Formation of Shc/Grb2- Crk adaptor complexes ...

Oncogene (1996) 13, 381-389

©

1996 Stockton Press All rights reserved 0950-9232/96 $12.00

Formation of Shc/Grb2Crk adaptor complexes containing tyrosine CM upon stimulation of the antigen receptor der H o r s t a n d

Borst

Division of Cellular Biochemistry, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands

antigen receptor (BCR) stimulation induces tyrosine phosphorylation of the adaptor protein and its association with Grb2. The Shc/Grb2 complex may be involved in activation, since Grb2 interacts with the guanine nucleotide exchange factor Sos. We reveal here an additional complexity of the Shc/Grb2 complex: it contains tyrosine phosphorylated proteins of 130, 110 and 75 kDa. The 130 kDa molecule indueibly associates with while the 75 kDa protein interacts with the SH3 domain of Grb2. The 110 kDa molecule is defined as CM, the product of the oncogene, which is strongly phosphorylated on tyrosine upon BCR stimulation. CM interacts with the SH3 domains of Grb2, with a preference for the domain, and is in this way recruited to upon BCR stimulation. studies showed that Grb2-associated CM can be phosphorylated by BCR-induced tyrosine kinases independent of a Shc/Grb2 interaction. This indicates that the BCR can also couple to a complex without the involvement of not only interacts with Grb2, but also with the adaptor protein Crk. I n contrast to its constitutive interaction with Grb2, tyrosine-phosphorylated Cbl only associates with Crk after BCR stimulation. I n summary, we observe that the BCR activates Shc/Grb2-, Grb2- and Crk adaptor complexes of distinct composition, which may allow selective coupling to different signal transduction cascades. CM participates in all three adaptor complexes and is tyrosine phosphorylated upon BCR stimulation, pointing to a central role for this molecule in the regulation of antigen receptor-induced B responses. Keywords: B-cell antigen receptor; Cbl; Crk; Ras activation

adaptor protein;

Introduction The B-cell antigen receptor (BCR) complex is composed of membrane bound immunoglobulin in association with a of CD79a and CD79b proteins (also called Mb-1/B29 or Activation of B cells via the BCR initiates signalling pathways that regulate gene rearrangement, cell proliferation, differentiation and survival (reviewed in Borst et 1993). Despite lack of intrinsic tyrosine kinase activity, the BCR signals according to the receptor tyrosine kinase principle (Gold et 1990). This occurs by virtue of its association with Correspondence: J Borst Received 18 December 1995; revised 16 A p r i l 1996; accepted 16 A p r i l 1996

cytoplasmic protein tyrosine kinases (PTK) (Campbell and Sefton, 1990; Yamanashi et 1991) and the presence of tyrosine motifs (Reth, 1989) in the cytoplasmic tails of CD79a/b, which are phosphorylated upon receptor stimulation. Members of three Srchomology 2 (SH2)-domain containing P T K families transduce signals from the activated BCR: the Srckinases (Campbell and Sefton, 1990; Yamanashi et 1991), Syk (Hutchcroft et al, 1991) and Btk (Aoki et al, 1994; Saouaf et 1994; de Weers et 1994). SH2-domain containing enzymes that are tyrosine phosphorylated upon triggering include (Carter et 1991) and -2 (Coggeshall et al, 1992), PI3 kinase (Gold et al, 1992; Yamanashi et al, 1992) , Ras-Gap (Gold et al, 1993) and Vav (Bustelo and Barbacid, 1992). The BCR has also been shown to activate Ras (Harwood and Cambier, 1993). Various receptor P T K , such as the growth factor receptor, can activate Ras via the adaptor proteins and Grb2 (Buday and Downward, 1993; Egan et al, 1993; L i et al, 1993; Rozakis-Adcock et al, 1992). Grb2 contains one SH2 domain flanked by two SH3 domains (Lowenstein et al, 1992), which constitutively interact with the nucleotide exchange factor Sos (Buday and Downward, 1993; Chardin et al, 1993; Egan et al, 1993; L i et al, 1993). Receptor tyrosine kinase activity results in recruitment of to the autophosphorylated receptor via its SH2 domain. Tyrosine phosphorylation of in turn allows its association with the SH2 domain of Grb2. Shc/Grb2 association is thought to recruit Sos to the plasma membrane, allowing it to activate Ras. Cytokine receptors (Cutler et al, 1993), the T cell antigen receptor (TCR) (Ravichandran et al, 1993) and the BCR (Lankester et al, 1994; Saxton et al, 1994; Smit et al, 1994), which all activate cytoplasmic PTK, also induce formation of a Grb2 complex containing Sos, and may therefore activate Ras in an analogous manner. However, direct interaction of the Shc/Grb2 complex with the activated receptors could not be demonstrated in all cases. I n addition to mediating Sos translocation, both and Grb2 can associate with other proteins, a number of which show a restricted tissue distribution. I n hematopoietic cells, i n the case of cytokine receptor(Liu et al, 1994), TCR- (Reif et al, 1994) and BCR (Lankester et al, Saxton et al, 1994; Smit et al, 1994) activation, associates with a 130-145 k D a protein. I n TCR-activated T lymphocytes, Grb2 was found to interact with three tyrosine phosphorylated proteins: a 36 kDa molecule which binds to the SH2 domain et al, Sieh et al, 1994), a 75 kDa molecule associating with both SH3 domains (Reif et al, 1994) and a 116 kDa molecule interacting with the amino-terminal SH3 domain (Motto et al, 1994). The

Composition of B

receptor-induced

Grb2- and

L Smit et al

382 k D a molecule is most likely identical to the product of the proto-oncogene (Blake et al., which was recently shown to interact with Grb2 (Fukazawa et 1995; Meisner et 1995). The oncogene was first identified as component of a murine retrovirus that induced pre-B cell lymphomas (Langdon et al., 1989). Deletion mutations affecting a specific amino acid region of Cbl unmask its transforming capacity, which is accompanied by its constitutive phosphorylation on tyrosine (Andoniou et al., 1994). I t has recently been demonstrated that Cbl is a substrate for tyrosine kinase activity exerted by HG Fand receptor tyrosine kinases (Bowtell et 1995; Meisner and Czech 1995; Galisteo et 1995; Tanaka et al., 1995) and for P T K activity induced by the receptor (Tanaka et al., 1995), T C R (Donovan et 1994; Reedquist et 1994) and BCR (Cory et 1995; this paper). I n T cells, Cbl has been shown to interact with the tyrosine kinases Zap-70 and Fyn (Fournel et al, 1996). We had previously found tyrosine phosphorylated proteins of 75, 130 k D a in the BCR-induced Grb2 complex et 1994). Here, we identify the protein as Cbl, which is strongly phosphorylated on tyrosine upon BCR stimulation, Cbl not only participates in a Shc/Grb2 complex, but also in Sheindependent Grb2- and Crk adaptor complexes of distinct composition, suggesting a role in the regulation of multiple BCR-induced signalling events.

Mr (kDa)

0

15

200-

97 68-

43 -

29 -

aShc

alg

Mr (kDa)

-200

-97

Results

-68

BCR stimulation induces a Grb2 complex containing tyrosine phosphorylated She and 75, 110 and 130 kDa molecules Stimulation of the BCR on Ramos cells induces tyrosine phosphorylation of the 52 and 46 kDa proteins within 5 min as demonstrated by anti-phosphotyrosine immunoblotting (Figure 1A). I n addition, tyrosinephosphorylated proteins of approximately 130, and 75 coprecipitate with after BCR triggering (Figure Stimulation of the BCR on Ramos B cells induces association of and Grb2, as shown by antiShe immunoblotting on an anti-Grb2 immunoprecipitate (Figure Immunoblotting with specific antibodies failed to identify as CD22, PI3 kinase, pl30Cas (Sakai et al, 1994) or FakB (Runner et al, 1994). Similarly, p75 did not react with anti-Syk or -Btk reagents (data not shown). is the c-cbl proto-oncogene product, which constitutively interacts with Grb2 I n T cells, the 120 kDa Cbl protein was found to be a major target for tyrosine phosphorylation induced by TCR triggering (Donovan et al, 1994) and to interact with Grb2 (Donovan et al, 1994; Meisner et al, 1995). Therefore, we tested whether the kDa tyrosine phosphorylated protein associated with Grb2 in activated B cells is identical to Cbl. Anti-She and -Grb2 precipitates from resting and activated Ramos cells were probed with serum, using an antiimmunoprecipitate as a positive control (Figure 2A). Cbl was found to constitutively interact with

Figure 1 After B C R stimulation, Grb2 is associated with tyrosine phosphorylated and proteins o f 130, and 75 k D a . B cells were untreated (— ) or incubated with polyclonal reagent for ( + ). Cell lysates were precleared w i t h normal rabbit serum and subjected to immunoprecipitation w i t h anti-She and anti-Grb2 sera. Precipitated proteins were separated by S D S - P A G E and immunoblotted w i t h anti-She serum or antiphosphotyrosine m A b 4G10 (aPY). The 46 k D a form is difficult to see, since it co-migrates with the heavy chain

Grb2, whereas its association with was induced by BCR stimulation (Figure 2A). To determine which domain of the Grb2 protein might be responsible for interaction with Cbl, GST/ Grb2 fusion proteins were used, comprising either full length Grb2, the SH2 domain, or one of the SH3 domains. Molecules isolated with these fusion proteins from lysates of resting and BCR-activated Ramos cells were separated by S D S - P A G E and probed with antiCbl serum (Figure 2B). This experiment revealed that Cbl constitutively binds to the SH3 domains of Grb2, with a preference for the amino-terminal domain. Anti-phosphotyrosine immunoblotting clearly demonstrated that BCR stimulation induces tyrosine phosphorylation of Cbl (Figure 2C). Together, these results demonstrate that the k tyrosine-phos-

Composition of B cell receptor-induced L Smit et al

phorylated protein associated with Grb2 in activated B cells is identical to Cbl. Cbl constitutively interacts with Grb2 SH3 domains. Upon BCR stimulation, Cbl is phosphorylated on tyrosine and recruited to by Grb2 (Figure 7).

a

aShc

aGrb2

NRS

! alg

(kDa)

- 9 7 - 6 8

- 4 3

and

Cbl inducibly associates with Crk upon BCR stimulation As shown in Figure 2C, we found that the Crk adaptor also participates in a BCR-induced signalling pathway. Anti-phosphotyrosine immunoblotting on anti-Crk precipitates from resting and stimulated B cells showed that a k D a tyrosine phosphorylated molecule is associated with Crk in BCR-activated cells. BCR stimulation did not induce tyrosine phosphorylation of the 40 or 42 k D a Crk forms (Matsuda et 1992, 1994) (Figure 2C). Immunoblotting with anti-Cbl serum revealed that the kDa protein is identical to Cbl, which inducibly associates with Crk upon BCR stimulation (Figure 3A). This induced association is strikingly different from the constitutive interaction between Cbl and Grb2. Possibly, tyrosine-phosporylated Cbl interacts with the SH2 domain of Crk.

29

aCrk

NRS

FL-Grb2

b

alg

SH3-N

SH2

SH3-C

GST

- +

Mr (kDa)

+

(kDa) -200 200-97 -68

-Cbl 97-

-43 43-

aCbl

aGrb2

aShc

aCrk

NRS aCbl

alg

+

(kDa) a-Crk

p130-97

Mr

+

(kDa)

p52Shc-43

-200 -97 -68

aPY -43

Figure 2 10 is the C b l protein, which interacts w i t h the SH3 domains o f Grb2 i n resting and activated B cells. (A) Cbl constitutively interacts w i t h endogenous Grb2 and inducibly associates w i t h The Cbl protein was identified i n anti-She and anti-Grb2 immunoprecipitates from resting and activated Ramos B cells by anti-Cbl immunoblotting. Cbl was positively identified by anti-Cbl immunoprecipitation. N R S = normal rabbit serum precipitate. (B) Cbl associates with Grb2 SH3 domains. Lysates from untreated ( — ) or stimulated ( + ) Ramos cells were incubated w i t h GST or with fusion proteins composed o f GST and full length ( F L ) Grb2, the amino-terminal SH3 domain (SH3N ) , the SH2 domain, or the carboxy-terminal SH3 domain (SH3C). Samples were resolved by S D S - P A G E , transferred to nitrocellulose and immunoblotted w i t h anti-Cbl serum. (C) Cbl is tyrosine phosphorylated upon B C R stimulation and comigrates w i t h phosphoproteins associated with Grb2 and Crk i n activated B cells. Anti-She, -Grb2, -Crk, -Cbl and N R S immunoprecipitates from resting and activated B cells were separated by S D S - P A G E and immunoblotted with 4G10 antiphosphotyrosine m A b

18

Immunoblotting

a-Crk

Figure 3 Crk inducibly associates w i t h Cbl, independent of or Grb2. Ramos cells were untreated (— ) or treated ( + ) with reagent and N R S , anti-Crk and immunoprecipitates were resolved by S D S - P A G E and transferred to nitrocellulose. (A) Immunoblotting with anti-Cbl serum on antiCrk and N R S immunoprecipitates. (B) Immunoblotting w i t h antiCrk m A b on anti-Crk and anti-She immunoprecipitates

Composition of B cell receptor-induced

Grb2- and L

384 a-Grb2 a-Grb2 NRS

et al re-IP

aShc

aShc Mr

alg

+ -200

p130-97 -68

(kDa)

a-Shc

-200

a-Grb2

NRS

alg

(kDa)

-97 -68

p52Shc-43 After 5th

After 5th

Depletion

Depletion

-200

-43

p130-

Figure 4 Grb2-associated Cbl is coupled to BCR signalling independent o f She. Ramos cells were untreated ( — ) or stimulated with reagent ( + ) and Lysates were directly used for the relevant or first depleted for protein by five subsequent precipitations with anti-She serum. NRS-, anti-Grb2and anti-She immunoprecipitates analysed were derived from Shedepleted or non-depleted lysates as indicated. Samples were separated by S D S - P A G E and transferred to nitrocellulose. Tyrosinephosphorylated proteins were detected by immunoblotting with 4G10 m A b

-97

-68

p52Shc

>

'

-43

Although interaction between and Crk has been reported (Matsuda et al., it did not take place in B cells. Crk could not be found in anti-She immunoprecipitates from either resting or activated B cells (Figure I n addition, Crk was not detected in anti-Grb2 immunoprecipitates (results not shown). We conclude that Cbl can be tyrosine phosphorylated and recruited to Crk upon BCR stimulation, independent of or Grb2 (Figure 7). Grb2-associated Cbl is tyrosine phosphorylated upon BCR stimulation independent of In E G F receptor signalling, Grb2 can couple the receptor to signal transduction pathways without the involvement of (Buday and Downward, 1993). Therefore, we determined whether BCR stimulation induces the association of tyrosine phosphorylated proteins with Grb2 in the absence of Grb2 was precipitated from Ramos B cell lysates either before or after exhaustive immunoprecipitation with anti-She serum. depletion was confirmed by subsequent anti-She immunoprecipitation (Figure 4). Anti-phosphotyrosine immunoblotting revealed Cbl as the major phosphoprotein in a Grb2 complex derived from activated B cells, whereas and were minor components (Figure 4; identity of and Cbl was confirmed by immunoblotting, as shown in Figures 1 and 2A). I n anti-She immunoprecipitates from activated B cells, is the major phosphoprotein (apart from (Figure 4). Upon removal of from the lysates, was selectively lost from the Grb2 immunoprecipitate. This indicates that is recruited to Grb2 by virtue of its interaction with I n activated B cells, a complex of tyrosine-phosphoryCbl and Grb2 remained after depletion. This indicates that Grb2-associated Cbl can be phosphorylated by BCR-activated kinases independent of a Grb2 interaction. Like receptor P T K , the BCR appears to couple directly to a Grb2 complex without the involvement of (Figure 7).

-29 p26-

Figure 5 inducibly associates with p l 3 0 and a 26 k D a protein upon B C R stimulation. Ramos cells were labelled metabolically w i t h and -cysteine. Prior to ( — ) , or after B cell activation with anti-Ig reagent ( + ), lysates were prepared, precleared with normal rabbit serum (NRS; not shown) and w i t h anti-She serum. Part o f the anti-She precipitate was analysed directly. Part was used for reprecipitation (re-IP) w i t h N R S , followed by anti-Grb2 serum, or anti-Crk serum (data not shown). A l l samples were analysed by SDS-PAGE

pl30 inducibly associates with stimulation

upon BCR

The results depicted in Figure 4 strongly suggest that does not directly associate with Grb2, but is recruited to Grb2 after BCR stimulation by virtue of its interaction with Since the identity of is unknown, we could not determine by immunoblotting whether its interaction with is constitutive or induced by BCR stimulation. To resolve this question, cells were labelled biosynthetically with and -cysteine and anti-She immunoprecipitates from stimulated and non-stimulated B cells were analysed by S D S - P A G E . This experiment revealed that proteins of 26and 23 k D a inducibly associate with the p52 and p46 species upon BCR stimulation (Figure 5). As expected, the 23 k D a molecule could be reprecipitated with anti-Grb2 serum, confirming successful B cell

Composition of B cell receptor-induced L et al

Grb2- and

385 MR (kDa)

200-p130 97-

-Cbl

68-

-p75

43-

29-

aPY

domains and fails to purify Sos (Reif et 1994). I f Grb2 is isolated with this peptide, only the SH2 domain remains available for interaction with other proteins. The EGFR-Y1068 phosphopeptide corresponds to the tyrosine site Tyr1068 in the carboxy-terminal tail of the F receptor, which binds the SH2 domain of Grb2. This peptide leaves the SH3 domains of Grb2 available for interaction with other proteins. The Sos-P (S) and EGFR-Y1068 (E) peptides recovered equivalent amounts of Grb2 from cell lysates (Figure 6B). As shown in Figure 6A, the Sos-P peptide (S) primarily precipitated tyrosine phosphorylated and from activated B cells, while the peptide (E) primarily precipitated Cbl and to a lesser extent pl30, p75 and (Figure 6A). We conclude that Cbl and p75 interact with the SH3 domains of endogenous Grb2. and the associated bind to the Grb2 SH2 domain in activated B cells, but they also associate to some extent with Grb2 SH3 domain(s).

Mr (kDa)

Discussion 6843-

29-

-Grb2

18-

Figure 6 Identification of proteins that interact w i t h SH3 or SH2 domains o f endogenous Grb2. Ramos cells were untreated (— ) or activated w i t h anti-Ig reagent ( + ). EGFR-Y1098 (E) and Sos-P (S) peptides were used to isolate Grb2, and CD79a (C) peptide was used for control precipitation. Samples were separated by S D S - P A G E and immunoblotted with anti-phosphotyrosine m A b 4G10 (A) or w i t h anti-Grb2 serum (B). The 170 k D a tyrosine phosphorylated protein recovered w i t h the peptides i n this experiment was not routinely seen i n anti-Grb2 precipitates

activation. The 26 kDa molecule did not react with anti-Grb2 or anti-Crk reagent and its identity remains unknown. The kDa molecule most likely corresponds to as identified in the experiments outlined above. Since p l 3 0 was only found in a complex derived from activated B cells, we conclude that stimulation induces its association with (Figure 7). Cbl and p75 bind to

domains of endogenous Grb2

I n Figure 2B, we have established that Cbl interacts with the SI domains of Grb2 fusion proteins. To determine how Cbl and the p75 phosphoprotein associate with endogenous Grb2, specific peptides were used to isolate Grb2 from activated B cell lysates. The synthetic Sos-P proline rich peptide corresponds to a sequence in the carboxy-terminal tail of Sos and binds to both SH3 domains of Grb2. The Sos-P peptide precipitates Grb2 via its SH3

Activation of the BCR on B lymphocytes induces tyrosine phosphorylation of the 52- and 46 k D a proteins (Lankester et al., 1994; Saxton et al., 1994; et 1994). Evidence has been provided that phosphorylation is mediated by the cytoplasmic P T K Lyn and Syk, which are activated by the BCR (Nagai et 1995). Engagement of 19 together with the BCR enhances phosphorylation (Lankester et al., 1994) and may involve the kinases (van Noesel et al, 1993). I n T cells, simultaneous triggering of the T C R and CD4 induces phosphorylation (Ravichandran et al, 1993). Here, TCR-associated Src-kinases and Zap-70, as well as CD4-associated Lck might be responsible for phosphorylation. As in receptor tyrosine kinase signalling, might interact with the tyrosine phosphorylated BCR complex by means of its SH2 domain. Although a SH2 domain fusion protein can associate with the tyrosine-phosphorylated CD79a/b heterodimer (Bauet al, we could not detect such an interaction in vivo. A proportion of the pool translocates to the plasma membrane upon stimulation (Lankester et al, 1994; Smit et al, unpublished results), suggesting that interacts either directly or indirectly with a molecule at this location. Possibly, associates via its SH2- or phosphotyrosine binding domain (PTE) and Williams, 1994) with tyrosine-phosphorylated Syk (Nagai et al, 1995). Similarly, the observed association of with the chain of the TCR/CD3 complex (Ravichandran et al, 1993) may have been mediated by the Zap70 P T K . Alternatively, tyrosine phosphorylated may provide a docking site for is not a transmembrane molecule, since it was found both in and membrane-associated complexes (Smit et al, unpublished result). I t did not react with antisera directed against CD22, pl20Ras-Gap, PI3 kinase, or FakB. L i u et al. (1994) have observed a 145 kDa tyrosine phosphorylated molecule, which associates with


Grh2- and L

et al

386 upon cytokine receptor stimulation. Evidence was presented that p contains an SH2 domain and competes with for the same binding site on (Liu et al., 1994). This is not the case for pl30, since the Sos-P peptide precipitated a Grb2 pool, which was associated with both and c D N A cloning must resolve whether and are identical and clarify the function of these proteins. Upon tyrosine phosphorylation, associates with the Grb2 SH2 domain, as described for other receptor systems (Rozakis-Adcock et al., 1992; Ravichandran et 1993). I n line with published findings (Chardin et al., 1995), we observed that can also associate with SH3 domains of Grb2 both in vivo (Figure 6A) and in vitro (results not shown). The significance of this interaction remains to be established. stimulation induces the formation of a Grb2-Sos complex (Lankester et Saxton et 1994). One of the functions of Shc/Grb2 association may therefore be the activation of Ras. However, we demonstrate that Grb2 SH3 domains also interact with p75, which may play another role. p75 may be identical to the 75 tyrosine phosphorylated protein observed in TCR-activated cells ( Reif et al., 1994), since it has not only the same mass, but also the same binding specificity for the carboxy-terminal domain of Grb2 (Smit et al., unpublished result). c D N A encoding a 76 Grb2-associating protein (SLP-76) was recently isolated. I t encodes a novel 533-amino acid protein with one SH2 domain and several motifs that might interact with SH2 and SH3 domains (Jackman et 1995). Whether this molecule is identical to p75 identified in our experiments remains to be established. We initially described a kDa tyrosine phosphorylated protein as component of the complex et al., 1994), which is defined here as Cbl (Blake et al., 1991). Cbl is tyrosine phosphorylated upon BCR stimulation (Cory et 1995; this paper) and constitutively interacts with Grb2 SH3 domains, with a preference for the amino-terminal domain. Similarly, in T cells, Cbl was identified as a major substrate for TCR-induced tyrosine phosphorylation and associates with a Grb2-SH3 domain (Donovan et al, 1994; Reedquist et al, 1994). We detected Cbl not only in Shc/Grb2 and Grb2 complexes, but also i n a Crk complex. While Cbl constitutively associates with Grb2, its interaction with Crk is induced by BCR stimulation. The association of tyrosine phosphorylated Cbl with Crk may involve an interaction with the Crk SH2 domain. This observation also places the Crk adaptor in a BCR-induced signalling cascade. I n an interesting analogy, T C R stimulation in T cells induces association of Crk with tyrosine phosphorylated 16, which was postulated to be related to pl30Cas or Cbl (Sawasdikosol et al, 1994). The activates Shc/Grb2-, Grb2- and Crk adaptor complexes of different composition (Figure 7), which may couple the receptor to different signalling cascades. Cbl appears to be associated with all three adaptor complexes (Figure 7), and may therefore have a central role in the regulation of these BCR-induced signal transduction pathways. I t is of obvious interest to determine which signalling events

Resting

Activated BCR

=08

Grb2/Shc

Grb2

SH2 Crk SH3-N SH3-C

Crk

Figure 7 Formation of three different adaptor protein complexes upon stimulation of the B C R i n human B cells Y tyrosine phosphorylation

are initiated by the Shc/Grb2-, Grb2- and Crk adaptor complexes and to establish how Cbl may be involved in their was identified as the transforming gene of a murine retrovirus, which induces pre-B cell lymphomas and myeloid leukemias (Langdon et al, 1989). The c-cbl product is a cytoplasmic protein, which contains a nuclear localization signal in its amino-terminal region, a Z n finger domain, a proline rich region and a putative carboxy-terminal leucine zipper (Blake et al, 1991). A mutated version of c-cbl, lacking 17 amino acids amino-terminal to the Zn finger region, has transforming properties (Andoniou et al, 1994). This mutant protein is constitutively phosphorylated on tyrosine, suggesting that Cbl phosphorylation is linked to normal and malignant cell growth (Andoniou et al, 1994) . Cbl was shown to interact in vivo with the and (Andoniou et al, 1994). could also phosphorylate Cbl in transfected cells (Andoniou et al, 1994). Since and also induce B and myeloid malignancies, and Cbl may lie in the same signal transduction pathway. We and others have demonstrated that Cbl is phosphorylated upon stimulation of the BCR. The responsible kinase is not yet known, but Cbl has also been shown to interact in vitro with the Bruton's tyrosine kinase (Cory et al, 1995) . I n T lymphocytes, an interaction with Fyn and Zap-70 has been shown (Fournel et al, 1996). I n addition, Cbl was found in association with the subunit of kinase ( K i m et al, 1995; Hartley et al, 1995; Fukuzawa et al, 1995).


In C elegans,

was recently identified as the c(Yoon et 1995). Interestingly, sli-1 is a regulator of the Let-23 receptor tyrosine kinase pathway, which involves Grb2 and Ras Our findings strongly suggest that Cbl and Sos can participate i n the same Grb2 complex. We hypothesize that BCR-induced Cbl phosphorylation affects Sos function and therewith regulates Ras activity. I n addition, Cbl may have other targets and regulate other cellular responses by participation in a Crk adaptor complex.

Materials and methods Cells The human Burkitt lymphoma lines Ramos and Daudi, which are mature B cell lines expressing transmembrane immunoglobulin M , were cultured in Iscove's modified Dulbecco's medium (IMDM) supplemented with 5% fetal calf serum (FCS). Prior to stimulation with anti-Ig reagents, the cells were incubated for 30 in serum free I M D M at 37°C. Antibodies Polyclonal rabbit anti-Grb2 and sera were raised against a fusion protein of glutathione (GST) and the complete Grb2 protein and against a fusion protein of GST and the domain, respectively (Pronk et al, 1994). Polyclonal goat anti-human Ig reagent (TAGO Immunologicals, Burlingame, CA) was used for B cell stimulation. The anti-phosphotyrosine monoclonal antibody (mAb) was purchased from Upstate Biotechnology Lake Placid, NY). Protein A, conjugated to horseradish peroxidase, was obtained from Sigma and horseradish peroxidase-conjugated rabbit anti-mouse Ig from DAKO (Glostrup, Denmark). The anti-Crk I , I I mAb was purchased from Transduction Labs (Lexington, Kentucky). The R2 anti-Cbl polyclonal antiserum was prepared by Blake et al. (1991). The anti-pl30Cas serum was kindly provided by Dr H Hirai (University of Tokyo, Tokyo, Japan), and the anti-FakB serum by dr SB Kanner (Bristol-Myers Squibb, Seattle, WA). Peptides and plasmids The EGFR-Y1068 phosphopeptide has the sequence PVPEY (phosphate)INQS and was kindly provided by Dr DA Cantrell (Imperial Cancer Research Fund, London, UK). The Sos-P peptide was synthesized in our laboratory and has the sequence SKGTDEVPVPPPVPPRR, which corresponds to amino acids at the carboxyterminus of The CD79a peptide, TYQDVGN, was kindly provided by Dr A Venkitaraman (MRC, Cambridge, U K ) . cDNA encoding the separate Grb2 domains were synthesized by PCR on the murine Grb2 cDNA template (kindly provided by Dr JL Bos, Utrecht University, Utrecht, The Netherlands) using the following primers: sense (5'-AGACGGATCCGAAGCCATCGCCAAATATGACT-3') and anti-sense (5'-AGACGAATTCTCACGGATGTGGTTTCATTTCTAT-3') for the amino-terminal SH3 domain (SH3-N), sense (5'-AGACGGATCCATGAAACCACATCCGTGGTTT-3') and anti-sense GTCGGCTGCTGTGG-3') for the SH2 domain, sense - AGACGGATCCACATACGTCCAGGCCCTCTTTG3') and anti-sense (5'-AGACGAATTCTTAGACGTTCCGGTTCACGGGGGTG-3') for the carboxy-terminal SH3

Grb2- and

(SH3-C). The PCR products and the full length Grb2 cDNA were cloned into the pGEX bacterial expression plasmid, which contains the GST gene (Smith et al, 1988). Bacterial GST/Grb2 fusion proteins were expressed in E and affinity purified with glutathione-Sepharose beads (Pharmacia, Uppsala, Sweden) as described (Smith et al, 1988).

Metabolic labelling For labelling with radioactive amino acids, Ramos cells were washed twice in phosphate-buffered saline (PBS) and incubated with 250 of a 1 mixture of and -cysteine at cells/ml in methionine- and cysteine-free 1640 medium (Gibco, Paisley, Scotland) containing 10% dialyzed FCS at for 6 h. After washing, Ramos cells at were stimulated for 5 with polyclonal goat anti-human Ig at 20 Cells were washed twice in ice-cold PBS and in 1% Nonidet P-40 (NP-40) containing lysis buffer, consisting of 30 Tris.HCl, pH 7.5, 150 1 EDTA, 1 m M phenylmethylsulfonyl fluoride, 0.1 pM aprotinin, 1 pM leupeptin, 1 m M sodium orthovanadate and 10 m M sodium fluoride. Lysates were cleared by for min at 13 000 g and by six incubations with normal rabbit serum and protein A-Sepharose CL-4B beads. protein was immunoprecipitated for 2 h at 4°C with 1 of anti-She serum and of protein A-Sepharose CL-4B beads, for cells/sample. Immunoprecipitates were washed in lysis buffer with NP-40, eluted and denatured in sample buffer (60 m M Tris.HCl pH 6.8, 10% glycerol, 2% SDS, 5% at 95°C for 5 and resolved by SDS-PAGE. For re-precipitation, the immunoprecipitate was boiled for 5 in 30 lysis buffer with 1% NP-40 and 5% SDS. After centrifugation, the supernatant was diluted with 2 ml 1 % NP-40-containing lysis buffer and 5 pg RNAse was added as carrier protein. The supernatant was precleared with normal rabbit serum, followed by incubation with 1 anti-Grb2 serum or 1 anti-Crk mAb and protein A-Sepharose CL-4B beads.

Immunoblotting After stimulation with goat anti-human Ig as indicated above, cells were washed twice in ice-cold PBS and solubilized in 1% NP-40-containing lysis buffer. Lysates were cleared by centrifugation and by two incubations with normal rabbit serum and protein A beads. After immunoprecipitation, samples, representing x 106 cells, were resolved by SDS-PAGE and electrophoretically transferred to nitrocellulose. For anti-Crk, anti-Sos, anti-She and anti-Cbl immunoblots, membranes were blocked for 2 h in PBS, 0.2% Tween-20 (PBS/T) and 2% non-fat milk. For anti-phosphotyrosine blots using 4G10 mAb, blocking was performed with 1% phosphotyrosine-free BSA (Sigma) in PBS/T for 2 h at 4°C. Filters were incubated with the indicated primary antibodies at a serum dilution of in PBS/T, 0.1% BSA for 6 h at 4°C, washed three times with PBS/T, and incubated with horseradish peroxidase-conjugated secondary antibody or -protein A in PBS/T for 2 at 4° C . Filters were washed three times in PBS/T, and visualization was performed by enhanced chemiluminescence (Amersham, U K ) .

Protein isolation with bacterial fusion proteins and peptides Cells were stimulated and lysed as described above. The lysates (from 5 x cells) were incubated with 2 pg GST fusion protein for 2 h at 4° C , followed by addition of 5 glutathione-Sepharose beads and incubation for 1 h at


Grb2- and L

et al

4° C . For precipitation with the Sos-P and CD79a peptides, 1 mg peptide was coupled to 200 beads (BioRad, Richmond, CA). Precipitation was performed with peptide-coupled beads and precipitates were washed four times in 1% NP-40containing lysis buffer. After separation by SDS-PAGE, proteins were transferred to nitrocellulose and detected with the indicated antibodies as described above.

Acknowledgements This work was supported by grant from the Netherlands Organization for Scientific Research. We thank Ir L Vernie and R van der Valk for peptide synthesis, dr H Hirai for providing us with the anti30Cas serum, dr SB Kanner for the anti-FakB serum, dr JL Bos for the Grb2 cDNA and dr DA Cantrell for the peptide.

References

Andoniou CE, Thien CBF and Langdon WY. (1994). EMBO J., 13, 4515-4523. Aoki Y, Isselbacher KJ and Pillai S. (1994). Natl. Acad. Sci. USA, 91, 10606-10609. Baumann G, Maier D, Freuler F, Tschopp C, Baudisch K and Wienands J. (1994). Eur. J. Immunol., 24, 17991807. Blake TJ, Shapiro M , Morse I I I HC and Langdon WY. (1991) . Oncogene, 6, 653-657. Borst J, Brouns GS, de Vries E, Verschuren M C M , Mason DY and van Dongen (1993). Immunol. Rev., 132, 49-84. Bowtell D D L and Langdon WY. (1995). Oncogene, 11, 1561-1567. Buday L and Downward J. (1993). Cell, 73, 611-620. Buday L, Egan SE, Rodriguez Viciana P, Cantrell D A and Downward J. (1994). J. Biol. 269, 9019-9023. Bustelo XR and Barbacid M . (1992). Science, 256, 11961199. Campbell M A and Sefton BM. (1990). Cell. 12, 2315-2321. Carter Park DJ, Rhee SG and Fearon DT. (1991). Proc. Natl. Acad. Sci. USA, 88, 2745-2749. Chardin P, Camonis JH, Gale NW, van L, Schlessinger J, Wigier M H and Bar-Sagi D. (1993). Science, 260, 1338-1343. Chardin P, Cussac D, Maignan S and Ducruix A. (1995). letters, 369, 47-51. Coggeshall K M , McHugh JC and Altman A. (1992). Proc. Natl. Acad. Sci. USA, 89, 5660-5664. Cory GOC, Lovering RC, Hinshelwood S, MacCarthyMorrogh L, Levinsky RJ and Kinnon C. (1995). Exp. Med., 182, 611-615. Cutler RL, Liu L, JE and Krystal G. J. Biol. 268, 21463-21465. de Weers.'M, Brouns GS, Hinshelwood S, Kinnon C, Schuurman RKB, Hendriks RW and Borst J. (1994). J. Biol. Chem., 269, 23857-23860. Donovan JA, Wange RL, Langdon WY and Samelson LE. (1994). J. Biol. Chem., 269, 22921-22924. Egan SE, Giddings BW, Brooks MW, Buday L, Sizeland A M and Weinberg RA. (1993). Nature, 363, 45-51. Fournel M , Davidson D, Weil R and Veillette A. (1996). J. Exp. Med., 183, 301-306. Fukuzawa T, Reedquist K A , T, Soltoff S, Panchamoorthy G, Druker B, Cantley L, Shoelson SE and Band H. (1995). ./. Biol. Chem., 270, 19141-19150. Galisteo M L , Dikic I , Batzer AG, Langdon WY, singer J. (1995). J. Biol. Chem., 270, 20242-20245. Gold MR, Chan VW-F, Turck CW and DeFranco A L . (1992) . J. Immunol, 148, 2012-2022. Gold MR, Crowley MT, Martin GA, McCormick F and DeFranco A L . (1993). J. Immunol, 150, 377-386. Gold MR, Law D A and DeFranco A L . (1990). Nature, 345, 810-813. Hartley D, Meisner H and Corvera S. (1995). J. Biol. Chem., 270, 18260-18263. Harwood AE and Cambier JC. (1993). J. Immunol, 151, 4513-4522.

JE, Harrison M L and Geahlen RL. (1991). J. Biol. Chem., 266, 14846-14849. Jackman JK, Motto DG, Sun Q, Tanemoto M . Turck CW, GA, Koretzky GA and Findell PR. (1995). J. Biol. Chem., 270, 7029-7032. Kanner SB, A and Chan P-Y. (1994). Proc. Natl. Acad. Sci. USA, 91, 10484-10487. Kavanaugh W M and Williams (1994). Science, 266, 1862-1865. Kim TJ, Kim Y T and Pillai S. (1995). J. Biol. Chem., 270, 27504-27509. Langdon WY, Hartley JW, Klinken SP, Ruscetti SK and Morse HC. (1989). Proc. Natl. Acad. Sci. USA, 86, 1172. Lankester AC, van GMW, Rood PML, Verhoeven AJ and van Lier RAW. Eur. J. Immunol., 24, 2818-2825. Li N , Batzer A, Daly R, Yajnik V, Skolnik E, Chardin P, Bar-Sagi D, Margolis B and Schlessinger J. (1993). Nature, 363, 85-87. Liu L, Damen JE, Cutler RL and Krystal G. (1994). Cell. 14, 6926-6935. Lowenstein EJ, Daly RJ, Batzer AG, Li W, Margolis B, Lammers R, Ullrich A, Skolnik EY, Bar-Sagi D and Schlessinger J. (1992). Cell, 70, Matsuda M , Hashimoto Y, Muroya K, Hasegawa H , Kurata T, Tanaka S, Nakamura S and Hattori S. (1994). Mol. Cell. Biol, 14, 5495-5500. Matsuda M , Tanaka S, Nagata S, A, Kurata T and Shibuya M . (1992). Mol. Cell. 12, 3482-3489. Meisner H , Conway BR, Hartley D and Czech MP. (1995). Cell. 15, 3571-3578. Meisner H and Czech MP. (1995). J. Biol. Chem., 270, 25332-25335. Motto DG, Ross SE, Jackman JK, Sun Q, Olson A L , Findell PR and Koretzky GA. (1994). J. Biol. Chem., 269, 21608-21613. Nagai K, Takata M , H and Kurosaki T. J. Biol. Chem., 270, 6824-6829. van Noesel CJM, Lankester AC, van Schijndel GMW and van Lier RAW. (1993). Int. Immunol, 5, 699-705. Pronk GJ, De Vries-Smits A M M , Downward J, Maassen JA, RH and Bos JL. (1994). Mol. Cell. 14, 1575-1581. Ravichandran KS, Kay Lee K, Songyang Z, Cantley LC, Burn P and Burakoff SJ. (1993). Science, 262, 902-905. Reedquist K, Fukazawa T, Druker B, Panchamoorthhy G, Shoelson S and Band H. (1994). Proc. Natl. Acad. Sci. USA, 91, 4135-4139. Reif K, Buday L, Downward J and Cantrell DA. (1994). J. Biol. Chem., 269, 14081-14087. Reth M . (1989). Nature, 338, 383. Rozakis-Adcock MR, McGlade J, G, G, Daly R, Li W, Batzer A, Thomas S. Brugge J, Pellici PG, Schlessinger J and Pawson T. (1992). Nature, 360, 689692. Sakai RA, Iwamatsu N , Hirano S, Ogawa T, Tanaka H , Mano Y, Yazaki and Hirai H . (1994). J., 13, 3748-3756.


Saouaf SJ, Mahajan S, Rowley RB, Kut SA, Fargnoli J, Burkhardt A L , Tsukada S, Witte ON and JB. (1994). Proc. Natl. Acad. Sci. USA, 91, 9524-9528. Sawasdikosol S, Ravichandran KS, Lee K K , Chang J-H and Burakoff SJ. (1994). / . Biol. Chem., 270, 2893-2896. Saxton T M , van Oostveen I , Bowtell D, Aebersold R and Gold (1994). J. Immunol, 153, 623-636. Sieh M , Batzer A, Schlessinger J and Weiss A. (1994). Cell. 14, 4435-4442. Smit L, de A M M , Bos JL and Borst J. (1994). J. Biol. Chem., 269, 20209-20212.

Grb2- and

389 Smith DB and Johnson KS. (1988). Gene, 67, 31-40. Tanaka S, Neff L, Baron R and Levy JB. (1995). J. Biol. Chem., 270, 14347-14351. Yamanashi Y, Y, Wongsasant B, Kinoshita Y, Ichimori Y, Toyoshima K and Yamamoto T. (1992). Proc. Natl. Acad. Sci. USA, 89, 1118-1122. Yamanashi Y, T, Mizuguchi J, Yamamoto T and Toyoshima K. (1991). Science, 251, 192-194. Yoon CH, Lee J, Jongward GD and Sternberg PW. (1995). Science, 269, 1102-1105.