Frequent epigenetic inactivation of the RASSF1A tumour suppressor ...

Oncogene (2003) 22, 461–466

& 2003 Nature Publishing Group All rights reserved 0950-9232/03 $25.00 www.nature.com/onc

Frequent epigenetic inactivation of the RASSF1A tumour suppressor gene in testicular tumours and distinct methylation profiles of seminoma and nonseminoma testicular germ cell tumours

1 Section of Medical and Molecular Genetics, Department of Paediatrics and Child Health, University of Birmingham, The Medical School, Edgbaston, Birmingham B15 2TT, UK; 2Institute of Pathology, University of Bonn, P.O. Box 2120, 53011 Bonn, Germany; 3 Cancer Research UK Renal Molecular Oncology Research Group, Section of Medical and Molecular Genetics, University of Birmingham, The Medical School, Birmingham B15 2TT, UK

Testicular germ cell tumours (TGCTs) are histologically heterogeneous neoplasms with variable malignant potential. Previously, we demonstrated frequent 3p allele loss in TGCTs, and recently we and others have shown that the 3p21.3 RASSF1A tumour suppressor gene (TSG) is frequently inactivated by promoter hypermethylation in a wide range of cancers including lung, breast, kidney and neuroblastoma. In order to investigate the role of epigenetic events in the pathogenesis of TGCTs, we analysed the promoter methylation status of RASSF1A and nine other genes that may be epigenetically inactivated in cancer (p16INK4A, APC, MGMT, GSTP1, DAPK, CDH1, CDH13, RARb and FHIT) in 24 primary TGCTs (28 histologically distinct components). RASSF1A methylation was detected in four of 10 (40%) seminomas and 15 of 18 (83%) nonseminoma TGCT (NSTGCT) components (P ¼ 0.0346). None of the other nine candidate genes were methylated in seminomas, but MGMT (44%), APC (29%) and FHIT (29%) were frequently methylated in NSTGCTs. Furthermore, in two mixed germ cell tumours, the NSTGCT component for one demonstrated RASSF1A, APC and CDH13 promoter methylation, but the seminoma component was unmethylated for all genes analysed. In the second mixed germ cell tumour, the NSTGCT component was methylated for RASSF1A and MGMT, while the seminoma component was methylated only for RASSF1A. In all, 61% NSTGCT components but no seminoma samples demonstrated promoter methylation at two or more genes (P ¼ 0.0016). These findings are consistent with a multistep model for TGCT pathogenesis in which RASSF1A methylation occurs early in tumorigenesis and additional epigenetic events characterize progression from seminoma to NSTGCTs. Oncogene (2003) 22, 461–466. doi:10.1038/sj.onc.1206119

*Correspondence: F Latif, Section of Medical and Molecular Genetics, Department of Paediatrics and Child Health, University of Birmingham, The Medical School, Edgbaston, Birmingham B15 2TT, UK; E-mail: fl[email protected] Received 2 August 2002; revised 16 September 2002; accepted 9 October 2002

Keywords: methylation; 3p21.3 gene; testicular tumours

tumour

suppressor

Introduction Testicular germ cell tumours (TGCTs) are the most frequent malignant tumour in young men and account for 1–2% of all malignancies in males. TGCTs are generally subclassified into seminoma (50%), nonseminoma (40%) or combined (10%) tumours. It is suggested that TGCTs originate from carcinoma in situ (CIS) and that a series of cytogenetic and molecular alterations are associated with progression of CIS to seminoma, which may subsequently develop into a nonseminoma tumour. Thus, seminomas are composed of cells similar to CIS cells and the undifferentiated stem cells of nonseminomas (termed embryonal carcinoma cells) may differentiate into teratomas, yolk sac tumours or choriocarcinomas (Looijenga and Oosterhuis, 1999; Chaganti and Houldsworth, 2000). The most consistent chromosomal alteration in TGCT is an isochromosome 12p(i(12p)), and tumours lacking i(12p) often have other structural abnormalities of 12p including amplification of 12p11.2–pl2.1 consistent with the involvement of a 12p oncogene (Suijkerbuijk et al., 1994; Mostert et al., 1998). Molecular genetic studies of TGCTs have reported allele loss on chromosomes 1, 3, 5, 9, 11, 12q, 13q, 17p and 18q (Looijenga et al., 1994; Mathew et al., 1994; Al-Jehani et al., 1995; Lothe et al., 1995; Murty et al., 1996; Rothe et al., 1999). However, mutation analysis of candidate tumour suppressor genes (TSGs) such as RB1, TP53, WT1, BRCA1, APC, MCC, NF2 and DCC has demonstrated only rare alterations, so major TGCT suppressor genes are yet to be identified. We and others have described frequent 3p allele loss in TGCTs (Foster et al., 1995). Several TSGs map to 3p (e.g., VHL at 3p25, FHIT at 3pl4, and RASSF1A at 3p21.3), and previously we found that although 54% of TGCTs have 3p allele loss, VHL mutations were not detected (Foster et al., 1995). Recently, we and others identified RASSF1A as a major 3p21.3 TSG (Dammann

ONCOGENOMICS

Sofia Honorio1, Angelo Agathanggelou1, Nicolas Wernert2, Marcus Rothe2, Eamonn R Maher1,3 and Farida Latif n,1,3

Epigenetic inactivation of RASSF1A in testicular tumours S Honorio et al

462

et al., 2000; Lerman and Minna, 2000). Although somatic RASSF1A mutations are rare, promoter hypermethylation and transcriptional silencing of RASSF1A is frequent in neuroblastoma, lung, breast and kidney cancers (Dammann et al., 2000, 2001; Agathanggelou et al., 2001; Astuti et al., 2001; Burbee et al., 2001; Dreijerink et al., 2001; Morrissey et al., 2001). Furthermore, in vitro and in vivo studies have demonstrated the ability of RASSF1A to suppress the malignant phenotype (Dammann et al., 2000; Burbee et al., 2001; Dreijerink et al., 2001). Aberrant promoter hypermethylation and associated gene silencing is now recognized as a major mechanism of TSG inactivation in many human cancers. The spectrum of genes inactivated by methylation differs between tumour types such that certain tumours may have unique patterns of methylation. The characterization of tumour-type-specific TSG methylation profiles provides insights into the molecular pathology of that particular cancer. The definition of tumour-specific ‘methylotypes’ will provide opportunities to develop novel diagnostic tests and therapeutic interventions. In addition, in certain neoplasms, notably colorectal and gastric cancer, a subset of tumours demonstrate a ‘methylator phenotype’ with promoter methylation of a wide range of TSGs (Toyota et al., 1999a, b). To investigate the possible role of the 3p21.3 RASSF1A TSG in TGCTs, we performed RASSF1A promoter region hypermethylation analysis in seminoma and nonseminoma tumours, and then proceeded to define the methylation profile of TGCTs by determining the methylation status of nine further genes that have been reported to be methylated in human cancers (p16INK4A, APC, MGMT, GSTP1, DAPK, CDH1, CDH13, RARb and FHIT).

Results RASSF1A promoter region methylation in TGCTs We performed methylation-specific PCR analysis to define the methylation status of RASSF1A promoter in 24 TGCTs (Figure 1). RASSF1A promoter region hypermethylation was found in 71% (17 of 24) of TGCTs. Among the 28 histological components analysed, there were four of 10 seminoma (40%) components and 15 of 18 (83%, P ¼ 0.0346) nonseminoma components methylated for RASSF1A (four of five yolk sac tumours (80%), five of five teratomas (100%), three of five embryonal carcinomas (60%), two of two choriocarcinoma (100%) and one mixed germ cell tumour). Although microdissection was performed for each primary TGCT, the unmethylated PCR product was detected in the majority of tumour samples. This could be due to the presence of remaining nonmalignant cells. RASSF1A methylation was also detected in four of 21 normal tissue DNA; in all cases the corresponding tumour was also methylated. These results indicate that silencing of the RASSF1A promoter might be an early event in some TGCTs. We also analysed two human Oncogene

embryonal carcinoma cell lines (NTERA2, 2102Ep) for RASSF1A methylation, and found both to be partially methylated. Promoter region methylation of nine other genes in TGCTs Having identified frequent RASSF1A promoter methylation in TGCTs, we proceeded to investigate if this finding was specific for RASSF1A. None of the seminoma samples analysed demonstrated promoter methylation at p16INK4A, MGMT, GSTP1, APC, DAPK, RARb, FHIT, CDH1 or CDH13. However, among nonseminoma components, promoter methylation was detected at MGMT (44%), APC (29%), FHIT (29%), CDH13 (12%), CDH1 (11%) and RARb (5%) (Figure 1) but not at p16INK4A, GSTP1 and DAPK. In each case, promoter methylation was specific to the tumour and was not detected in the corresponding normal tissue. Promoter methylation was significantly more common in nonseminoma versus seminoma samples for MGMT (P ¼ 0.0258), but this did not reach statistical significance for APC (P ¼ 0.14) and FHIT (P ¼ 0.12). In two mixed TGCTs containing seminoma and yolk sac components, the yolk sac component was methylated for RASSF1A and MGMT, while the seminoma component was methylated for only RASSF1A. In the second mixed TGCT, the yolk sac component was methylated for RASSF1A, APC and CDH13 but the seminoma component was unmethylated for all genes analysed. The NTERA2 EC line was partially methylated for MGMT and RARb, while the 2102Ep line was partially methylated for FHIT. p16INK4A, APC, GSTP1, DAPK and CDH1 were not methylated in either line. We compared the methylation patterns in the different histological groups according to the number of genes that demonstrated promoter methylation (Figure 2). Most seminomas showed no methylation, and in the rest, methylation was limited to RASSF1A. In contrast, only 6% (1/18) nonseminoma components analysed did not show any methylation and 44% (8/18) demonstrated methylation of at least three genes. All five nonseminoma yolk sac components had methylation of two or more genes, three of five teratomas, one of five embryonal carcinomas and one of two choriocarcinoma had methylation of two or more genes. Discussion We have defined, for the first time, the methylation status of RASSF1A and the methylation profile of nine further genes in TGCTs. Previous studies have demonstrated the following: (a) De novo RASSF1A promoter CpG methylation is associated with transcriptional silencing and, in tumour cell lines, RASSF1A expression is restored after treatment with a demethylating agent. (b) RASSF1A suppresses the growth of tumour cell lines in both in vivo and in vitro studies. We detected RASSF1A promoter methylation in 71% of TGCTs. RASSF1A methylation was significantly less in seminomas compared to nonseminomas (P ¼ 0.0346). To


463

Figure 1 Representative results of the MSP analysis of genes RASSF1A, MGMT, FHIT, APC, CDH13, CDH1 and RARb in 2 primary TGCTs (28 histologically distinct components). Abbreviations are as follows: MW1 – 50 bp DNA ladder; MW2 – 100 bp DNA ladder; U – unmethylated PCR product; M – methylated PCR product; MGCT – mixed germ cell tumour; S – seminoma; NS – nonseminoma; YS – yolk sac tumour; MT – mature teratoma; IT – immature teratoma; C – choriocarcinoma; EC – embryonal carcinoma; N – normal; P – positive controls. RASSF1A is the most frequently methylated gene and the only one epigenetically inactivated in seminomas

date, RASSF1A methylation has been reported in the majority of lung, kidney, neuroblastoma, Wilms’, nasopharyngeal, prostate, bladder and gastric tumours (Agathanggelou et al., 2001; Astuti et al., 2001; Burbee et al., 2001; Byun et al., 2001; Dammann et al., 2001; Dreijerink et al., 2001; Lee et al., 2001; Lo et al., 2001; Morrissey et al., 2001; Maruyama et al., 2002). Thus, frequent RASSF1A methylation is common to many

tumour types. For the other nine genes, none was methylated in seminomas. In nonseminoma TGCTs (NSTGCTs), three genes were frequently methylated: MGMT 44%, APC 29% and FHIT 29%. While this work was in progress, a report by Smiraglia et al (2002) came out also describing distinct epigenetic phenotypes in seminomas versus nonseminomas using restriction landmark genomic scanning. Oncogene


464

Figure 2 Percentage distribution of the number of genes methylated in seminomas (white bars) and nonseminomas (black bars)

Methylation profiling of other cancers has demonstrated that methylation of the DNA repair gene MGMT occurs commonly in colorectal (39%), lung (21%) and nasopharyngeal cancers (20%) and rarely in prostate cancer (0%). FHIT methylation status has not been analysed previously in TGCTs, but reduced immunohistochemical staining has been reported (Kraggerud et al., 2002). Previous studies have detected FHIT methylation in 37% of primary nonsmall cell cancer, 31% of primary breast tumours, 16% of bladder cancer and 15% of prostate cancer. The APC gene is frequently inactivated in colorectal and other gastrointestinal cancers by truncating mutations. Recently, methylation and silencing of the APC 1A promoter has been reported in gastrointestinal, lung and breast cancers. We found the APC gene to be methylated in 29% of nonseminomas (in most yolk sac tumours but not in teratoma or embryonal carcinoma samples). Promoter methylation was absent or infrequent (o15% of NSTGCTs) at p16fNK4A, GSTP1, RARb, DAPK, CDH1 and CDH13. Chaubert et al. (1997) reported a frequency of 50% methylation for p16INK4A in TGCTs, but we failed to find any methylation in our set of testicular tumours. This could be due to far more stringent conditions used in our MSP assay, which makes it much more specific but less sensitive. A recent report by Lind et al. (2002) also failed to find any methylation of the p16INK4A gene in 73 TGCTs. Previous reports have described DNA methylation changes in TGCTs (Peltomaki, 1991; Looijenga et al., 1997; Smiraglia et al., 2002). This report is the first comprehensive methylation profile of TGCTs using candidate gene analysis. The methylation profile we have defined (frequent methylation of RASSF1A, MGMT and APC; absent or rare methylation at p161NK4A, GSTP1, RARb, DAPK, CDH1 and CDH13) is not similar to that reported for other human cancer types (Esteller et al., 2001), and suggests that epigenetic profiling of human cancers may provide opportunities to develop novel diagnostic strategies. Oncogene

Human tumorigenesis is a multistep process. For some cancers, notably colorectal cancer, there is considerable knowledge of the molecular events associated with progression from early precursor lesions through to metastatic cancer (Fearon and Vogelstein, 1990). Although knowledge of the pathogenesis of TGCTs is more limited, a multistep model with progression from precursor CIS to seminoma and then NSTGCT has been proposed widely. However, the specific gene alteration events that might determine progression from CIS to NSTGCT are ill-defined. The i(12p) formation is associated with progression from CIS to seminoma. Allelotyping studies have suggested that 3q27–28, 5q31, 5q34–35, 9p22–p21 and 12q22 allele loss occurs early (found in CIS), while the absence of allelic losses in CIS for either TP53 or DCC suggests that loss of these genes is a late event (Faulkner et al., 2000). We have demonstrated that although RASSF1A promoter methylation is common in seminomas, NSTGCTs are characterized by a very high incidence of RASSF1A methylation and additional epigenetic alterations, in particular MGMT, FHIT and APC promoter methylation. We note that, in some cases, RASSF1A methylation was detected in both the TGCT and the adjacent normal tissue. Similar observations have been reported in lung and colon tissues, and are consistent with a ‘field defect’ and RASSF1A methylation occurring as an early event. Our results are compatible with the hypothesis that testicular germ cell neoplasms represent a continuum from CIS to NSTGCTs with seminoma as an intermediate stage. Progression along this pathway is characterized by cumulative epigenetic alterations, with RASSF1A promoter methylation as the first event. We noted variations in the extent of gene promoter methylation between different histological subtypes of NSTGCTs, and further investigations are indicated to determine the precise relationships between epigenetic gene silencing and clinicopathological characteristics of TGCTs.

Materials and methods Clinical samples Formalin-fixed, paraffin-embedded archival material (1 month to 10 years old) from 24 TGCTs was analysed. Of these, 20 were pure tumours and five were composed of two or three distinct constituents. DNA was extracted from a total of 28 histological components after microdissection (10 seminomas and 18 nonseminomas (five yolk sac, five embryonal carcinoma, six teratoma (four mature and two immature teratomas) and two choriocarcinoma)). The remaining mixed germ cell tumour consisted of mature and immature teratoma and yolk sac components that were not separated for methylation analysis. Normal DNA was isolated from tumour-free epididymal tissue. Microdissection and DNA extraction Areas of interest were selected microscopically on haematoxylin and eosin (H&E) stained sections. Microdissection was


Toyooka et al. (2001)

Graff et al. (1997)

Esteller et al. (1998)

Esteller et al. (1999)

Katzenellenbogen et al. (1999)

Herman et al. (1996)

Tsuchiya et al. (2000)

Virmani et al. (2000)

This paper

Zochbauer Muller et al. (2001)

CGTAAACGACGCCGACCCCACTA CATAAACAACACCAACCCCACTA CGATTAAACCCGTACTTCGCTAA CCCAATTAAACCCATACTTCACTAA GACCAATCCAACCGAAACGA AACCAATCCAACCAAAACAA TCGACGAACTCCCGACGA CCAATCAACAAACTCCCAACAA GACCCCGAACCGCGACCGTAA CAACCCCAAACCACAACCATAA CCCTCCCAAACGCCGA CAAATCCCTCCCAAACACCAA GCACTCTTCCGAAAACGAAACG AACTCCACACTCTTCCAAAAACAAAACA GCCCCAATACTAAATCACGACG CCACCCCAATACTAAATCACAACA TAACTAAAAATTCACCTACCGAC CACAACCAATCAACAACACA GACGTTTTCATTCATACACGCG AACTTTTCATTCATACACACA

72–66 65–59 58 58 59 59 57 60 65 60 65 60 58 58 57.5 60 64–58 55 60 55

74 74 192 204 146 146 100 110 150 151 98 106 81 93 91 97 115 97 243 243

Sodium bisulphite modification and methylation analysis

M, methylated-specific primers; U, unmethylated-specific primers

16q24 CDH13

16q22 CDH1

11q13 GSTP1

10q26 MGMT

9q34 DAPK

9p21 p16INK4A

5q21 APC

3p24 RARb

RASSF1A 3p21

FHIT

M: U: M: U: M: U: M: U: M: U: M: U: M: U: M: U: M U: M: U:

M: U: M: U: M: U: M: U: M: U: M: U: M: U: M: U: M: U: M: U: TTGGGGCGCGGGTTTGGGTTTTTACGC TTGGGGTGTGGGTTTGGGTTTTTATG CGAGAGCGCGTTTAGTTTCGTT GGGGGTTTTGTGAGAGTGTGTTT TCGAGAACGCGAGCGATTCG TTGAGAATGTGAGTGATTTGA TATTGCGGAGTGCGGGTC GTGTTTTATTGTGGAGTGTGGGTT TTATTAGAGGGTGGGGCGGATCGC TTATTAGAGGGTGGGGTGGATTGT GGATAGTCGGATCGAGTTAACGTC GGAGGATAGTTGGATTGAGTTAATGTT TTTCGACGTTCGTAGGTTTTCGC TTTGTGTTTTGATGTTTGTAGGTTTTTGT TTCGGGGTGTAGCGGTCGTC GATGTTTGGGGTGTAGTGGTTGTT TTAGGTTAGAGGGTTATCGCGT TAATTTTAGGTTAGAGGGTTATTGT TCGCGGGGTTCGTTTTTCGC TTGTGGGGTTGTTTTTTGT 3pl4

Annealing Product References temperature size (bp) (1C) Reverse primer (50 -30 ) Forward primer (50 -30 ) Chromosomal location Gene

Table 1 Summary of the MSP conditions used for the 10 genes analysed in this study

465 carried out mechanically from 10 mM thick sections that were routinely deparaffinized with xylene and 100% absolute ethanol. DNA was extracted after proteinase K digestion using the QIAamp DNA mini kit (Qiagen).

Sodium bisulphite modification was performed as described previously (Agathanggelou et al., 2001) with slight variations. Briefly, 0.5 mg of genomic DNA was denatured by boiling for 10 min at 1001C and incubating in 0.3 m NaOH for 15 min at 371C. Unmethylated cytosines were then sulphonated by incubation in 3.12 m sodium bisulphite (pH 5.0) (Sigma)/ 5 mm hydroquinone (Sigma) in a Hybaid thermocycler for 20 cycles of 30 s at 991C/15 min at 501C. Modified DNA was purified using the Wizard DNA clean-up system (Promega). The conversion reaction was completed by desulphonating in 0.3 m NaOH for 10 min at room temperature. Finally, the DNA was ethanol precipitated and resuspended in 50 ml of distilled water. Methylation-specific PCR (MSP) was then used to assess the methylation status of the promoter regions of genes RASSF1A, FHIT, RARb, APC, p16, DAPK, MGMT, GSTP1, E-cadherin (CDH1) and H-cadherin (CDH13), using for each gene two sets of primers that distinguish between methylated and unmethylated DNA sequences. Chromosomal location of all genes tested, primer sequences for both the methylated and unmethylated forms, annealing temperatures used, expected PCR product sizes and corresponding methodological references are summarized in Table 1. For PCR amplification, 1.5–3 ml of bisulphite-modified DNA were added in a final volume of 25 ml of PCR mixture containing 10 PCR buffer (Qiagen), deoxynucleotide triphosphates (0.16– 0.2 mm final concentration), primers (0.32–0.8 mm final concentration of each per reaction) and 0.625–1 unit of HotStarTaq DNA polymerase (Qiagen). Amplification was carried out in a 9700 Perkin-Elmer thermal cycler using the primer-specific annealing temperatures shown in Table 1 (a touchdown PCR was performed for several primer sets to ensure specificity of results); 40 cycles of amplification were used in all situations. All PCR reactions were performed with positive and negative controls for both methylated and unmethylated alleles selected from a panel of available lung and breast tumour cell lines; noDNA negative controls were also included. PCR products were analysed on 3% ethidium bromide-stained agarose gels and visualized under UV illumination. Statistical analysis Comparisons were made using Fisher’s exact test or w2 test as appropriate. P values o0.05 were taken as statistically significant. Acknowledgements This work was supported in part by the Association for International Cancer Research and Cancer Research UK. SH is supported by the Portuguese Foundation for Science and Technology. We thank Dr Peter W Andrews for providing the two human embryonal carcinoma cell lines. A special thanks to Dr Peter Barber from the Neuropathology Department, University of Birmingham, The Medical School, UK.

References Agathanggelou A, Honorio S, Macartney DP, Martinez A, Dallol A, Rader J, Fullwood P, Chauhan A, Walker R, Oncogene


466 Shaw JA, Hosoe S, Lerman MI, Minna JD, Maher ER and Latif F. (2001). Oncogene, 20, 1509–1518. Al-Jehani RM, Povey S, Delhanty JD and Parrington JM. (1995). Genes Chromosomes Cancer, 13, 249–256. Astuti D, Agathanggelou A, Honorio S, Dallol A, Martinsson T, Kogner P, Cummins C, Neumann HP, Voutilainen R, Dahia P, Eng C, Maher ER and Latif F. (2001). Oncogene, 20, 7573–7577. Burbee DG, Forgacs E, Zochbauer-Muller S, Shivakumar L, Fong K, Gao B, Randle D, Kondo M, Virmani A, Bader S, Sekido Y, Latif F, Milchgrub S, Toyooka S, Gazdar AF, Lerman MI, Zabarovsky E, White M and Minna JD. (2001). J. Natl. Cancer Inst., 93, 691–699. Byun DS, Lee MG, Chae KS, Ryu BG and Chi SG. (2001). Cancer Res., 61, 7034–7038. Chaganti RSK and Houldsworth L. (2000). Cancer Res., 60, 1475–1482. Chaubert P, Guillou L, Kurt AM, Bertholet MM, Metthez G, Leisinger HJ, Bosman F and Shaw P. (1997). Am. J. Pathol., 151, 859–865. Dammann R, Li C, Yoon JH, Chin PL, Bates S and Pfeifer GP. (2000). Nat. Genet., 25, 315–319. Dammann R, Takahashi T and Pfeifer GP. (2001). Oncogene, 20, 3563–3567. Dreijerink K, Braga E, Kuzmin I, Geil L, Duh FM, Angeloni D, Zbar B, Lerman MI, Stanbridge EJ, Minna JD, Protopopov A, Li J, Kashuba V, Klein G and Zabarovsky ER. (2001). Proc. Natl. Acad. Sci. USA, 98, 7504–7509. Esteller M, Corn PG, Baylin SB and Herman JG. (2001). Cancer Res., 61, 3225–3229. Esteller M, Corn PG, Urena JM, Gabrielson E, Baylin SB and Herman JG. (1998). Cancer Res., 58, 4515–4518. Esteller M, Hamilton SR, Burger PC, Baylin SB and Herman JG. (1999). Cancer Res., 59, 793–797. Faulkner SW, Leigh DA, Oosterhuis JW, Roelofs H, Looijenga LH and Friedlander ML. (2000). Br J Cancer, 83, 729–736. Fearon ER and Vogelstein BA. (1990). Cell, 61, 759–767. Foster K, Osborne RJ, Huddart RA, Affara NA, FergusonSmith MA and Maher ER. (1995). Eur J Cancer, 31A, 2392–2395. Graff JR, Herman JG, Myohanen S, Baylin SB and Vertino PM. (1997). J. Biol. Chem., 272, 22322–22329. Herman JG, Graff JR, Myohanen S, Nelkin BD and Baylin SB. (1996). Proc. Natl. Acad. Sci. USA, 93, 9821–9826. Katzenellenbogen RA, Baylin SB and Herman JG. (1999). Blood, 93, 4347–4353. Kraggerud SM, Aman P, Holm R, Stenwig AE, Fossa SD, Nesland JM and Lothe RA. (2002). Cancer Res., 62, 512–517. Lee MG, Kim HY, Byun DS, Lee SJ, Lee CH, Kim JI, Chang SG and Chi SG. (2001). Cancer Res., 61, 6688–6692. Lerman MI and Minna JD. (2000). Cancer Res., 60, 6116–6133. Lind GE, Smith-Soerensen B, Skotheim RI, Fossaa SD, Fodstad O, Stenwig AE, Jakobsen KS and Lothe RA. (2002). Proceedings of the American Association for Cancer Research, 93rd Annual Meeting, Vol. 43, p. 1120.

Oncogene

Lo KW, Kwong J, Hui AB, Chan SY, To KF, Chan AS, Chow LS, Teo PM, Johnson PJ and Huang DP. (2001). Cancer Res., 61, 3877–3881. Looijenga LH, Abraham M, Gillis AJ, Saunders GF and Oosterhuis JW. (1994). Genes Chromosomes Cancer, 9, 153–160. Looijenga LH, Gillis AJ, van Gurp RJ, Verkerk AJ and Oosterhuis JW. (1997). Am. J. Pathol., 151, 581–590. Looijenga LHJ and Oosterhuis JW. (1999). Rev. Reprod., 4, 90–100. Lothe RA, Peltomaki P, Tommerup N, Fossa SD, Stenwig AE, Borresen AL and Nesland JM. (1995). Lab Invest., 73, 606–614. Maruyama R, Toyooka S, Toyooka KO, Virmani AK, Zochbauer-Muller S, Farinas AJ, Minna JD, McConnell J, Frenkel EP and Gazdar AF. (2002). Clin. Cancer Res., 8, 514–519. Mathew S, Murty VV, Bosl GJ and Chaganti RS. (1994). Cancer Res., 54, 6265–6269. Morrissey C, Martinez A, Zatyka M, Agathanggelou A, Honorio S, Astuti D, Morgan NV, Moch H, Richards FM, Kishida T, Yao M, Schraml P, Latif F and Maher ER. (2001). Cancer Res., 61, 7277–7281. Mostert MC, Verkerk AJ, van de Pol M, Heighway J, Marynen P, Rosenberg C, van Kessel AG, van Echten J, de Jong B, Oosterhuis JW and Looijenga LH. (1998). Oncogene, 16, 2617–2627. Murty VV, Reuter VE, Bosl GJ and Chaganti RS. (1996). Oncogene, 12, 2719–2723. Peltomaki P. (1991). Biochim. Biophys. Acta, 1096, 187–196. Rothe M, Albers P and Wernert N. (1999). J. Pathol., 188, 389–394. Smiraglia DJ, Szymanska J, Kraggerud SM, Lothe RA, Peltomaki P and Plass C. (2002). Oncogene, 21, 3909–3916. Suijkerbuijk RF, Sinke RJ, Weghuis DE, Roque L, Forus A, Stellink F, Siepman A, van de Kaa C, Soares J and Geurts van Kessel A. (1994). Cancer Genet Cytogenet., 78, 145–152. Toyota M, Ahuja N, Ohe-Toyota M, Herman JG, Baylin SB and Issa JP. (1999a). Proc. Natl. Acad. Sci. USA, 96, 8681– 8686. Toyota M, Ahuja N, Suzuki H, Itoh F, Ohe-Toyota M, Imai K, Baylin SB and Issa JP. (1999b). Cancer Res., 59, 5438– 5442. Toyooka KO, Toyooka S, Virmani AK, Sathyanarayana UG, Euhus DM, Gilcrease M, Minna JD and Gazdar AF. (2001). Cancer Res., 61, 4556–4560. Tsuchiya T, Tamura G, Sato K, Endoh Y, Sakata K, Jin Z, Motoyama T, Usuba O, Kimura W, Nishizuka S, Wilson KT, James SP, Yin J, Fleisher AS, Zou T, Silverberg SG, Kong D and Meltzer SJ. (2000). Oncogene, 19, 3642–3646. Virmani AK, Rathi A, Zochbauer-Muller S, Sacchi N, Fukuyama Y, Bryant D, Maitra A, Heda S, Fong KM, Thunnissen F, Minna JD and Gazdar AF. (2000). J. Natl. Cancer Inst., 92, 1303–1307. Zochbauer-Muller S, Fong KM, Maitra A, Lam S, Geradts J, Ashfaq R, Virmani AK, Milchgrub S, Gazdar AF and Minna JD. (2001). Cancer Res., 61, 3581–3585.