1348
Wing et al.
Eur. J. Immunol. 2015. 45: 1348–1353
DOI: 10.1002/eji.201445020
SHORT COMMUNICATION
Germ-free mice deficient of reactive oxygen species have increased arthritis susceptibility Kajsa Wing1 , Katrin Klocke1 , Annika Samuelsson2 and Rikard Holmdahl1 1
Medical Inflammation Research, Department of Biochemistry and Biophysics, Karolinska Institute, Stockholm, Sweden 2 Department of Microbiology, Tumor and Cell Biology, Karolinska Institute, Stockholm, Sweden The NADPH oxidase 2 (NOX2) complex is responsible for the production of ROS in phagocytic cells. Genetic defects in NOX2 lead to opportunistic infections and inflammatory manifestations such as granulomas in humans, also known as chronic granulomatous disease (CGD). This condition is mirrored in mice with defective ROS production and interestingly both species are predisposed to autoimmune diseases. An unresolved question is whether the hyper-inflammation and tendency to develop autoimmunity are secondary to the increased infections, or whether these are parallel phenomena. We generated germ-free ROS deficient Ncf1 mutant mice that when reared in specific pathogen-free condition, are highly susceptible to collagen-induced arthritis compared with wild-type mice. Strikingly, arthritis incidence and severity was almost identical in germ-free and specific pathogen-free ROS-deficient mice. In addition, partial reduction of the microbial flora by antibiotics treatment did not alter the disease course. Taken together, this shows that ROS has a clear immune regulatory function that is decoupled from its function in host defence.
Keywords: Animal models Rheumatoid arthritis
r
Chronic granulomatous disease
r
Host defence
r
NOX2 ROS
r
Additional supporting information may be found in the online version of this article at the publisher’s web-site
Introduction Patients suffering from chronic granulomatous disease (CGD), a primary immune deficiency, lack phagocyte oxidative burst as they carry mutations in one of the subunits of the phagocyte NADPH oxidase 2 (NOX2) complex [1]. This results in recurrent life threatening bacterial and fungal infections but the disease is also characterized by hyper-inflammation and autoimmunity such as inflammatory bowel disease (IBD), systemic lupus erythematosus, and lupus like symptoms, diabetes type 1, and polyarthritis [2–7]. Thus, while CGD patients clearly have problems to regu-
Correspondence: Prof. Rikard Holmdahl e-mail:
[email protected] C 2015 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
late a normal microbial flora they also suffer from conditions that may not directly link to infections, which indicates an additional immune regulatory role of ROS. We have previously demonstrated the importance of a functional NOX2 complex for arthritis resistance in rodents [8, 9]. Mice with a spontaneous single nucleotide mutation in the Ncf1 gene (referred to as Ncf1*/* ) have a defective production of ROS in phagocytes and are predisposed to development of collageninduced arthritis (CIA). The Ncf1 protein, also known as p47phox , is one of five subunits of the NOX2 complex, responsible for generating superoxide anions that serve as precursors of ROS. The Ncf1 mutated mouse is susceptible to microbial infections and is sporadically infected by normally harmless agents such as Staphylococcus xylosus and Staphylococcus aureus and also more sensitive to Aspergillus fumigatus, all common pathogens in CGD www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 1348–1353
Cellular immune response
Figure 1. Collagen-induced arthritis (CIA) in Ncf1 mutated mice housed in germ-free (GF) or specific pathogen-free (SPF) environment. (A–C) Mice were immunized with collagen type II and boosted 35 days later. (A) Mean arthritis score and (B) incidence of CIA in B10.Q.Ncf1** male and female mice housed GF or SPF compared with ROS producing B10.Q.Ncf1+ controls was measured. (A and B) Data are shown as ± SEM (n = 6–10 mice/group) and are pooled from two separate CIA experiments. Statistical significance was calculated between Ncf1*/* and Ncf1+ littermates using Mann–Whitney U test in (A) and Fishers exact test in (B). * p < 0.05 ** p < 0.01 represent comparisons between GF groups and # p < 0.05, ## p < 0.01 comparisons between SPF groups. (C) Representative sections of ankle joints from mice (n = 3 mice/group) stained with hematoxylin and erythrosine, depicted in 100× magnification.
patients [10, 11]. It is believed that an increased pathogen load could lead to autoimmune inflammatory manifestations such as IBD. Alternatively, it is possible that the genetic defects in parallel cause both increased infection susceptibility and inflammatory hypersensitivity. In CGD the causative genetic defect is well known and the availability of an excellent and well-characterized animal model provides an opportunity to resolve this question. Therefore to investigate a potential causative role for the commensal flora in ROS-deficient autoimmunity, Ncf1*/* , and wild-type mice were re-derived in germ-free condition and subjected to CIA.
Results and discussion ROS-deficient mice develop CIA in germ-free condition To investigate the impact of the commensal microbial flora on arthritis susceptibility in ROS-deficient mice, C57BL/10.Q Ncf1*/* , and C57BL/10.Q Ncf1+/+ wild-type mice were transferred from our specific pathogen free (SPF) mouse colony to the germ-free research facility by caesarean section. The colony was established by heterozygote parental breeding generating Ncf1 homozygote
C 2015 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
mutants, Ncf1 heterozygotes and Ncf1 homozygote wild types. The latter two groups were pooled and used as the C57BL/10.Q wild-type control group denoted Ncf1+ since one Ncf1 wild-type allele rescues ROS production [12]. We first determined that na¨ıve germ-free (GF) Ncf1*/* and Ncf1+ littermates displayed similar frequencies of CD4+ T cells, CD8+ T cells, Foxp3+ regulatory T cells, B220+ , or CD11b+ cells with similar proliferation status, i.e. Ki67 expression (Supporting Information Table 1). Next, GF male and female Ncf1*/* and Ncf1+ littermates were subjected to CIA with parallel experiments run SPF. Strikingly, irrespective of housing condition, male Ncf1*/* mice developed disease with the same 100% incidence and time course (Fig. 1A, B). Ncf1+ littermate controls also developed arthritis but with a significantly lower incidence that reached 20% in both GF and SPF males. As previously observed, female C57BL/10.Q mice were less susceptible to CIA compared with males. Histopathological analysis showed synovium hyperplasia and pannus formation accompanied by severe cartilage and bone erosion in both GF and SPF Ncf1*/* mice (Fig. 1C). Furthermore we were recently able to show that NOX2 deficiency in both humans and mice result in a type 1 interferon response signature that was reproduced in GF Ncf1*/* mice, which makes it of endogenous origin [13]. Taken together this
www.eji-journal.eu
1349
1350
Wing et al.
Figure 2. T- and B-cell responses to CII in specific pathogen-free (SPF) or germ-free (GF) ROS-deficient B10.Q.Ncf1*/* and wild-type B10.Q.Ncf1+ male mice after CIA induction. (A and B) The T-cell response against CII259-273 peptides was determined by enzyme-linked immunospot assays for (A) IL-17 and (B) IFN-γ. Spleen and lymph node cells were pooled and restimulated in vitro with unmodified CII peptide (K264), CII peptide glactocylated on hydroxylysine at position 264 (GalHyK264) or Concaviline A (ConA). (C–F) Serum antibody (Ab) levels were determined using ELISA for total (C) anti-CII Abs (C), (D) anti-PPD Abs, (E) anti-CII IgG1, IgG2b, IgG2c isotypes, and (F) Abs toward the two main B-cell CII-epitopes. (A–F) Data are shown as mean +SEM ((A and B) n = 6–10; (C–F) n = 7–9 mice/group) and are pooled from two independent experiments. Statistics were calculated between Ncf1*/* and Ncf1+ littermates using Mann–Whitney U test, * p < 0.05 represent comparison between GF groups and ## p < 0.01 comparisons between SPF groups.
shows that similar disease pathways are operating in ROS deficient Ncf1*/* mice irrespectively of housing condition and that these are de-coupled from the microbial flora.
Germ-free ROS-deficient mice raise T- and B-cell responses to collagen type II To further investigate disease pathology we compared the T-cell recall response to heterologous rat CII in GF and SPF male mice by ELISpot after 9 weeks of CIA (Fig. 2A, B). The immunodominant T-cell CII259-273 epitope contains two lysine residues at positions 264 and 270, which can be posttranslationally modified by hydroxylation and subsequent glycosylation. As expected, the T-cell response was highest toward the CII peptide with a monosaccharide attached to hydroxylysine at position 264 (GalHyK), with a lower response to naked peptide (K264) [14]. Notably, CII-specific T cells from both SPF and GF Ncf1*/* and Ncf1+ wild-type mice produced IFN-γ and IL-17. This is different to recent reports from spontaneous IL-17-dependent arthritis C 2015 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Eur. J. Immunol. 2015. 45: 1348–1353
models, which rely on the normal microbiota to produce IL-17 and are protected when GF [15, 16]. However here, in CIA, no major differences in disease development or IL-17 production between GF and SPF mice were seen and although this is the first time CIA has been performed in GF mice the results are in line with previous studies on oil induced arthritis and CIA in gnotobiotic dark agouti rats [17–19]. In Ncf1*/* mice serum levels of anti-CII Abs are typically enhanced around disease onset, but later decrease [8, 12]. In line with this, our serum samples taken late in disease, show a trend toward higher titres of total anti-CII Abs in GF Ncf1*/* mice compared with controls (Fig. 2C). The result was partly reproduced in the IgG1, IgG2b, and IgG2c anti-CII Ab response (Fig. 3E) and in the response to the two main CII epitopes C1 and U1 [20] (Fig. 3F). In addition both SPF and GF Ncf1*/* mice produced a significantly higher Ab response to purified protein derivative (PPD) compared with controls albeit at similar level in both conditions (Fig. 3D). Previous studies show that conventionally kept Ncf1*/* mice have more severe arthritis accompanied by an increased adaptive response compared with controls [8, 12]. Similarly, although the adaptive response could not be fully confirmed, this study show that GF Ncf1*/* mice maintain their increased arthritis susceptibility compared with ROS producing controls.
CIA in C57BL/10.Q Ncf1*/* mice is not affected by antibiotics treatment It has been shown that partial depletion of the microbiota by orally administered antibiotic Baytril (enrofloxacin) can increase CIA severity in DBA/1 mice [21]. To investigate if a sudden change in microflora affected CIA in C57BL/10.Q Ncf1*/* mice this experiment was reproduced. However, no significant difference in disease severity or incidence could be seen neither for ROS deficient nor sufficient mice when antibiotic treated and nontreated mice were compared (Fig. 3 A, B). Antibiotics treated and control mice raised a similar T- and B-cell response and Ncf1*/* mice had significantly more GalHyK264 peptide-reactive IL-17 producing T cells day 11 after immunization during the priming phase as well as a higher anti-CII Ab response day 54 compared withNcf1+/+ controls (Fig. 3C–E). There was no difference in the general frequency of IL-17 producing αβ T cells, and the frequency of CD3+ γδ T cells in lymph nodes was not markedly different (Fig. 3F–G, Supportive information Fig. 1). These results differ from previous data [21], which could possibly be attributed to different local flora in respective SPF facility or simply to different genetic background as the disease course is faster in DBA/1 compared with B10.Q mice.
Concluding remarks This study shows, for the first time, that the increased CIA susceptibility of ROS-deficient mice is not dependent on the commensal www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 1348–1353
Cellular immune response
Figure 3. Collagen-induced arthritis (CIA) in antibiotics treated Ncf1 mutated mice and wild-type controls in specific pathogen-free (SPF) environment. (A–H) Male mice were treated with antibiotics and then immunized with collagen type II and boosted 35 days later. (A) Mean arthritis score and (B) incidence of CIA in B10.Q.Ncf1** and Ncf1++ males given plain water or antibiotics was measured. (C and D) T-cell response of lymph node cells against unmodified CII peptide (K264), CII peptide glactocylated on hydroxylysine at position 264 (GalHyK264) or Concaviline A (ConA) was determined by enzyme-linked immunospot assays for (C) IL-17 and (D) IFN-γ after immunization in antibiotics treated and nontreated mice. (E) Serum levels of anti-CII antibodies in antibiotics treated and nontreated mice were determined by ELISA. (F and G) Flow cytometric analysis of lymph node cells from antibiotics treated and nontreated mice were performed to analyze the frequency of (F) CD3+ γδ T cells and (G) CD4+ IL-17+ T cells after immunization in. (H) 16S rRNA expression was quantified by band area in paired samples from six mice before and after antibiotics treatment. (A–H) Data are shown as mean ±SEM ((A and B and E) n = 9–14 mice/group; (C and D) n = 6–12 mice/group) and are representative of one experiment except (C and D) that are pooled data of two independent experiments. Statistics were done between Ncf1*/* and Ncf1+ mice using Mann–Whitney U test (A, C, E), Fishers exact test (B) and Wilcoxon sign rank test (H). * p < 0.05 represent comparisons between antibiotics treated groups and # p < 0.05 represent comparisons between water groups.
bacterial flora. Previous studies have shown that ROS operates also in an adjuvant-free model on DBA/1 background [22]. Together this strongly emphasize that ROS has an immunological role beyond host defence. For example, butyrate a bacterial fermentation product produced in the gastrointestinal tract by commensals can induce ROS in intestinal epithelial cells and suppress the NF-kB pathway [23]. In this case ROS would be part of the steadystate immune regulation and one may speculate that lack of such a mechanism could contribute to the IBD commonly seen in CGD patients. Since CIA incidence and severity was almost identical in GF compared with SPF wild-type mice, ROS deficiency in the
C 2015 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
gut likely has limited impact on joint inflammation in this model. Rather, it is likely the T-cell priming with CII that takes place in the joint draining lymph nodes that is affected. This is dependant on ROS-producing macrophages since mice are rescued from arthritis by specific expression of Ncf1 in CD68+ macrophages [24]. Since CIA is T-cell dependant in Ncf1*/* mice, although T cells themselves fail to produce ROS in our hands, it is reasonable to think that the T cells get exposed during antigen presentation. Such an exposure may lead to downregulation of T-cell activation pathways and a reduction in the adaptive immune response thereby raising the threshold for aberrant immune activation [25].
www.eji-journal.eu
1351
1352
Wing et al.
Eur. J. Immunol. 2015. 45: 1348–1353
Materials and methods
Enzyme-linked immunospot assay
Animals
Splenocytes and lymph node cells (inguinal, axillary, and popletal) were pooled after 9 weeks of CIA in GF and SPF mice while in antibiotics experiments lymph node cells were obtained day 11 after immunization. Individual samples were tested with ELISpot as previously described [26].
All mice were genetically controlled and shared the C57BL/10 background expressing the H2-Aq haplotype, referred to as B10.Q mice. Ncf1 mutated mice (Ncf1m1J/m1J denoted as Ncf1*/* ) have been described previously [8]. Germ-free mice were housed and bred at the Core Facility for Germ-Free Research, Karolinska Institute. Bacterial growth in faeces was negative and determined weekly. All procedures were approved by the local research ethics committee.
Arthritis induction and evaluation CIA was induced as previously described [8]. Arthritis was monitored macroscopically, i.e. each swollen or red toe or knuckle equals 1 point and each swollen ankle or wrist equals 5 points, with a max score of 60 points/mouse. All experiments were blinded. Due to their delayed development germ-free mice were 14–18 week old at the start of the experiment while conventional mice were 10–14 week old.
Antibiotics treatment A range of 11–12–week-old male mice received either drinking R vet (Bayer Healthcare, water containing 0.27 mg/mL of Baytril Monheim, Germany) or plain water. The treatment continued for a total of 3 weeks. After 2 weeks CIA was performed in accordance with previously published methods [21]. Bacterial contents of feces were analyzed after DNA extraction with PowerSoil DNA isolation kit (Mo Bio Laboratories, Carlsbad, CA). 16S rRNA was amplified by PCR from 50 ng of DNA (16S-UF: AGAGTTTGATCCTGGCTCAG, 16S-UR: GACGGGCGGTGWGTRCA). The products were visualized on agarose gel and quantified by ImageJ software.
Enzyme-linked immunosorbent assay Serum was analyzed for anti-CII Abs by ELISA as previously described [26]. Briefly, serum was titrated (1:200–1:3 × 105 ) in parallel to standard. Total anti-CII antibody levels were determined as μg/mL using pooled polyclonal anti-CII serum of known concentration. For the PPD response plates were coated with 10 μg/mL Tuberculin PPD (Statens Serum Institute, Copenhagen, Denmark) and serum was diluted 1:20, followed by the same procedure as for total anti-CII Ab ELISA. Isotype, epitope, and PPD responses were determined as arbitrary units using the same serum pool.
Histology After 9 weeks of CIA hind paws were dissected and fixed in 4% paraformaldehyde and decalcified in a solution containing formic acid and paraformaldehyde after which paws were dehydrated and embedded in paraffin. Sections of 5 μm were cut and stained with hematoxylin and eosin.
Statistics Data was analyzed by Mann–Whitney U test, Wilcoxon signed rank test or Fisher’s exact test (GraphPad Prism ver 5.0b). Only biological replicates are shown.
Flow cytometry Spleenocytes of na¨ıve 10–12–week-old male germ-free mice or draining lymph node cells obtained from antibiotics treated mice 11 days after immunization were stained with fluorescently labeled antibodies (Abs) and acquired on a LSRII flow cytometer (BD Biosciences, San Diego, CA, USA). For intracellular staining the Foxp3/transcription factor staining buffer set was used (Affymetrics eBioscience, San Diego, CA, USA). Analysis was done by Flowjo software (Treestar Inc. Ashland, OR, USA). Antibodies: CD3 FITC, allophycocyanin (145-2C11), CD8 PE (53-6.7), γδ TCR PE (GL3), B220 FITC (RA3-6B2), CD11c PECy7 (HL3), Gr-1 allophycocyanin (RB6-8C5), Ki67 PE (B56) all from BD Bioscience (San Diego, CA, USA). CD4 allophycocyanin (GK1.5), Foxp3 allophycocyanin (FJK-16s) all from eBioscience (San Diego, CA, USA). TCRb FITC (H57-597), IL-17A Pacific Blue (TC11-18H10.1), CD11b Pacific Blue (M1/70) from BioLegend (San Diego, CA, USA). C 2015 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Acknowledgments: We thank Kristina Palestro, Carlos Palestro and Pia Andersson for mouse care and Emma Mondoc for histology. Supporting foundations: Swedish Research Council (RH), the Swedish Strategic Science Foundation (RH), Knut and Alice Wallenberg foundation (RH), the EU Masterswitch (RH) (Grant No. Health-F2-2008-223404), Neurinox (RH) (Health-F2-2011278611), and the IMI program BeTheCure (RH), King Gustav V 80-year foundation (KW), Swedish Society for Medical Research (KW).
Conflict of Interest: The authors have no financial conflict of interest. www.eji-journal.eu
Eur. J. Immunol. 2015. 45: 1348–1353
Cellular immune response
References
T cells in a mouse model of arthritis. J. Clin. Invest. 2008. 118: 205– 216.
1 Holland, S. M., Chronic granulomatous disease. Clin. Rev. Allergy Immunol. 2010. 38: 3–10.
16 Wu, H-J., Ivanov, II., Darce, J., Hattori, K., Shima, T., Umesaki, Y., Littman, D. R. et al., Gut-residing segmented filamentous bacteria drive
2 Leiding, J. W., Marciano, B. E., Zerbe, C. S., Deravin, S. S., Malech, H. L. and Holland, S. M., Diabetes, renal and cardiovascular disease in p47(phox-/-) chronic granulomatous disease. J. Clin. Immunol. 2013. 33: 725–730.
autoimmune arthritis via T helper 17 cells. Immunity 2010. 32: 815– 827. 17 Pearson, C. M., Wood, F. D., McDaniel, E. G. and Daft, F. S., Adjuvant arthritis induced in germ-free rats. Proc. Soc. Exp. Biol. Med. 1963. 112:
3 Marciano, B. E., Rosenzweig, S. D., Kleiner, D. E., Anderson, V. L., Darnell, D. N., Anaya-O’Brien, S., Hilligoss, D. M. et al., Gastrointestinal involvement in chronic granulomatous disease. Pediatrics 2004. 114: 462–468.
91–93. 18 Breban, M. A., Moreau, M. C., Fournier, C., Ducluzeau, R. and Kahn, M. F., Influence of the bacterial flora on collagen-induced arthritis in
4 DeRavin, S. S., Naumann, N., Cowen, E. W., Friend, J., Hilligoss, D., Marquesen, M., Balow, J. E. et al. Chronic granulomatous disease as a risk factor for autoimmune disease. J. Allergy Clin. Immunol. 2008. 122: 1097–1103.
susceptible and resistant strains of rats. Clin. Exp. Rheumatol. 1993. 11: 61–64. 19 Bjork, ¨ J., Kleinau, S., Midtvedt, T., Klareskog, L. and Smedegard, ˚ G., Role of the bowel flora for development of immunity to hsp 65 and arthritis
5 Marks, D. J. B., Miyagi, K., Rahman, F. Z., Novelli, M., Bloom, S. L. and
in three experimental models. Scand. J. Immunol. 1994. 40: 648–652.
Segal, A. W., Inflammatory bowel disease in CGD reproduces the clini-
20 Holmdahl, R., Rubin, K., Klareskog, L., Larsson, E. and Wigzell,
copathological features of Crohn’s disease. Am. J. Gastroenterol. 2009. 104:
H., Characterization of the antibody response in mice with type II
117–124.
collagen-induced arthritis, using monoclonal anti-type II collagen anti-
6 Lee, B. W. and Yap, H. K., Polyarthritis resembling juvenile rheumatoid arthritis in a girl with chronic granulomatous disease. Arthritis Rheum. 1994. 37: 773–776.
bodies. Arthritis Rheum. 1986. 29: 400–410. 21 Dorozy ˙ nska, ´
I.,
Majewska-Szczepanik,
M.,
Marcinska, ´
K.
and
Szczepanik, M., Partial depletion of natural gut flora by antibiotic
7 Olsson, L. M., Lindqvist, A-K., Kallberg, ¨ H., Padyukov, L., Burkhardt, H., Alfredsson, L., Klareskog, L. et al., A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the
aggravates collagen induced arthritis (CIA) in mice. Pharmacol. Rep. 2014. 66: 250–255. 22 Hagenow, K., Gelderman, K. A., Hultqvist, M., Merky, P., Backlund, ¨ J.,
NCF4 gene, supporting a role for the NADPH-oxidase complex in autoim-
Frey, O., Kamradt, T. et al., Ncf1-associated reduced oxidative burst pro-
munity. Arthritis Res. Ther. 2007. 9: R98.
motes IL-33R+ T cell-mediated adjuvant-free arthritis in mice. J. Immunol.
8 Hultqvist,
M.,
Olofsson,
P.,
Holmberg,
J.,
Backstrom,
B.
T.,
Tordsson, J. and Holmdahl, R., Enhanced autoimmunity, arthritis,
2009. 183: 874–881. 23 Kumar,
A.,
Wu,
H.,
Collier-Hyams,
L.
S.,
Kwon,
Y-M.,
and encephalomyelitis in mice with a reduced oxidative burst due
Hanson, J. M. and Neish, A. S., The bacterial fermentation product
to a mutation in the Ncf1 gene. Proc. Natl. Acad. Sci. USA. 2004. 101:
butyrate influences epithelial signaling via reactive oxygen species-
12646–12651.
mediated changes in cullin-1 neddylation. J. Immunol. 2009. 182: 538–
9 Olofsson, P., Holmberg, J., Tordsson, J., Lu, S., Akerstrom, B. and Holmdahl, R., Positional identification of Ncf1 as a gene that regulates arthritis severity in rats. Nat. Genet. 2003. 33: 25–32. 10 Pizzolla, A., Hultqvist, M., Nilson, B., Grimm, M. J., Eneljung, T., Jonsson, I-M., Verdrengh, M. et al., Reactive oxygen species produced by the NADPH oxidase 2 complex in monocytes protect mice from bacterial infections. J. Immunol. 2012. 188: 5003–5011. 11 Grimm, M. J., Vethanayagam, R. R., Almyroudis, N. G., Dennis, C.
546. 24 Gelderman, K. A., Hultqvist, M., Pizzolla, A., Zhao, M., Nandakumar, K. S., Mattsson, R. and Holmdahl, R., Macrophages suppress T cell responses and arthritis development in mice by producing reactive oxygen species. J. Clin. Invest. 2007. 117: 3020–3028. 25 Gelderman, K. A., Hultqvist, M., Holmberg, J., Olofsson, P. and Holmdahl, R., T cell surface redox levels determine T cell reactivity and arthritis susceptibility. Proc. Natl. Acad. Sci. USA 2006. 103: 12831–12836.
G., Khan, A. N. H., D’Auria, A. C, Singel, K. L. et al., Monocyte- and
26 Batsalova, T., Dzhambazov, B., Merky, P., Backlund, ¨ A. and Backlund, ¨
macrophage-targeted NADPH oxidase mediates antifungal host defense
J., Breaking T cell tolerance against self type II collagen in HLA-DR4-
and regulation of acute inflammation in mice. J. Immunol. 2013. 190: 4175–
transgenic mice and development of autoimmune arthritis. Arthritis
4184.
Rheum. 2010. 62: 1911–1920.
12 Hultqvist, M., Backlund, J., Bauer, K., Gelderman, K. A. and Holmdahl, R., Lack of reactive oxygen species breaks T cell tolerance to collagen
Abbreviations: CGD: chronic granulomatous disease · CIA: collagen-
type II and allows development of arthritis in mice. J. Immunol. 2007. 179:
induced arthritis · IBD: inflammatory bowel disease · NOX2: NADPH
1431–1437.
oxidase 2 · PPD: purified protein derivative · SPF: specific pathogen free
13 Kelkka, T., Kienhoefer, D., Hoffmann, M., Linja, M., Wing, K., Sareila, O., Hultqvist, M. et al., Reactive oxygen species deficiency induces autoimmunity with downstream interferon signature. Antioxid. Redox Signal. 2014. 21: 2231–2245. 14 Backlund, ¨ J., Treschow, A., Bockermann, R., Holm, B., Holm, L., Issazadeh-Navikas, S., Kihlberg, J. et al., Glycosylation of type II collagen
Full correspondence: Prof. Rikard Holmdahl, Department of Microbiology, Tumor and Cell Biology, Karolinska Institute, Stockholm, Sweden e-mail:
[email protected] Fax: +46-8-524-87750
is of major importance for T cell tolerance and pathology in collageninduced arthritis. Eur. J. Immunol. 2002. 32: 3776–3784. 15 Abdollahi-Roodsaz, S., Joosten, L. A. B., Koenders, M. I., Devesa, I., Roelofs, M. F., Radstake, T. R. D. J, Heuvelmans-Jacobs, M. et al., Stimulation of TLR2 and TLR4 differentially skews the balance of
C 2015 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Received: 10/7/2014 Revised: 9/1/2015 Accepted: 12/2/2015 Accepted article online: 16/2/2015
www.eji-journal.eu
1353
