Functional characterization of a glucosyltransferase ...

Physiologia Plantarum 156: 139–149. 2016

© 2015 Scandinavian Plant Physiology Society, ISSN 0031-9317

Functional characterization of a glucosyltransferase gene, LcUFGT1, involved in the formation of cyanidin glucoside in the pericarp of Litchi chinensis Xiao-Jing Lia,b , Jie-Qiong Zhangb , Zi-Chen Wub , Biao Laia,b , Xu-Ming Huangb , Yong-Hua Qina , Hui-Cong Wangb,* and Gui-Bing Hua,b,* a b

State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources, South China Agricultural University, Guangzhou, China Physiological Laboratory for South China Fruits, College of Horticulture, South China Agricultural University, Guangzhou, China

Correspondence *Corresponding authors, e-mail: [email protected]; [email protected] Received 4 January 2015; revised 13 May 2015 doi:10.1111/ppl.12391

Anthocyanins generate the red color in the pericarp of Litchi chinensis. UDP-glucose: flavonoid 3-O-glycosyltransferase (UFGT, EC. 2.4.1.91) stabilizes anthocyanidin by attaching sugar moieties to the anthocyanin aglycone. In this study, the function of an UFGT gene involved in the biosynthesis of anthocyanin was verified through heterologous expression and virus-induced gene silencing assays. A strong positive correlation between UFGT activity and anthocyanin accumulation capacity was observed in the pericarp of 15 cultivars. Four putative flavonoid 3-O-glycosyltransferase-like genes, designated as LcUFGT1 to LcUFGT4, were identified in the pericarp of litchi. Among the four UFGT gene members, only LcUFGT1 can use cyanidin as its substrate. The expression of LcUFGT1 was parallel with developmental anthocyanin accumulation, and the heterologously expressed protein of LcUFGT1 displayed catalytic activities in the formation of anthocyanin. The LcUFGT1 over-expression tobacco had darker petals and pigmented filaments and calyxes resulting from higher anthocyanin accumulations compared with non-transformed tobacco. In the pericarp with LcUFGT1 suppressed by virus-induced gene silencing, pigmentation was retarded, which was well correlated with the reduced-LcUFGT1 transcriptional activity. These results suggested that the glycosylation-related gene LcUFGT1 plays a critical role in red color formation in the pericarp of litchi.

Introduction Glycosyltransferases (GTs) are enzymes that catalyze the transfer of a glycosyl residue to an acceptor molecule. In plants, GTs exist as large, multigene families (Bowles 2002). Family 1 contains putative secondary plant glycosyltransferase (PSPG) motifs, which are highly conserved consensus sequences for glycosylation of various secondary metabolites using UDP-glucose as sugar donor (Paquette et al. 2003, Caputi et al. 2012). Plant UDP

glycosyltransferases (UGTs) display intrinsic sugar donor specificities: glucosylation (UDP-glucose), rhamnosylation (UDP-rhamnose), galactosylation (UDP-galactose) and glucuronosylation (UDP-glucuronic acid) (Miller et al. 1999, Fukuchi-Mizutani et al. 2003, Sawada et al. 2005, Yonekura-Sakakibara et al. 2007). In general, plants contain a high copy number of UGT genes, among which 121 genes have been identified in Arabidopsis thaliana (Lim et al. 2003) and 165 genes in Medicago truncatula (Modolo et al. 2007).

Abbreviations – GTs, glycosyltransferases; HPLC-DAD, high-performance liquid chromatography with diode array detection; LB, Luria-Bertani; PDS, phytoene desaturase; PSPG, putative secondary plant glycosyltransferase; TRV, tobacco rattle virus; UGTs, UDP glycosyltransferases; UFGT, UDP-glucose: flavonoid 3-O-glycosyltransferase; VIGS, virus-induced gene silencing.

Physiol. Plant. 156, 2016

139

Flavonoid UGTs exhibit region specificity toward the sugar acceptor. Flavonoid 3-O-glycosyltransferase, 5-O-glycosyltransferase and 7-O-glycosyltransferase form a unique phylogenic clade with cluster I, II and III, respectively (McIntosh and Mansell 1990, De Vetten et al. 1999). UDP-glucose: flavonoid 3-O-glycosyltransferase (UFGT) is the most intensively studied flavonoid UGT because of its function in anthocyanin biosynthesis. Anthocyanins are water-soluble pigments synthesized via the flavonoid pathway and responsible for the characteristic red, blue and purple colors of many plant tissues (Macheix et al. 1990). UFGT stabilizes anthocyanidin by attaching sugar moieties to the anthocyanin aglycone. Among all the structural genes, UFGT is a rate-limiting gene involved in anthocyanin biosynthesis. The expression of UFGT has been found to be a highly regulated step in the biosynthetic pathway of anthocyanin in a range of fruit species (Boss et al. 1996, Griesser et al. 2008, Cutanda-Perez et al. 2009, Montefiori et al. 2011, Wei et al. 2011, Zhao et al. 2012). Arabidopsis plants with mutations in ANL1, a UFGT, do not accumulate anthocyanins (Kubo et al. 2007). Litchi (Litchi chinensis Sonn.) is an economically important member of Sapindaceae family and has been widely cultivated in subtropical areas in the world. Anthocyanins give rise to the red color in litchi. Anthocyanin concentration in mature litchi fruit varies among cultivars from none to 734 mg m−2 . LcUFGT has a predominant role in anthocyanin accumulation in litchi (Wei et al. 2011, Zhao et al. 2012). UFGT is a multi-gene family. There are three genes (At1g30530, At5g17030 and At5g17040) that are quite similar to ANL1 in Arabidopsis. Among them, At1g30530 has been shown to encode a UDP-rhamnose: flavonol-3-O-rhamnosyltransferase (Jones et al. 2003). Seven UFGTs were identified in Vitis vinifera (Ono et al. 2010). In red kiwifruit, two UFGTs has been isolated (Montefiori et al. 2011). In litchi, one UFGT (LcUFGT, GenBank number HQ402914) has been isolated by reverse transcription-polymerase chain reaction (RT-PCR) using degenerate primers and found that the expression of LcUFGT is significantly correlated with the pericarp anthocyanin concentration among 12 cultivars and in chemical treatments (Wei et al. 2011). However, only one litchi UFGT gene has been isolated, and no solid evidence has been provided to verify the function of this gene. In this study, we provide data on the ripening-related expression of glycosyltransferase involved in anthocyanin biosynthesis in the pericarp of litchi. Sugar donor specificity of litchi UFGT was discussed, and the correlation between UFGT activity and 140

anthocyanin accumulation capacity was observed in 15 cultivars. Heterologous expression and virus-induced gene silencing (VIGS) assays have been used to verify the function of the isolated putative UFGT genes.

Materials and methods Plant materials Exposed fruit of 15 litchi cultivars differing in pericarp color was collected randomly at commercial maturity indicated by redness of the skin and plumpness of the aril. Fruit from three trees of cultivar Feizixiao were sampled for observation of the developmental pattern of anthocyanin accumulation in the pericarp. Fruits were taken at intervals of 4 to 8 days after color break. Five fruits from different positions of the canopy were pooled and regarded as one replication. Three replications were set for every sample. The samples were taken to the laboratory immediately after harvest, washed in deionized water and dried with gauze. Discs of pericarp were taken, frozen in liquid nitrogen and stored at −80∘ C until needed. Nicotiana benthamiana and Nicotiana tabacum were used in genetic transformation. All plants were grown in a greenhouse at 28∘ C using natural light. Anthocyanin HPLC-DAD analysis Four pericarp discs (≈0.5 g) were extracted with 3 ml methanol/water/HCl (85:12:3, v/v) for 4 h at room temperature in the dark. The extracted fluids were filtered through a 0.45 μm MilliporeTM before use. Anthocyanins were analyzed using an Agilent 1200 HPLC system (Agilent Technologies, Waldbronn, Germany) equipped with a diode-array detector. Separation was achieved on an A NUCLEODUR® C18 column (250 × 4.6 × mm) (Pretech Instruments, Sollentuna, Sweden) at 35∘ C. The HPLC conditions used in this study had been previously optimized in our laboratory and used in our previous study (Wei et al. 2011). Cyanidin-3glucoside and cyanidin-3-rutinoside were quantified based on standard curves generated for authentic standards. Enzyme assay Samples (0.5 g) were ground into fine powder using a mortar and pestle with liquid N2 . The powder was then extracted with 100 ml of 100 mM Tris–HCl buffer (pH 8.0) containing 5% (w/v) PVPP, 14 mM 𝛽-mercaptoethanol, 1% BSA, 1.5 mM PMSF, 10% Physiol. Plant. 156, 2016

Table 1. Primers for cloning of LcUFGTs in litchi pericarp and for real-time PCR assay. Gene Primers for cloning LcUFGT1 LcUFGT2 LcUFGT3 LcUFGT4

Forward primer (5′ –3′ )

ATGTACTACATATATCCACCACC ATGTCGGAAGGTAGAGAAAATAG ATGGCGGTCACTCAAAGCTC ATGTCTCAACCCACCACC

Primers for real-time PCR assay LcUFGT1 GCCACCAGCGGTTCCTAATA LcUFGT2 ATTGGGGTGTTCGTTACTCAT LcUFGT3 AGAACCCAAGTCTGTCGTGTAT LcUFGT4 GCGTCGGTCCTTTCAATCT

glycerol and 0.1% TritonX-100. The homogenate was centrifuged at 16 000 g for 10 min, and the supernatant was desalted with a PD 10 column (GE Healthcare®, Buckinghamshire, UK) and equilibrated with extraction solution containing 100 mM Tris–HCl (pH 8.0) and 5 mM DTT. The final elute was 2 ml. UFGT activity was assayed according to Ford et al. (1998). The formation of anthocyanin was measured using HPLC. The reaction mixture (200 μl) contained 100 mM Tris–HCl (pH 8.0), 10 mM polyethylene glycol-4000 (PEG-4000), 14 mM 𝛽-mercaptoethanol, 2 mM DTT, 9 mM UDP-glucose (Sigma U4625), 10 mM cyanidin (Sigma 79457, diluted with 2-methoxyethanol) and 100 μl extract. The reaction mixture was incubated at 30∘ C for 30 min, and then 150 μl of 5% HCl was added. The HPLC condition in detecting the formation of anthocyanin was same with anthocyanin component analysis. Identification and analysis of candidate genes Four sequences annotated as putative UFGT were obtained from the L. chinensis genome database http:// litchidb.genomics.cn/page/species/index.jsp. Primers were designed to isolate these genes from litchi to investigate their expression patterns (Table 1). RNA extraction and cDNA synthesis were performed in accordance with the procedure used in our previous study (Wei et al. 2011). cDNA from the pericarp of mature fruit of cv. Nuomici was used as PCR templates. Rapid amplification of cDNA ends (RACE) was performed to obtain the 3′ and 5′ ends using 3′ -Full RACE Core Set Ver.2.0 and 5′ RACE Kit (TaKaRa, Japan). Full-length cDNA sequences, namely LcUFGT 1 to 4, were available in the GenBank nucleotide database. Multiple sequence alignment was performed using ClustalW and viewed with GENEDOS (3.2). Phylogenetic analysis was performed using MEGA version 4


Reverse primer (5′ –3′ )

Product size (bp)

TTAGGCATCCTTTGGCCTTG TCAGCGCCTGGTGACGAAG TTAAAACCTGGAGATTTTCTC TAACTAGGCCTTGATACT

1410 1341 1377 1143

ATGCCTCTGCTACTGCTACAATCT CTTTCAGGGCTTTCATTGTTCC GCAACTATCTTTCCATTCCCTC GGAGCCCAACTCACCACAA

134 193 189 216

software with the neighbor-joining method based on ClustalW multiple. mRNA expression analysis Total RNA was extracted from pericarp or tobacco tissues using the RNAOUT kit (Tiandz, Beijing, China). DNase I (TaKaRa, Japan) was added to remove genomic DNA, and RNase-free columns (Tiandz) were used to purify total RNA. Gene-specific primers (Table 1) were designed using Primer 5.0 software. Primer specificity was determined by RT-PCR and melt-curve analysis. The transcript levels of LcUFGT 1–4 were analyzed using quantitative real-time PCR (qRT-PCR) with THUNDERBIRD qPCR Mix (TOYOBO, Osaka, Japan) and ABI 7500 Real-Time PCR Systems (Applied Biosystems®, CA, USA), which were used according to the manufacturers’ protocol. All qRT-PCR reactions were normalized using Ct value corresponding to LcActin (GenBank Accession No. HQ615689). The relative expression levels of those genes were calculated using 2 –ΔΔCT method (Livak and Schmittgen 2001). Reported values represent the average of three biological replicates. Heterologous expression in tobacco leaves The plasmids used for the tobacco transient expression assay were constructed by ligating full-length tested genes into pEAQ-HT using NruI and XhoI. The primers used to amplify the encoding region are listed in Table S1, Supporting Information. The product was recombined with the linearized vector pEAQ-HT (In-Fusion™ Advantage PCR Cloning Kits, Clontech). The constructed vector was maintained in Agrobacterium tumefaciens GV3101 strain. Cultures were grown to stable phase in Luria-Bertani (LB) medium supplemented with appropriate antibiotics, pelleted by centrifugation at 2000 g 141

resuspended in 10 mM MES (pH 5.6), 10 mM MgCl2 and 100 mM acetosyringone, and then adjusted the OD600 to 1.2 and incubated at ambient temperature for 2-4 h. Suspensions were vacuum infiltrated into N. benthamiana leaves. Cultures harboring pEAQ-HT were used as control, and tissue was harvested 6 days after infiltration. Constructing vector and stable tobacco transformants The isolated cDNAs of LcUFGT1 from litchi were cloned into pBI121 plasmid between SacI and BamHI restriction sites. This resulted in the formation of recombinant construct pBI121-LcUFGT1. The construct was then transferred into A. tumefaciens strain GV3101 by triparental mating. A. tumefaciens harboring pBI121-LcUFGT1 constructs was used for leaf disc transformation of N. tabacum K326 following the standard transformation protocol (Horsch et al. 1985). Genomic DNA was extracted from young leaves of transgenic and wild-type plant lines at the adult stage using the CTAB method. The presence of the transferred LcUFGT1 was identified by PCR detection using the primers, F: CGGGATCCCGATGGATGCCAGGAAAAAGAATTTT, R: CGAGCTCGTTATTCTCTTTTCACGCTGAGC. VIGS of LcUFGT1 Tobacco rattle virus (TRV)-derived vectors were provided by Prof Qin-Long Zhu from Key Laboratory of Innovation and Utilization for Germplasm Resources in South China Agricultural University. VIGS was carried out as described previously (Velásquez et al. 2009). TRV1 and TRV2 vector with the LcUFGT1 insert were separately transformed in the A. tumefaciens strain GV3101 and then grown separately in LB liquid media containing Kanamycin 50 mg l−1 and rifampicin 1 mg l−1 overnight. From the overnight culture, 1 ml was picked from each tube and again subcultured separately for 2 h in 10 ml LB media containing kanamycin 50 mg l−1 and rifampicin 1 mg l−1 and 200 μM l−1 of acetosyringone to induce the virulence genes. The separate 10 ml liquid cultures were grown at 28∘ C in darkness until they attained an optical density of 2.5. The two cultures were then spun for 15 min at 10 000 revolutions per minute and resuspended in an induction buffer containing 200 μM l−1 acetosyringone, 10 mM of MES and 10 mM of MgCl2 , adjusted to pH 5.6 and grown again for 2 h. Agrobacterium strains GV3101 containing TRV1 and TRV2-LcUFGT1 or TRV2 only (Control) were then mixed in a 1:1 ratio and injected evenly in pericarp of fruits still attached to the plant about 2 weeks before harvest. Ripe fruits were harvested approximately 12 days after injection. 142

Statistical analysis Statistical analyses were performed using the statistical package DPS v3.0 (Hangzhou, China). Pearsoncorrelation coefficients between UFGT activities and concentrations of anthocyanins in pericarp were calculated and subjected to two-tailed tests to determine significance at P < 0.05.

Results and discussion Correlation between UFGT activity and anthocyanin accumulation Glucose is the most common sugar moiety in flavonoid glycosides, so UDP-glucose: flavonoid glucosyltransferase (UFGlcT) is the most common flavonoid UGT (Mazza and Miniati 1993). In apple fruit, the main anthocyanin is cyanidin-3-galactoside and UDP-galactose: flavonoid glucosyltransferase (UFGalT), which catalyzes the formation of anthocyanin instead of UFGlcT (Ju et al. 1995, Lister et al. 1996). In the pericarp of litchi, the main anthocyanins are cyanidin-3-glucoside and cyanidin-3-rutinoside (Lee and Wicker 1991, Zhang et al. 2004). Significant UFGT activity was noticed using UDP-glucose as sugar donor (Fig. 1A). These indicated that the UFGT present in the pericarp of litchi is UFGlcT, which is congruent with the presence of cyanidin-3-glucoside. Subsequently, UDP-glucose was used as sugar donor to measure the activities of UFGT in 15 litchi cultivars with varied anthocyanin contents (Fig. 1B). The activities of UFGT varied from 0.56 ± 0.19 nmol g−1 FW min−1 in non-red cultivar XQML to 23.0 ± 1.5 nmol g−1 FW min−1 in dark-red cultivar FZX. A strong positive correlation was found between UFGT activity and anthocyanin accumulation capacity of the 15 cultivars (Fig. 1C). This result suggested that UFGT might play an important role in anthocyanin biosynthesis in the pericarp of litchi. In petunia (Gerats et al. 1985) and apple (Ju et al. 1995, Lister et al. 1996), activity of UFGT is positively correlated with anthocyanin synthesis, and therefore, UFGT is the crucial enzyme in anthocyanin biosynthesis. Analysis of UFGTs from the pericarp of litchi The search for UFGTs in the anthocyanin biosynthetic pathway of L. chinensis genome database: http:// litchidb.genomics.cn/page/species/index.jsp focused on glycosyltransferase genes annotated as UFGT. Four putative UFGT-like genes were identified and designated as LcUFGT1, LcUFGT2, LcUFGT3 and LcUFGT4. The coding regions of these four LcUFGTs were 1410, 1341, 1377 and 1143 bp, respectively (Table 1). All predicted


Fig. 1. Litchi UFGT activity analysis. (A) HPLC chromatogram of the following reactions at 520 nm: cyanidin + distilled water (control); cyanidin + UDP-glucose. (B) Activities of UFGT in the pericarp of 15 litchi cultivars and their correlation with pericarp anthocyanin contents. The vertical bars represent standard error of three biological replicates. Relative coefficient r with ‘*’ indicates significant correlation at P < 0.05.

proteins from the four putative UFGT-like genes exhibited the PSPG motif in the C terminus, a 44-amino-acid sequence found in most plant UFGT enzymes (Fig. S1) (Paquette et al. 2003). A phylogenetic tree of plant UDP glycosyltransferases and putative litchi UFGTs showed four clusters (Fig. 2),


which appear to be characterized by the specificity of the flavonoid glycosyltransferase activities. Cluster I, II and III are characterized by flavonoid 3-O-glycosyltransferases, flavonoid 5-O-glycosyltransferases and flavonoid 7-Oglycosyltransferases, respectively (Vogt and Jones 2000, Yonekura-Sakakibara et al. 2007, Noguchi et al. 2007). 143

Fig. 2. Phylogenetic analysis of selected plant GTs and putative litchi UFGTs. Bar = 0.2 amino acid substitutions per site. Functional clusters (I, II, IIIa, IIIb and IV) of flavonoid UGTs are shaded gray. Triangles represent UFGTs in litchi. The accession number of these proteins are as follows in the GenBank database: GmIF7GlcT, NP_001235161.1; SbF7GlcT, BAA83484.1; ThA5GlcT, BAA83484.1; VhA5GlcT, AB013598.1; PfA5GlcT, AB013596.1; PhA5GlcT, BAA89009.1; FiF3GlcT, AAD21086.1; HvF3GT, CAA33729.1; VvF3GlcT, gi|88192533; PfF3GlcT, BAA19659.1; GeIF7GlcT, BAC78438.1; SbB7GAT, BAC98300.1; PhF3GlcT, BAA89008.1; UGT94B1, BAD77944.1; RhA53GlcT, BAD99560.1; LvC4’GlcT, BAE48240.1; AmC4’GlcT, AB198665.1; CmF7G2’’RhaT, AAL06646.2; PhA3G6’’RhaT, CAA50376.1; IpA3G2’’GlcT, AB192315.1; UGT78D2(AtF3GlcT), NP_197207.1; AtF5GlcT, AAL69494.1; AtF7GlcT, NP_567955.1; UGT73C6(AtF3G7GlcT), NP_181217; UGT78B1 (GtF3GlcT), BAA12737.1; NbRT, BAC10994.1; UGT94D1, BAF99027.1; UGT89C1(AtF7RhaT), AC024174_5; UGT78D1(At3RhaT), AA586155; Ph3GalT, XP_004242677.1; Vm3GalT, BAA36972.1; Lb7GlcT, BAG80536.1; Gt3’GlcT, BAC54092.1; PfUGT57, BAG31949.1; AmF7GAT, BAG31945.1; SlF7GAT, BAG31946.1; SiF7GAT, BAG31947.1; PfF7GAT, BAG31948.1; AmF7GlcT, BAG31950.1; Pf3GlcT, BAG31951.1; Ph3GlcT, BAG31952.1; Am7GlcT, BAG16513.1; Am7GlcT, BAG16514.1; UGT88A1, NP_566550.1; UGT78D3(At3AraT), NP_197205.1; Vvf7GluR, XM_002271551.2; SlF7GluR, XP_004238624.1. LcUFGT1, HQ402914; LcUFGT2, KF954723; LcUFGT3, KF954724; LcUFGT4, KF954725. Table 2. Character and identity analyses of the deduced LcUFGTs proteins isolated from litchi. Gene LcUFGT1 LcUFGT2 LcUFGT3 LcUFGT4

GenBank number

Length (AA)

Theoretical MW (kDa)

Theoretical IP

Top BLAST match

Identity (%)

HQ402914 KF954723 KF954724 KF954725

469 446 458 380

52.2 49.5 50.6 41.2

8.44 5.73 5.81 8.54

XP_007029552.1 Theobroma cacao XP_007014139.1 Theobroma cacao XP_007042805.1 Theobroma cacao XP_006443177.1 Citrus clementina

64 62 61 63

Cluster IV contains PSPGs catalyzing the glycosyl transfer to the sugar moiety of flavonoid glycosides (Sawada et al. 2005). Four putative UFGT-like genes LcUFGT1 to LcUFGT4 belonged to clade I, which contained the UFGT subfamily of glycosyltransferase genes. The four genes encode putative proteins of 469, 446, 458 and 464 amino acids, respectively, with corresponding theoretical molecular weights of 52.2, 49.5, 50.6 and 41.2 kDa (Table 2). LcUFGT1, LcUFGT2 and LcUFGT3 showed top BLAST match to Theobroma cacao, while 144

LcUFGT4 was top BLAST match to Citrus clementina (Table 2). LcUFGT1 displayed 99% identity to previously reported partial sequence of LcUFGT (HQ402914) and therefore was regarded as the full sequence of LcUFGT (Wei et al. 2011). LcUFGT1, LcUFGT2 and LcUFGT4 showed 62.8, 50.4 and 45.3% identity to VvF3GlcT, a predicted UFGT gene in V. vinifera (Kobayashi et al. 2001), respectively. VvF3GlcT is critical in anthocyanin biosynthesis in grape berry. LcUFGT3 showed 50.5 and


44.8% identity to Vm3GalT from Vigna mungo (Mato et al. 1998) and Ph3GalT from Petunia hybrida (Miller et al. 1999), respectively. Both Vm3GalT and Ph3GalT have been functionally characterized as galactosyltransferase. The expressed protein of Vm3GalT showed high UF3GalT activity but low UFGlcT activity (Mato et al. 1998). PhF3GalT transferred UDP-galactose to flavonols, mainly kaempferol (Miller et al. 1999). Developmental expression of LcUFGTs in relation to anthocyanin accumulation In this study, four members of UFGT gene family, LcUFGT1 to LcUFGT4, were isolated. We analyzed their transcript patterns in relation to enzyme activities and anthocyanin accumulation during litchi fruit development (Fig. 3A). Paralleling with the accumulation of anthocyanin, the activities of UFGT in the pericarp increased with fruit development and maturation. Among the four LcUFGTs, the expression of LcUFGT1 and LcUFGT4 displayed similar developmental tendencies with anthocyanin accumulation and UFGT activities. The pEAQ vectors have been used to produce a wide variety of proteins in plants (Peyret and Lomonossoff 2013). In this study, we examined the activities of LcUFGTs transient expression proteins in catalyzing the formation of anthocyanin (Fig. 3B). Among the four heterologously expressed proteins, only LcUFGT1 displayed significant UFGT activity. This result suggested that LcUFGT1 was UFGT genes but its alleles were not UFGT genes that determined accumulation of anthocyanins in litchi. Function of LcUFGT1 in tobacco Studies have used tobacco as a model plant to investigate the function of some structural genes in anthocyanin biosynthesis (Nishihara et al. 2005, Nakatsuka et al. 2006, 2007). To further investigate the function of LcUFGT1, the ORF was introduced into tobacco for constitutively expressing LcUFGT1 under the control of the cauliflower mosaic virus 35S promoter. All the putative transgenic lines selected for genomic DNA PCR showed amplicon of expected size. Among 20 transgenic tobacco lines, harboring the 35S: LcUFGT1 constructs strong LcUFGT1 expressive transgenic tobacco plants, line 1, 4 and 5 were chosen and used for further analysis. The RT-PCR of the cDNA from the pericarp of fruit treated with GV3101/TRV2-LcUFGT1 amplified noticeable LcUFGT1 fragment using LcUFGT primers (Fig. 4A). However, no expected fragments of LcUFGT1 were detected in the pericarp treated with GV3101


Fig. 3. Developmental patterns of UFGT activities, anthocyanin contents and expression of UFGT genes (A) and the activities of the transiently expressed proteins of LcUFGT1 in tobacco (B). The vertical bars represent standard error of three biological replicates.

empty. The flowers of these LcUFGT1 over-expressive lines had deeper pink petal limbs compared with those of the wild type, and pigmented filaments and calyx were observed in the transgenic lines (Fig. 4B). Although HPLC analysis showed identical anthocyanin profile, much higher peaks and concentrations of anthocyanins were observed in the extracts of petals, filaments and calyces from LcUFGT1 over-expressive tobacco lines. (Fig. 4C and D). In addition, corolla tube became shorter and partially apopetalous in the transgenic plants (Fig. S2). Functional test of LcUFGT1 in litchi using VIGS During the past decades, many researchers have reported some useful molecular techniques for downregulating 145

Fig. 4. Phenotype and anthocyanin concentrations in 35S:LcUFGT1 tobacco flowers. (A) RT-PCR analysis of LcUFGT1 and Actin transcripts in the flower of the over-expression lines and wild type. (B) Typical flower phenotypes of the wild-type and LcUFGT1-expressing tobacco line no. 5. (C). The absorbance profiles at 520 nm of extract from the petals of the wild-type and LcUFGT1-expressing tobacco line no. 5. Cyanidin 3-rutinoside was the major anthocyanin in the petals of wild-type tobacco plants. (D) Anthocyanin concentrations in different flower tissues of the wild-type and LcUFGT1-expressing tobacco lines.

gene expression, including antisense and RNA interference (RNAi) technology (Tomilov et al. 2008, Yoder et al. 2009, Alakonya et al. 2012). RNAi has been applied to suppress some structural genes in anthocyanin biosynthesis, causing the inhibition of anthocyanin accumulation and a change in flower color in transgenic plants (Fukusaki et al. 2004, Nishihara et al. 2005). However, its applicability in woody fruit crops has been constrained by lack of methods to deliver the silencing molecules and/or plantlet regeneration system. VIGS is a technique that uses recombinant viruses to specifically reduce endogenous gene activity through plant innate silencing mechanisms called Post-Transcriptional 146

Gene Silencing (Voinnet 2001). VIGS is not a stable transformation strategy but works transiently and therefore could be used as a powerful and rapid tool in gene validation for loss-of-function. VIGS has been successfully applied in N. benthamiana, Solanum lycopersicum and Striga hermonthica plants (Velásquez et al. 2009, Kirigia et al. 2014), but not in litchi, a woody fruit crop. In this study, viral-induced technique through Agro-infiltration method was effective in litchi. This was evidenced by downregulation of the phytoene desaturase (PDS, EC 1.3.99.30) gene resulting in photo-bleached phenotypes on the leaves of litchi. The bleaching appeared on new shoots infiltrated with


Fig. 5. Effects of virus-induced LcUFGT1 silencing on the fruit pigmentation of litchi and real-time PCR to confirm silencing of LcUFGT1 gene. The LcActin transcript was used as a reference gene.

GV3101 harboring the TRV1 and mixed with GV3101 having TRV2 vector containing the PDS insert on 10th days after treatment (Fig. S3). VIGS was applied to the fruit before color break to suppress LcUFGT1. Pigmentation was retarded in fruit infiltrated with GV3101 harboring the TRV1 and mixed with GV3101 having TRV2 vector containing the LcUFGT1, while pigmentation was normal in the control fruit and fruit infiltrated with GV3101 empty (Fig. 5A). To confirm if silencing of LcUFGT1 had occurred in the pericarp because of infiltration, RT-PCR analysis was done using LcUFGT1-specific primers. The transcriptions of LcUFGT1 were extremely low showing LcUFGT1 gene was strongly suppressed by the VIGS. However, the pericarp treated with GV3101 empty and those without infiltration had high expression of LcUFGT1 (Fig. 5B).

Conclusion In the pericarp of litchi, the main anthocyanins are cyanidin-3-glucoside and cyanidin-3-rutinoside. And significant UFGT activity was noticed using UDP-glucose as sugar donor. These results indicated that the UFGT present in the pericarp of litchi was actually UDP-glucose: flavonoid glucosyltransferase (UFGlcT). A strong positive correlation between UFGT activity and


anthocyanin accumulation was observed in 15 cultivars, which demonstrated the crucial role of UFGT in litchi anthocyanin biosynthesis. Four putative UFGT-like genes, designated as LcUFGT1 to LcUFGT4, were identified in the pericarp of litchi. Their deduced amino acid sequences contained the PSPG box motif and were clustered with flavonoid 3-O-glycosyltransferase genes in other species. The expression of LcUFGT1 was parallel with developmental accumulation of anthocyanins and displayed catalytic activities of the formation of cyanidin-3-O-glucoside as demonstrated by heterologous expression assays. And furthermore, LcUFGT1 over-expression tobacco lines had darker petals and pigmented filaments and calyx resulting from increased anthocyanin accumulation. These results indicated that LcUFGT1 encodes the last structural enzyme (UFGT) necessary for anthocyanin biosynthesis in the pericarp of litchi. In addition, we have demonstrated that TRV VIGS vectors could be used to suppress functional genes in litchi. The expression of LcUFGT1 was notably pulled down in the pericarps infiltrated with GV3101 harboring the TRV1 and mixed with GV3101 having TRV2 vector containing the LcUFGT1, resulting in retarded pigmentation. Our study provides further evidence for the key function of LcUFGT1 in the anthocyanin biosynthesis in litchi as well as a potential technique for gene pull-down in woody plants.

Author contributions L. X. J. performed the most of the experiments. Z. J. Q. and W. Z. C. carried out VIGS assay. L. B. performed transient heterologous expression in tobacco. H. X. M. and Q. Y. H. performed data analysis and interpreted the results. W. H. C. and H. G. B. designed the experiment, discussed the data and drafted the manuscript. All authors have read and approved the final manuscript. Acknowledgements – This study was supported by the China Litchi and Longan Industry Technology Research System (Project No. CARS-33), National Natural Science Fund of China (Project No. 30971985), and the Key Laboratory of Innovation and Utilization for Germplasm Resources in Horticultural Crops in Southern China of Guangdong Higher Education Institutes, South China Agricultural University (No. KBL11008). The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript. The authors thank Ruo Ouyang for providing information on the plant materials and Jie-Tang Zhao for his technical assistance.

147

References Alakonya A, Kumar R, Koenig D, Kimura S, Townsley B, Runo S, Garces HM, Kang J, Yanez A, David-Schwartz R, Machuka J, Sinha N (2012) Interspecific RNA interference of SHOOT MERISTEMLESS-like disrupts Cuscuta pentagona plant parasitism. Plant Cell 24: 3153–3166 Boss PK, Davies C, Robinson SP (1996) Expression of anthocyanin biosynthesis pathway genes in red and white grape. Plant Mol Biol 32: 565–569 Bowles D (2002) A multigene family of glycosyltransferases in a model plant, Arabidopsis thaliana. Biochem Soc Trans 30: 301–306 Caputi L, Malnoy M, Goremykin V, Nikiforova S, Martens S (2012) A genome-wide phylogenetic reconstruction of family 1 UDP-glycosyltransferases revealed the expansion of the family during the adaptation of plants to life on land. Plant J 69: 1030–1042 Cutanda-Perez MC, Ageorges A, Gomez C, Vialet S, Terrier N, Romieu C, Torregrosa L (2009) Ectopic expression of VlmybA1 in grapevine activates a narrow set of genes involved in anthocyanin synthesis and transport. Plant Mol Biol 69: 633–648 De Vetten NJ, Ter Horst HP, Van Schaik A, De Boer A, Mol J, Koes R (1999) A cytochrome b5 is required for full activity of flavonoid 3’, 5’’-hydroxylase, a cytochrome P450 involved in the formation of blue flowers. Proc Natl Acad Sci USA 96: 778–783 Ford CM, Boss PK, Hoj PB (1998) Cloning and characterization of Vitis vinifera UDP-glucose: flavonoid 3-O-glucosyltransferase, a homologue of the enzyme encoded by the maize bronze-1 locus that may primarily serve to glucosylate anthocyanidins in vivo. J Biol Chem 273: 9224–9233 Fukuchi-Mizutani M, Okuhara H, Fukui Y, Nakao M, Katsumoto Y, Yonekura-Sakakibara K, Kusumi T, Hase T, Tanaka Y (2003) Biochemical and molecular characterization of a novel UDP-glucose: anthocyanin 3’-O-glucosyltransferase, a key enzyme for blue anthocyanin biosynthesis, from gentian. Plant Physiol 132: 1652–1663 Fukusaki E, Kawasaki K, Kajiyama S, An C-I, Suzuki K, Tanaka Y, Kobayashi A (2004) Flower color modulations of Torenia hybrida by downregulation of chalcone synthase genes with RNA interference. J Biotechnol 111: 229–240 Gerats AGM, Vrijlandt E, Wallroth M, Schram AW (1985) The influence of the genes Anl, An2 and An4 on the activity of the enzyme UDPG: flavonoid-3-O-glucosyltransferase in flowers of Petunia hybrida. Biochem Genet 23: 591–598 Griesser M, Hoffmann T, Bellido ML, Rosati C, Fink B, Kurtzer R, Aharoni A, Munoz-Blanco J, Schwab W (2008) Redirection of flavonoid biosynthesis through the down-regulation of an anthocyanidin glucosyltransferase

148

in ripening strawberry fruit. Plant Physiol 146: 1528–1539 Horsch R, Fry J, Hoffmann N, Eichholtz D, Rogers S, Fraley R (1985) A simple and general method for transferring genes into plants. Science 227: 1229–1231 Jones P, Messner B, Nakajima JI, Schäffner AR, Saito K (2003) UGT73C6 and UGT78D1, glycosyltransferases involved in flavonol glycoside biosynthesis in Arabidopsis thaliana. J Biol Chem 278: 43910–43918 Ju Z, Liu C, Yuan Y (1995) Acitivties of chalcone synthase and UDPGal: flavonoid-3-O-glycosyltransferase in relation to anthocyanin synthesis in apple. Sci Hortic 63: 175–185 Kirigia D, Runo S, Alakonya A (2014) A virus-induced gene silencing (VIGS) system for functional genomics in the parasitic plant Striga hermonthica. Plant Methods 10: 16 Kobayashi S, Ishimaru M, Ding CK, Yakushiji H, Goto N (2001) Comparison of UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) gene sequences between white grapes (Vitis vinifera) and their sports with red skin. Plant Sci 160: 543–550 Kubo H, Nawa N, Lupsea SA (2007) Anthocyaninless1 gene of Arabidopsis thaliana encodes a UDP-glucose:flavonoid-3-O-glucosyltransferase. J Plant Res 120: 445–449 Lee HS, Wicker L (1991) Anthocyanin pigments in the skin of lychee fruit. J Food Sci 56: 446–468 Lim E, Baldauf S, Li Y, Elias L, Worrall D, Spencer SP, Jackson RG, Taguchi G, Ross J, Bowles DJ (2003) Evolution of substrate recognition across a multigene family of glycosyltransferases in Arabidopsis. Glycobiology 13: 139–145 Lister CE, Lancaster JE, Walker JRL (1996) Developmental changes in enzymes of flavonoid biosynthesis in the skins of red and green apple cultivars. J Sci Food Agric 71: 313–320 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2 –ΔΔCT method. Methods 25: 402–408 Macheix JJ, Fluriet A, Billot J (1990) Fruit Phenolics. CRC Press, Boca Raton, FL, pp 378 Mato M, Ozeki Y, Itoh Y, Higeta D, Yoshitama K, Teramoto S, Aida R, Ishikura N, Shibata M (1998) Isolation and characterization of a cDNA clone of UDP-galactose: flavonoid 3-O-galactosyltransferase (UF3GaT) expressed in Vigna mungo seedlings. Plant Cell Physiol 39: 1145–1155 Mazza G, Miniati E (1993) Anthocyanins in fruits, vegetables and grains. CRC Press, Boca Raton, FL McIntosh CA, Mansell RL (1990) Biosynthesis of naringin in Citrus paradisi: UDP-glucosyltransferase activity in grapefruit seedlings. J Photochem 29: 1533–1538 Miller KD, Guyon V, Evans JN, Shuttleworth WA, Taylor LP (1999) Purification, cloning, and heterologous expression of a catalytically efficient flavonol


3-O-galactosyltransferase expressed in the male gametophyte of Petunia hybrida. J Biol Chem 274: 34011–34019 Modolo LV, Blount JW, Achnine L, Naoumkina MA, Wang XQ, Dixon RA (2007) A functional genomics approach to (iso) flavonoid glycosylation in the model legume Medicago truncatula. Plant Mol Biol 64: 499–518 Montefiori M, Espley RV, Stevenson D, Cooney J, Datson PM, Saiz A, Atkinson RG, Hellens RP, Allan AC (2011) Identification and characterisation of F3GT1 and F3GGT1, two glycosyltransferases responsible for anthocyanin biosynthesis in red-fleshed kiwifruit (Actinidia chinensis). Plant J 65: 106–118 Nakatsuka T, Nishihara M, Mishiba K, Yamamura S (2006) Heterologous expression of two gentian cytochrome P450 genes can modulate the intensity of flower pigmentation in transgenic tobacco plants. Mol Breed 17: 91–99 Nakatsuka T, Abe Y, Kakizaki Y, Yamamura S, Nishihara M (2007) Production of red-flowered plants by genetic engineering of multiple flavonoid biosynthetic genes. Plant Cell Rep 26: 1951–1959 Nishihara M, Nakatsuka T, Yamamura S (2005) Flavonoid components and flower color change in transgenic tobacco plants by suppression of chalcone isomerase gene. FEBS Lett 579: 6074–6078 Noguchi A, Saito A, Homma Y, Nakao M, Sasaki N, Nishino T, Takahashi S, Nakayama T (2007) A UDP-glucose:isoflavone 7-O-glucosyltransferase from the roots of soybean (Glycine max) seedling. J Biol Chem 282: 23581–23590 Ono E, Homma Y, Horikawa M, Kunikane-Doi S, Imai H, Takahashi S, Kawai Y, Ishiguro M, Fukui Y, Nakayama T (2010) Functional differentiation of the glycosyltransferases that contribute to the chemical diversity of bioactive flavonol glycosides in grapevines (Vitis vinifera). Plant Cell 22: 2856–2871 Paquette S, Møller BL, Bak S (2003) On the origin of family 1 plant glycosyltransferases. Phytochemistry 62: 399–413 Peyret H, Lomonossoff GP (2013) The pEAQ vector series: the easy and quick way to produce recombinant proteins in plants. Plant Mol Biol 83: 51–58 Sawada S, Suzuki H, Ichimaida F, Yamaguchi MA, Iwashita T, Fukui Y, Hemmi H, Nishino T, Nakayama T (2005) UDP-glucuronic acid: anthocyanin glucuronosyltransferase from red daisy (Bellis perennis) flowers. Enzymology and phylogenetics of a novel glucuronosyltransferase involved in flower pigment biosynthesis. J Biol Chem 280: 899–906 Tomilov A, Tomilova N, Wroblewski T, Michelmore R, Yoder J (2008) Trans-specific gene silencing between host and parasitic plants. Plant J 56: 389–397

Velásquez AC, Chakravarthy S, Martin GB (2009) Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato. J Vis Exp 28: e1292. doi:10.3791/1292 Vogt T, Jones P (2000) Glycosyltransferases in plant natural product synthesis: characterization of a supergene family. Trends Plant Sci 5: 380–386 Voinnet O (2001) RNAi silencing as a plant immune system against viruses. Trends Genet 17: 449–459 Wei YZ, Hu FC, Hu GB, Li XJ, Huang XM, Wang HC (2011) Differential expression of anthocyanin biosynthetic genes in relation to anthocyanin accumulation in the pericarp of Litchi Chinensis Sonn. PLoS ONE 6: e19455. doi:10.1371/journal.pone. 0019455 Yoder J, Gunathilake P, Wu B, Tomilova N, Tomilov AA (2009) Engineering host resistance against parasitic weeds with RNA interferance. Pest Manag Sci 65: 460–466 Yonekura-Sakakibara K, Tohge T, Niida R, Saito K (2007) Identification of a flavonol 7-O-rhamnosyltransferase gene determining flavonoid pattern in Arabidopsis by transcriptome coexpression analysis and reverse genetics. J Biol Chem 282: 14932–14941 Zhang Z, Pang X, Yang C, Ji Z, Jiang Y (2004) Purification and structural analysis of anthocyanins from litchi pericarp. Food Chem 84: 601–604 Zhao ZC, Hu GB, Hu FC, Wang HC, Yang ZY, Lai B (2012) The UDP glucose: flavonoid-3-O-glucosyltransferase (UFGT) gene regulates anthocyanin biosynthesis in litchi (Litchi chinesis Sonn.) during fruit coloration. Mol Biol Rep 39: 6409–6415

Supporting Information Additional Supporting Information may be found in the online version of this article: Table S1. Primers for amplifying the encoding region in tobacco transient expression assays. Fig. S1. Structure-based protein sequence alignment of LcUFGTs and VvGT1. Fig. S2. Shorter corolla tube and partially apopetalous flower in the transgenic lines compared with wild-type plants. Fig. S3. Silencing of the PDS control gene causes photobleaching in the leaves of litchi. Photographs were taken 2 weeks after silencing.

Edited by V. Shulaev


149