadruplex DNAzyme-based sensors. The main reason is that free hemin can also efficiently catalyze the oxidation of these substrates by H2O2. Because most G-quadruplex DNAzyme-based sensors are developed on the basis of formation or destruction of G-quadruplexes in the presence of analytes, high catalytic ability of free hemin for fluorogenic substrates will provide the sensors with high background noises (Nakayama and Sintim, 2010). As a result, there has been no widely accepted fluorogenic substrate till now. To screen out a suitable fluorogenic substrate for G-quadruplex DNAzymes, free hemin or G-quadruplex DNAzyme-catalyzed oxidation reactions of seven candidate fluorogenic substrates, which have been used as fluorogenic substrates of HRP or/and G-quadruplex
Y. Cai et al. / Biosensors and Bioelectronics 49 (2013) 312–317
DNAzymes, were compared under their individual optimal conditions. The feasibility of the selected substrate, which had the maximum signal-to-background ratio, to enhance the sensitivity of G-quadruplex DNAzyme-based sensors was also demonstrated.
2. Experimental
313
Cu2+-mediated substrate strand cleavage reaction was conducted at 25 1C for 20 min. Then 1 μM hemin was added and the mixture was incubated at 25 1C for another 1 h. Afterward, 0.7 mM tyramine HCl and 2 mM H2O2 was added with a final volume of 100 μL. The fluorescence emission spectra were recorded by a RF-5301PC fluorescence spectrophotometer after the reaction had run for 5 min, and the emission intensity at 410 nm was used for quantitative analysis. All experiments were performed in triplicate.
2.1. Materials and reagents The oligonucleotides (GatG4: 5′-TGGGTAGGGCGGGTTGGGAAA; CatG4-M: 5′-TGTGTAGTGCGTGTTGTGAAA; Cu-S: 5′-TCCCAACATAACATATGCTTCTTTCTAATACGGCTTACCTGGGATGGGCGGGTTGGGA; Cu-E: 5′-GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC) were purchased from Sangon Biotech. Co. Ltd. (Shanghai, China). The concentrations of the oligonucleotides were all represented as single-stranded concentrations. Single-stranded concentration was determined by measuring the absorbance at 260 nm. Molar extinction coefficient was determined using a nearest neighbor approximation (http:// www.idtdna.com/analyzer/Applications/OligoAnalyzer). H2O2, Triton X-100, hemin, Tris (tris(hydroxymethyl) aminomethane), HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), tyramine hydro chloride (tyramine HCl), ADHP (Amplex Red, 10-acetyl-3,7-dihydroxyphenoxazine), HPPA (3-(4-hydroxyphenyl) propionic acid), MTCCA (1-methyl-1,2,3,4-tetrahydro-β-carboline-3-carboxylic acid), VB1 (thiamine hydrochloride), HVA (homovanillic acid, 4-hydroxy-3-methoxyphenylacetic acid), H2DCFDA (2′,7′-dichlorodihydrofluorescein diacetate) and the used metal salts (NaCl, KCl, NH4Cl, Cu(NO3)2, Cd(NO3)2, Co(NO3)2, CaCl2, Fe(NO3)3, Ni(NO3)2, ZnCl2, Pb(NO3)2, Hg(Ac)2, MgCl2, MnCl2) were all obtained from Sigma. All chemical reagents were analytical grade and used without further purification. The stock solutions of 10 mM tyramine HCl, HPPA, VB1, HVA in distilled water were stored at 4 1C. The stock solutions of 10 mM MTCCA, 4 mM ADHP, 1 mM H2DCFDA and 50 μM hemin were prepared in dimethylsulfoxide (DMSO) and stored at −20 1C. 2.2. Comparison of fluorogenic substrates by fluorescence analysis Taking tyramine HCl as an example, DNA solution (0.1 μM CatG4) was prepared in 50 mM Tris–HCl buffer (pH ¼ 7.5) containing 200 mM NH4+ and 0.002% (v/v) Triton X-100. In order to ensure the formation of G-quadruplex structure, the mixture was heated at 95 1C for 5 min, then cooled to 25 1C slowly and incubated at 25 1C for 30 min. Then, 20 nM hemin was added and the solution was incubated at 25 1C for another 30 min. 0.7 mM tyramine HCl and 0.2 mM H2O2 were added. The total volume of the mixture was 100 μL and all the concentrations mentioned above were final values. The fluorescence emission spectrum was recorded by a RF-5301PC fluorescence spectrophotometer (Shimadzu, Japan) after the reaction had run for 5 min. The emission intensity at 410 nm (λex ¼316 nm) was used for quantitative analysis. The slit sizes, excitation wavelengths and emission wavelengths of the seven candidate fluorogenic substrates were listed in Table 1, respectively. All experiments were performed in triplicate. 2.3. Fluorescence “turn-on” Cu2+ detection using tyramine HCl as G-quadruplex DNAzyme fluorogenic substrate The DNA mixture was prepared by mixing 0.2 μM of the enzyme strand (Cu-E) and 0.2 μM of the substrate strand (Cu-S) in 25 mM HEPES buffer solution (pH¼7.4) containing 200 mM NaCl and 0.002% (v/v) Triton X-100. The mixture was heated at 95 1C for 5 min, then cooled to 25 1C slowly and incubated for 1 h to ensure the annealing between the enzyme and substrate strands. Then, 50 μM ascorbic acid and different concentrations of Cu2+ were added.
3. Results and discussion 3.1. Seven candidates for the selection of fluorogenic substrate In this study, seven compounds, including tyramine HCl, HPPA, HVA, ADHP, MTCCA, VB1 and H2DCFDA (Fig. 1B), were used as candidates to select a suitable fluorogenic substrate for G-quadruplex DNAzymes. It has been proved that phenolic compounds (tyramine HCl, HPPA and HVA) can be oxidized to dimeric phenols by H2O2 with the catalysis of G-quadruplex DNAzyme or HRP (Fig. S1) (Nakayama and Sintim, 2010). G-quadruplex DNAzyme-catalyzed oxidation of ADHP will produce Amplex Red radical, which can subsequently transfer to fluorescent resorufin through dismutation (Gorris and Walt, 2009). In the presence of peroxidase-like G-quadruplex DNAzymes, non-fluorescent H2DCFDA, VB1, MTCCA can be oxidized into highly fluorescent dichlorofluorescein, thiochrome, 1-methyl-beta-carboline respectively (Bobbitt and Willis, 1980; Li et al., 2003; Zhou et al., 2009). Overall, all of these seven compounds have been reported as fluorogenic substrates of peroxidase, and some of them have been used in G-quadruplex DNAzyme-based sensors. 3.2. Optimization of reaction conditions for the seven fluorogenic substrates Most G-quadruplex DNAzyme-based sensors are designed on the basis of target-triggered formation or destruction of G-quadruplex structures, which can bind hemin to form peroxidase-like G-quadruplex DNAzymes. To obtain maximum signal-to-background ratio (F/F0), the background noise (F0), which is generated from free hemin-catalyzed oxidation of the candidate fluorogenic substrate, should be controlled at a low level. At the same time, the detection signal (F) that is generated from G-quadruplex DNAzyme-catalyzed sensing system, in which the G-quadruplex concentration is closely related to the amount of the detection target, should be as large as possible (Fig. 1A, Route I). Every candidate substrate has its own optimal reaction conditions. In order to equitably assess the feasibility of these seven candidates to be used as fluorogenic substrates of G-quadruplex DNAzymes, their individual optimal reaction conditions, including hemin concentration, buffer pH value, monovalent cationic ion type (NH4+/K+) and concentration, were investigated using F/F0 as criterion. The experimental details are shown in Figs. S1–S7. In these experiments, CatG4, a G-rich oligonucleotide that has been widely used in G-quadruplex DNAzyme studies, was used to form peroxidase-like G-quadruplex DNAzyme with hemin. The selected optimal conditions are listed in Table 1. The best pH value of these seven candidates were within the range of 7.0–8.0, which are all near physiological pH (pH≈7.4), thus greatly increasing the possibilities of these candidates to be used in G-quadruplex DNAzyme-based biosensors. Nakayama et al. demonstrated that NH4+ can increase the turnover numbers of G-quadruplex DNAzymes and enhance the initial rates of G-quadruplex DNAzymecatalyzed reactions (Nakayama and Sintim, 2009, 2010). Herein, we found that the reaction systems using these candidates as fluorogenic substrates could also gave larger F/F0 values in the presence
314
Y. Cai et al. / Biosensors and Bioelectronics 49 (2013) 312–317
Table 1 Individual instrument conditions and optimal reaction conditions for the seven candidate fluorogenic substrates and their use in CatG4 detection. Tyramine HCl
HPPA
HVA
ADHP
MTCCA
VB1
H2DCFDA
Instrument conditions
Ex slit (nm) Em slit (nm) λex (nm) λem (nm)
5 5 316 410
5 5 313 412
5 5 309 425
1.5 3 558 585
5 5 345 436
10 10 366 439
3 3 506 525
Optimized reaction conditions
Chemin (nM) pH Monovalent cationic ion Reaction time (min)
15 7.5–8.0 NH+ 4 200 mM 5
25 7.5 NH+ 4 250 mM 1.5
100 7.5–8.0 NH+ 4 200 mM 2
20 7.0 NH+ 4 200 mM 1.5
20 7.5 NH+ 4 250 mM 3
200 8.0 NH+ 4 250 mM 3
100 7.8 NH+ 4 250 mM 2.5
CatG4 detection
Linear range (nM) LOD (nM)
1–70 0.18
3–100 0.70
10–100 2.0
2–100 0.34
5–100 1.7
2–100 1.4
2–200 0.50
Fig. 1. The candidate fluorogenic substrates and the strategies for their evaluation. (A) Two routes for screening fluorogenic substrate. (B) Structures of the candidate fluorogenic substrates used in study.
Y. Cai et al. / Biosensors and Bioelectronics 49 (2013) 312–317
200 16
150
12
F/F0
3.3. Time-dependent oxidation of the candidate fluorogenic substrates
Tyramine HCl
250
Fluorescence
of NH4+ than in the presence of K+. It should be noted that adding a certain amount of K+ or Na+ to make a mixture of NH4+/K+ or NH4+/Na+ had no influence on the F/F0 values compared with that containing NH4+ only (Fig. S8). This result suggested that the presence of K+ or Na+ will not affect the use of these fluorogenic substrates in G-quadruplex DNAzyme-based sensors, thus will not limit the application scope of corresponding sensors.
315
100
3.4. Fluorescent detection of the model G-quadruplex CatG4 For the G-quadruplex DNAzyme-based sensors that are developed on the basis of target-triggered G-quadruplex formation or destruction, the target concentration is closely related to that of the Gquadruplex in the sensing system. In order to prove that the candidate fluorogenic substrates can be used for G-quadruplex DNAzyme-based sensor design, the sensitivities of G-quadruplex detection using these candidates as fluorogenic substrates were compared. In these experiments, CatG4 was used as a model G-quadruplex. In each sensing system, CatG4 concentration-dependent fluorescence increase was observed at the low concentration range, and reached a plateau at last (Fig. 2a and Fig. S10). A linear relationship was observed over a certain CatG4 concentration range. On the basis of 3s/S (s is the standard deviation of the blank samples, S is the slope of the calibration curve), the limits of detection (LOD) were calculated (Table 1). Among these seven fluorogenic substrates, tyramine HCl gave the highest signal-tonoise ratio and the lowest LOD (0.18 nM). This result further demonstrated that tyramine HCl would be the best choice for G-quadruplex DNAzyme-based fluorescent sensors.
0
0
R2 = 0.9960 LOD = 0.18 nM
4
50
0
50
0
10 20 30 40 50 60 70
100
150
200
CatG4 concentration (nM) 16 14 12 10
F/F0
As for the sensors that are developed on the basis of targettriggered formation of G-quadruplex DNAzymes, the signal of the sensing system containing free hemin but without G-quadruplexes should be considered as the background signal. To obtain the maximum signal-to-background ratio, the background should be controlled at a low level. That is to say, a perfect fluorogenic substrate should be non-reactive with H2O2 in the presence of free hemin but can be efficiently catalyzed by G-quadruplex DNAzymes (Fig. 1A, Route I). To compare the possibilities of these seven candidates to be used as fluorogenic substrates of G-quadruplex DNAzymes, the time-dependent fluorescence signal changes of individual candidate/H2O2 reaction systems in the presence of free hemin or CatG4/hemin complex were compared (Fig. S9). All of these candidates could be oxidized by H2O2 in the presence of free hemin, accompanied by the background fluorescence increase. Among these candidates, tyramine HCl, HPPA and VB1 could give stable background after the reaction had run for 1 min. However, the background fluorescence of the reaction systems containing HVA, ADHP, MTCCA or H2DCFDA increased continuously even after 5 min. In the presence of CatG4/hemin complex, much more significant time-dependent fluorescence increase was observed for all the seven candidates. Except MTCCA and H2DCFDA, other five could give stable fluorescence signals when the reactions had run for 5 min. Among these seven candidates, tyramine HCl gave the maximum signal-to-background ratio (F/F0 ¼ 15.3). ADHP gave the second large one (F/F0 ¼8.04). But because free hemincatalyzed ADHP could not give a stable background in 5 min, the maximum F/F0 value was obtained at about 1.5 min. After that, the F/F0 value continuously decreased with reaction time. That is to say, detection time must be strictly controlled when ADHP was used. Taking above-mentioned facts into consideration, we recommend tyramine HCl as the fluorogenic substrate for the sensors that are developed on the basis of target-triggered G-quadruplex formation or destruction.
8
No DNA 0.1 µM CatG4-M 0.1 µM CatG4
8 6 4 2 0
Tyramine HPPA HVA ADHP MTCCA VB1 H2DCFDA HCl
Different sensing systems Fig. 2. Fluorescent detection of CatG4. (a) CatG4 concentration-dependent fluorescence signal change of the sensing system. The insert shows the F/F0 change over CatG4 concentration range of 1–70 nM. The solid line represents the linear fit to the data. This figure shows the representative result of the sensing system using tyramine HCl as fluorogenic substrate. The results of other six candidate fluorogenic substrates were shown in Fig. S10. (b) Selectivity of the fluorescent sensors for CatG4 detection. The concentrations of CatG4 and CatG4-M were both 0.1 μM. All experiments were performed in triplicate.
For a reliable assay, it is necessary to demonstrate that the fluorescence increase is really caused by the presence of G-quadruplex rather than other DNA sequences. To demonstrate this, we designed CatG4-M. CatG4-M is a variant of CatG4, it cannot fold into a G-quadruplex structure. As expected, CatG4, which could coordinate with hemin to form catalytic G-quadruplex DNAzyme, made the fluorogenic substrates be oxidized into fluorescent products, accompanied by the fluorescence increase of corresponding reaction systems. On the contrary, the same concentration of CatG4-M nearly had no effect on the oxidation reactions as the fluorescence intensities remained unchanged compared with the blank controls containing free hemin only (Fig. 2b). That is to say, the fluorescence increase of the sensing system is CatG4specific, thus demonstrating that these fluorogenic substrates can be applied into G-quadruplex DNAzyme-based sensors. 3.5. Application of tyramine HCl in G-quadruplex DNAzyme-based Cu2+ sensor According to the experimental results mentioned above, tyramine HCl was recommended as the fluorogenic substrate for the sensors that are developed on the basis of target-triggered G-quadruplex formation or destruction. The above experiments used CatG4 as a model G-quadruplex. In fact, G-quadruplex DNAzymes are
Y. Cai et al. / Biosensors and Bioelectronics 49 (2013) 312–317
600
600
500
500
400 300
Cu2+
200
300 200 100
100 0
400 F/F0
Fluorescence
Fluorescence
316
0 360 380 400 420 440 460 480 500
wavelength(nm)
0
200
14 12 10 8 6 4 2 0
400
0
50
600
100
150
800
200
1000
Cu2+ Concentration (nM)
Fig. 3. The use of tyramine HCl in G-quadruplex DNAzyme-based Cu2+ sensor. (a) Working mechanism of the G-quadruplex DNAzyme-based Cu2+ sensor using tyramine HCl as the fluorescent signal producer. (b) Cu2+ concentration-dependent change in fluorescence spectra. The concentrations of Cu2+ were listed in the figure. (c) Cu2+ concentration-dependent change in the fluorescence signal at λ ¼ 410 nm. The insert shows the fluorescence signal change in the Cu2+ concentration range of 2–200 nM. The solid line represents a linear fit to the data. All experiments were performed in triplicate.
usually applied to design sensors for harmful heavy metals, proteins, DNA, RNA and other analytes. So it is necessary to demonstrate that tyramine HCl can also be used in complicated analysis cases. To demonstrate this, we used a G-quadruplex DNAzymebased Cu2+ sensor, which was reported by us recently (Zhang et al., 2012), as a model, the feasibility of using tyramine HCl in such a Cu2 + -sensing system was demonstrated. The working mechanism of this Cu2+ sensor was shown in Fig. 3a. The substrate strand (Cu-S) containing G-rich sequence folds into an intramolecular stem-loop structure, so that the G-rich sequence is partly caged in the doublestranded stem and cannot form G-quadruplex. The enzyme strand (Cu-E) associates with the substrate strand through a triple-helix region and a double-helix region to form substrate/enzyme complex. In the presence of Cu2+, the substrate strand is cleaved at the cleavage site. Stable intramolecular stem-loop structure transfers to less stable intermolecular duplex structure, resulting in the release of the G-rich sequence and the formation of G-quadruplex. The Gquadruplex binds with hemin to form G-quadruplex DNAzyme, which can catalyze the oxidation of tyramine HCl by H2O2, thus leading to the increase of fluorescence intensity. As shown in Fig. 3, the fluorescent intensity of the sensing system increased with Cu2+ concentration at low concentration range, and the growth slowed down above 500 nM. A linear relationship (R2 ¼ 0.9941) was observed over a range of 2–200 nM. The detection limit (3s/S) was calculated to be 0.7 nM. Considering that the presence of NH4+ could decrease the effective concentration of Cu2+, Na+ was used instead of NH4+ in this Cu2+-sensing system. Despite the fact that this is not the optimal condition for tyramine HCl, the detection limit given by fluorescent detection was also lower than our reported one (4 nM) when used ABTS as the colorimetric substrate, demonstrating that the use of fluorogenic substrate can really improve the sensitivity of Gquadruplex-based sensors. Compared with the other fluorescencebased sensors for Cu2+, this method using tyramine HCl was also outstanding for the sensitivity (Zhao et al., 2009; Liu and Lu, 2007; Wen et al., 2006; Qin et al., 2010; Wu and Anslyn, 2004) (Table S1). This G-quadruplex DNAzyme-based fluorescent Cu2+ sensor also displayed high selectivity against other metal ions. To demonstrate this, other 10 metal ions were individually added to the sensor solution, and fluorescence signal in the absence or presence of Cu2+ was measured. As shown in Fig. S11. In the absence of Cu2+, none of the tested metal ions could result in obvious fluorescence signal
increase. When 0.2 μM of Cu2+ and 2 μM of another metal ion were both added to the sensor solution, except that the solution containing Fe3+ and Cu2+ gave a little higher fluorescence signal, the fluorescence signals of other solutions all increased to levels similar to that given by Cu2+ alone, suggesting that the presence of these metal ions would not interfere the detection of Cu2+. The interference of Fe3+ was also found in our reported G-quadruplex DNAzyme-based Cu2+ sensor using ABTS as colorimetric substrate (Zhang et al., 2012), it may come from the effect of Fe3+ on the Cu2+-triggered cleavage of the substrate strand, but not from the effect on the oxidation of tyramine HCl by H2O2. 3.6. Fluorogenic substrate screening for G-quadruplex DNAzymebased sensors targeting detection of H2O2 or H2O2-related analytes Some G-quadruplex DNAzyme-based sensors aim at detection of H2O2 or H2O2-related analytes. A good example is G-quadruplex DNAzyme-based glucose oxidase sensor (Golub et al., 2011). For these sensors, the signals of the sensing systems without H2O2 should be considered as backgrounds (Fig. 1A, Route II). Correspondingly, the screening criterion of fluorogenic substrates should be different from that mentioned above. Therefore, fixing the concentrations of CatG4, hemin and individual fluorogenic substrates, the fluorescence signals of the sensing system with and without H2O2 were compared (Fig. 4). Among these fluorogenic substrates, ADHP gave the maximum fluorescence signal change (ΔF), and H2DCFDA gave the second large one. Considering that ADHP has a fast reaction kinetic (Fig. S9) and could give a large fluorescence signal change in a short time, we recommend it as the fluorogenic substrate for Gquadruplex DNAzyme-based sensors targeting the detection of H2O2 or corresponding analytes. The sensitivity of H2O2 detection using ADHP as fluorogenic substrate was tested. As shown in Fig. S12, the fluorescence signal increased with the increasing concentration of H2O2, and a good linear relationship (R2 ¼0.9944) between fluorescence signal and H2O2 concentration was observed over a range of 0.02–2 μM. The detection limit (3s/S) was estimated to be 14 nM, which was much lower than that of the colorimetric assay using ABTS as colorimetric substrate (Nakayama and Sintim, 2010). The experiments mentioned above showed that G-quadruplex DNAzyme-catalyzed H2DCFDA-H2O2 reaction had a slow reaction kinetic (Fig. S9), the fluorescence signal could not reach a stable level in
Y. Cai et al. / Biosensors and Bioelectronics 49 (2013) 312–317
317
Acknowledgment 300
Fluorescence
This work was supported by the Natural Science Foundation of China (No. 21175072), the National Basic Research Program of China (No. 2011CB707703), the National Natural Science Foundation of Tianjin (No. 12JCYBJC13300), the Fundamental Research Funds for the Central Universities and the Program for New Century Excellent Talents in University (NCET-10-0504) Chinese Ministry of Education.
Without H2O2 2 mM H2O2
250 200 150 100 50
Appendix A. Supporting information
0 Tyramine HPPA HCl
HVA
ADHP MTCCA
VB1 H2DCFDA
Different sensing systems 900
Without H2O2 2 mM H2O2
800
Fluorescence
700
70
600
60 50
500
40
400
30 20
300
10
200
0
100
Tyramine HPPA HCl
HVA
MTCCA VB1
0 Tyramine HPPA HCl
HVA
MTCCA
VB1
H2DCFDA
Different sensing systems
Fig. 4. Fluorescence signals of the sensing systems containing individual candidate fluorogenic substrates in the absence or presence of H2O2. (a) The excitation and emission slits were set as 3 nm. (b) The excitation and emission slits were set as 5 nm. The insert shows a more obvious comparison by resetting the y-axis range. [CatG4] ¼50 nM, [hemin] ¼20 nM, [substrate] ¼50 μM, [H2O2]¼ 2 mM, reaction time ¼ 5 min. All experiments were performed in triplicate.
a short time, so H2DCFDA is not suitable for fast analysis. With the prolonging reaction time, H2DCFDA could give a large fluorescence signal change. The fluorescence emitted by G-quadruplex DNAzyme-catalyzed H2DCFDA oxidation system could even be observed by the naked eyes under room-light (Fig. S13). That is to say, H2DCFDA can be used for H2O2 and corresponding analytes detection when fast detection is not required. 4. Conclusion For screening a suitable fluorogenic substrate for G-quadruplex DNAzyme-based sensors, G-quadruplex DNAzyme-catalyzed oxidations of seven candidates were compared by recording corresponding fluorescence signal change. Among these candidates, tyramine HCl gave the maximum signal-to-background ratio for the sensing systems with and without G-quadruplexes, and thus was recommended as the fluorogenic substrate for the sensors that are developed on the basis of target-triggered G-quadruplex formation or destruction. ADHP gave the maximum fluorescence signal change between the sensing systems with and without H2O2, thus was recommended as the fluorogenic substrate for the sensors targeting the detection of H2O2 or H2O2-related analytes.
Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.bios.2013.05.034.
References Bobbitt, J.M., Willis, J.P., 1980. Journal of Organic Chemistry 45, 1978–1984. Golub, E., Freeman, R., Niazov, A., Willner, I., 2011. Analyst 136, 4397–4401. Gorris, H.H., Walt, D.R., 2009. Journal of the American Chemical Society 31, 6277–6282. Khan, M.A., Jin, S.O., Lee, S.H., Chung, H.Y., 2009. Luminescence 24, 73–78. Kong, D.-M., Wang, N., Guo, X.-X., Shen, H.-X., 2010a. Analyst 135, 545–549. Kong, D.-M., Xu, J., Shen, H.-X., 2010b. Analytical Chemistry 82, 6148–6153. Leung, C.H., Chan, D.S., Man, B.Y., Wang, C.J., Lam, W., Cheng, Y.C., Fong, W.F., Hsiao, W.L., Ma, D.L., 2011. Analytical Chemistry 83, 463–466. Li, D., Shlyahovsky, B., Elbaz, J., Willner, I., 2007. Journal of the American Chemical Society 129, 5804–5805. Li, J.Z., Dasgupta, P.K., Li, G.G., 2003. Analytical Chemistry 75, 6753–6758. Li, T., Dong, S.J., Wang, E.K., 2009a. Analytical Chemistry 81, 2144–2149. Li, T., Li, B.L., Wang, E.K., Dong, S.J., 2009b. Chemical Communications 45, 3551–3553. Li, T., Wang, E.K., Dong, S.J., 2009c. Journal of the American Chemical Society 131, 15082–15083. Li, T., Wang, E.K., Dong, S.J., 2008. Chemical Communications 44, 3654–3656. Li, T., Wang, E.K., Dong, S.J., 2010. Analytical Chemistry 82, 1515–1520. Lin, H.X., Zou, Y., Huang, Y.S., Chen, J., Zhang, W.Y., Zhuang, Z.X., Jenkins, G., Yang, C. J., 2011. Chemical Communications 47, 9312–9314. Liu, J.W., Lu, Y., 2007. Journal of the American Chemical Society 129, 9838–9839. Nakayama, S., Sintim, H.O., 2009. Journal of the American Chemical Society, 10320–10333. Nakayama, S., Sintim, H.O., 2010. Molecular BioSystems 6, 95–97. Nakayama, S., Wang, J.X., Sintim, H.O., 2011. Chemistry: A European Journal 17, 5691–5698. Ohta, T., Yamauchi, Y., Takitani, S., 1992. Fresenius' Journal of Analytical Chemistry 343, 550–552. Pavlov, V., Xiao, Y., Gill, R., Dishon, A., Kotler, M., Willner, I., 2004. Analytical Chemistry 76, 2152–2156. Qin, H., Ren, J., Wang, J., Wang, E.K., 2010. Chemical Communications 46, 7385–7387. Qiu, B., Zheng, Z.-Z., Lu, Y.-J., Lin, Z.-Y., Wong, K.-Y., Chen, G.-N., 2011. Chemical Communications 47, 1437–1439. Weizmann, Y., Beissenhirtz, M.K., Cheglakov, Z., Nowarski, R., Kotler, M., Willner, I., 2006. Angewandte Chemie International Edition 45, 7384–7388. Wen, Z.-C., Yang, R., He, H., Jiang, Y.-B., 2006. Chemical Communications 42, 106–108. Wu, Q., Anslyn, E.V., 2004. Journal of the American Chemical Society 126, 14682–14683. Xiao, Y., Pavlov, V., Niazov, T., Dishon, A., Kotler, M., Willner, I., 2004. Journal of the American Chemical Society 126, 7430–7431. Zhang, Q., Cai, Y., Li, H., Kong, D.-M., Shen, H.-X., 2012. Biosensors and Bioelectronics 38, 331–336. Zhang, X.B., Wang, Z.D., Xing, H., Xiang, Y., Lu, Y., 2010. Analytical Chemistry 82, 5005–5011. Zhang, Y.F., Li, B.X., Jin, Y., 2011. Analyst 136, 3268–3273. Zhao, Y., Zhang, X.B., Han, Z.X., Qiao, L., Li, C.Y., Jian, L.X., Shen, G.L., Yu, R.Q., 2009. Analytical Chemistry 81, 7022–7030. Zhou, X.-H., Kong, D.-M., Shen, H.-X., 2010. Analytical Chemistry 82, 789–793. Zhou, Z.X., Du, Y., Zhang, L.B., Dong, S.J., 2009. Biosensors and Bioelectronics 34, 100–105.
