Functional Cooperation between Human ... - Journal of Virology

Functional Cooperation between Human Adenovirus Type 5 Early Region 4, Open Reading Frame 6 Protein, and Cellular Homeobox Protein HoxB7 Daniela Müller,a Sabrina Schreiner,a Melanie Schmid,a Peter Groitl,a Michael Winkler,b,c and Thomas Dobnera Heinrich Pette Institute, Leibniz Institute for Experimental Virology, Hamburg, Germanya; Institute for Infection Medicine, University Medical Center Schleswig-Holstein, Kiel, Germanyb; and German Primate Center, Leibniz Institute for Primate Research, Göttingen, Germanyc

Human adenovirus type 5 (HAdV5) E4orf6 (early region 4 open reading frame 6 protein) is a multifunctional early viral protein promoting efficient replication and progeny production. E4orf6 complexes with E1B-55K to assemble cellular proteins into a functional E3 ubiquitin ligase complex that not only mediates proteasomal degradation of host cell substrates but also facilitates export of viral late mRNA to promote efficient viral protein expression and host cell shutoff. Recent findings defined the role of E4orf6 in RNA splicing independent of E1B-55K binding. To reveal further functions of the early viral protein in infected cells, we used a yeast two-hybrid system and identified the homeobox transcription factor HoxB7 as a novel E4orf6-associated protein. Using a HoxB7 knockdown cell line, we observed a positive role of HoxB7 in adenoviral replication. Our experiments demonstrate that the absence of HoxB7 leads to inefficient viral progeny production, as HAdV5 gene expression is highly regulated by HoxB7-mediated activation of various adenoviral promoters. We have thus identified a novel role of E4orf6 in HAdV5 gene transcription via regulation of homeobox protein-dependent modulation of viral promoter activity.

H

uman adenovirus type 5 (HAdV5) E4orf6 (early region 4 open reading frame 6 protein) is a multifunctional protein which promotes efficient viral replication and plays a major role in adenoviral transformation processes. During infection, this viral factor assembles an SCF-like E3 ubiquitin ligase complex based on the cellular proteins elongins B and C, cullin 5, and Rbx1 (4, 66; reviewed in references 74 and 83). In cooperation with E1B-55K (early region 1B 55K protein), this viral RING-type ligase ubiquitinates cellular substrates prior to proteasomal degradation. So far, p53, DNA ligase IV, Mre11, integrin ␣3, and BLM (Blooms helicase) have been identified as targets of this HAdV5 ligase complex (4, 18, 64, 83). E1B-55K was also identified as a viral interaction partner of the transcription factor Daxx (76, 79, 89) and is required for proteasomal degradation of Daxx during HAdV5 infection (75, 76). Remarkably, in contrast to the cellular targets of HAdV5 E3 ubiquitin ligases mentioned above, E4orf6 is dispensable for Daxx removal. In reverse, the HAdV12 E4orf6 protein was shown to target TopBP1, a protein involved in the DNA damage response and cell cycle checkpoint control (70, 71). In this case, HAdV12 E1B-55K is apparently not relevant for the cullin2-E4orf6-dependent proteasomal degradation of TopBP1 (5). In addition, it was shown that formation of the HAdV5 E3 ubiquitin ligase complex is necessary for E4orf6- and E1B-55K-mediated export of viral late mRNA out of the nucleus into the cytoplasm (7, 88). This preferential export of viral transcripts over cellular mRNA is important for efficient viral protein expression and host cell shutoff. However, different studies show that during the course of infection, only up to 50% of E4orf6 is associated with E1B-55K (16, 60, 80). Therefore, we were interested in additional roles and unknown functional capacities of E4orf6 in HAdV5-infected cells (69). As known to date, E4orf6 stabilizes the unprocessed viral late RNAs in the nucleus in an E1B-55K-independent manner, thus providing correct splicing of viral late transcripts (34, 55, 56).

8296

jvi.asm.org

Journal of Virology

Additionally, it was shown that E4orf6 interacts with a region toward the carboxy terminus of the tumor suppressor protein p53, therefore promoting inhibition of p53-dependent transactivation (19). Besides its functions during HAdV5 infection, E4orf6 was shown to enhance the transforming potential of E1A in cooperation with E1B-55K in primary rodent cells (51, 53). To establish an efficiently transformed phenotype, the carboxy-terminal region within E4orf6, the so-called oncodomain, is necessary and sufficient (54). The E4orf6 oncodomain contains an arginine-rich sequence with characteristics of an amphipathic alpha helix and is likely a functional protein domain (9, 58). Indeed, the oncodomain was shown to be sufficient for productive HAdV5 infection (58) and adenoviral transformation of primary rodent cells (54). Apparently, E4orf6 modulates its lytic and nonlytic/oncogenic functions by interacting with various other proteins. The arginine residues within the alpha helix may play a major role in mediating such protein-protein interactions with HAdV5 E4orf6 (59). To gain insights into further E4orf6 functions, we screened for new cellular interaction partners of the E4orf6 oncodomain by yeast two-hybrid techniques and discovered the cellular transcription factor HoxB7 as a novel E4orf6 binding partner. Furthermore, our studies reveal new tasks mediated by binding of the early viral protein to HoxB7.

Received 26 January 2012 Accepted 23 April 2012 Published ahead of print 2 May 2012 Address correspondence to Thomas Dobner, [email protected] -hamburg.de. Copyright © 2012, American Society for Microbiology. All Rights Reserved. doi:10.1128/JVI.00222-12

p. 8296 – 8308

August 2012 Volume 86 Number 15

E4orf6 Interaction with HoxB7

MATERIALS AND METHODS Cell culture and generation of knockdown cell lines. H1299 cells (49), A549 cells (DSMZ ACC 107; Deutsche Sammlung für Mikroorganismen und Zellkulturen GmbH, Braunschweig, Germany), and W162 cells (3) were grown as monolayer cultures in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal calf serum (FCS), 100 U of penicillin, and 100 ␮g of streptomycin per ml in a 5% CO2 atmosphere at 37°C. To generate HoxB7 knockdown cell lines (shHoxB7), H1299 cells were transduced with lentiviral particles containing the pSuper vector (OligoEngine) expressing a short hairpin RNA (shRNA) targeted to the coding strand sequence in HoxB7 (5=-GAG CCG AGT TCC TTC AAC A-3=) (see Table 3), at nucleotides (nt) 240 to 258. Transduced cells were selected and maintained in medium containing puromycin (1 ␮g/ml) to generate monoclonal cell lines. Viruses. The wild-type HAdV5 virus H5pg4100 and the mutant viruses H5pm4149, H5pm4150, H5pm4166, and H5pm4154 were described recently (7, 22, 30, 37, 47). These viruses carry mutations in the E1B-55K (H5pm4149), E4orf3 (H5pm4150), E4orf4 (H5pm4166), and E4orf6 (H5pm4154) open reading frames and do not express the respective viral proteins. The H5pm4139 virus mutant was generated with point mutations in both the BC1 and BC2 box motifs within the E4orf6 protein (7). Viruses were propagated and titrated in W162 cell cultures. Infections were performed as described previously (37). To measure virus growth, infected cells were harvested at 48 and 72 h postinfection (p.i.) and lysed by three cycles of freeze-thawing. The cell lysates were serially diluted in DMEM, and virus yield was determined by infection of W162 cells. Subsequent quantitative E2A immunofluorescence staining was carried out 24 h after infection. Viral DNA replication was monitored by quantitative PCR as described previously (76). pSuper control and shHoxB7 cells were infected with wild-type H5pg4100 virus and mutant viruses prior to harvest at 2, 8, 10, 12, 14, 16, 24, and 48 h postinfection. PCR was performed using E1B-55K-specific primers (E1B-55K-qPCR-fw and E1B-55KqPCR-rev) (see Table 3) and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers GAPDH fwd and GAPDH rev) (see Table 3). Reaction products were separated in agarose gels, and band intensities were quantified using Gene Tools software (Syngene). Transient transfection. Proteins used in this study were expressed from their respective complementary DNAs under the control of the cytomegalovirus immediate-early promoter, derived from the pcDNA3 vector (Invitrogen), to express hemagglutinin (HA)-tagged HAdV5 E4orf6 proteins (wild-type E4orf6, E4orf6-L245P, and onco-E4orf6 [amino acids 204 to 294]) and FLAG-tagged HoxB7. Transient transfection of subconfluent H1299 cells with a mixture of DNA and 25-kDa linear polyethylenimine (PEI; Polysciences) was performed as previously described (76). After transfection, cells were incubated for 6 to 8 h in a 5% CO2 atmosphere at 37°C before the medium was replaced with DMEM supplemented with 10% FCS, 100 U of penicillin, and 100 ␮g of streptomycin per ml. Luciferase reporter assays. For dual-luciferase assays, subconfluent pSuper and shHoxB7 cells were transfected using effector plasmids and pRL-TK (Promega), which expresses the Renilla luciferase under the control of the herpes simplex virus thymidine kinase promoter. Total cell extracts were prepared 48 h after transfection, and RGC firefly luciferase activity was assayed in an automated luminometer (Lumat LB9510; Berthold Technologies) as described by the manufacturer (Promega). All samples were normalized for transfection efficiency by measuring the Renilla luciferase activity. HAdV5 promoter constructs are based on the pGL3-basic vector (Invitrogen) as described previously (73). qRT-PCR analysis. Total RNA was isolated with TRIzol reagent (Invitrogen) as described by the manufacturer. The amount of total RNA was measured, and 1 ␮g of RNA was reverse transcribed using a reverse transcription (RT) system (Promega) including an anchored-oligo(dT)18 primer specific to the poly(A)⫹ RNA. To amplify specific viral genes, primers were designed as shown in Table 1. Quantitative RT-PCR (qRT-


TABLE 1 Primers used for quantitative RT-PCR analysis to amplify specific viral genes Primer

Descriptiona

Sequence (5=–3=)

1371 1372 1569 1570 1686 1687 1690 1691 1767 1768

18S rRNA fwd 18S rRNA rev E1B fwd E1B rev E1A fwd E1A rev HoxB7 fwd HoxB7 rev E4orf6 rev E4orf6 fwd

CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT GAGGGTAACTCCAGGGTGCG TTTCACTAGCATGAAGCAACCACA GTGCCCCATTAAACCAGTTG GGCGTTTACAGCTCAAGTCC AGAGTAACTTCCGGATCTA TCGGCTTCAGCCCTGTCTT CCCTCATAAACACGCTGGAC GCTGGTTTAGGATGGTGGTG

a

fwd, forward primer; rev, reverse primer.

PCR) was performed with a first-strand method in a Rotor-Gene 6000 thermal cycler (Corbett Life Sciences, Sydney, Australia), using 0.1-ml reaction tubes containing a 1/10 dilution of the cDNA template, 5 pmol/␮l of each synthetic oligonucleotide primer (Table 1), and 5 ␮l/ sample of Power SYBR green PCR master mix (Applied Biosystems). The PCR conditions were as follows: 10 min at 95°C followed by 55 cycles of 30 s at 95°C, 30 s at 55 to 62°C (depending upon the primer set), and 30 s at 72°C. The average threshold cycle (CT) value was determined from triplicate reactions, and levels of viral mRNA relative to cellular 18S rRNA were calculated as described recently (85). The identities of the products obtained were confirmed by melting curve analysis. ChIP analysis. Chromatin immunoprecipitation (ChIP) analysis was performed as described previously (31, 78), with some modifications. For ChIP, proteins from 2 ⫻ 106 cells were cross-linked to DNA with 1% formaldehyde in phosphate-buffered saline (PBS) for 10 min at room temperature. The reaction was quenched, and cells were washed with PBS and harvested by scraping off the dish. Nuclei were isolated by incubation of cross-linked cells with 500 ␮l of buffer I (50 mM HEPES-KOH, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton X-100) for 10 min on ice and then pelleted by centrifugation (1,350 ⫻ g for 5 min at 4°C). The nuclei were subsequently washed with 500 ␮l buffer II (10 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA), pelleted again, and resuspended in 500 ␮l buffer III (1% SDS, 10 mM EDTA, 50 mM Tris-HCl). Chromatin was fragmented by sonication using a Bioruptor (Diagenode) to an average length of 100 to 300 bp. After addition of 10% Triton X-100, cell debris was pelleted by centrifugation (20,000 ⫻ g, 4°C), and supernatants were collected. Chromatin was diluted with dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl, 167 mM NaCl). To reduce the nonspecific background, chromatin was preincubated with salmon sperm DNA-protein A agarose beads (Upstate). Antibodies were added and incubated for 16 h at 4°C. Fifty microliters of agarose beads was added to precipitate the chromatin immunocomplexes for 4 h at 4°C. Beads were washed once with low-salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, 150 mM NaCl), once with high-salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, 500 mM NaCl), once with LiCl wash buffer (0.25 M LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl), and twice with Tris-EDTA (TE) buffer. Chromatin was eluted from the beads in elution buffer (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1% SDS) for 10 min at 95°C. Proteinase K was added for protein degradation, and samples were incubated for 1 h at 55°C. For preparation of input controls, samples were treated identically to IP samples, except that nonspecific antibodies were used. qRT-PCR analysis was performed using a Rotor Gene 6000 thermal cycler (Corbett Life Sciences, Australia) and 0.5-ml reaction tubes containing a 1/100 dilution of the precipitated chromatin, 10 pmol/␮l of each synthetic oligonucleotide primer (Table 2), and 5 ␮l/sample of SYBR green PCR master mix (Applied Biosystems). The PCR conditions used were as follows: 7 min at 95°C followed by 45 cycles of 12 s at 95°C, 40 s at 60°C, and 15 s at 72°C. The average CT value

jvi.asm.org 8297

Müller et al.

TABLE 2 Primers used in ChIP assays to amplify viral promoter regions Primer descriptiona

Sequence (5=–3=)

E1A fwd E1A rev E1B fwd E1B rev pIX fwd pIX rev E2early fwd E2early rev MLP fwd MLP rev

TCCGCGTTCCGGGTCAAAGT GTCGGAGCGGCTCGGAG GGTGAGATAATGTTTAACTTGC TAACCAAGATTAGCCCACGG CGCTGAGTTTGGCTCTAGCGAT CTGCTGCAAAACAGATACAAAACTACA TACTGCGCGCTGACTCTTAAGG ATGGCGCTGACAACAGGTGCT TGATTGGTTTGTAGGTGTAGG ACAGCGATGCGGAAGAGA

a


was determined from triplicate reactions and normalized against nonspecific IgG controls with standard curves for each primer pair. Error bars indicate the standard errors of the means. The identities of the products obtained were confirmed by melting curve analysis. Values above 1% of the input, which are stated to indicate significant promoter binding (38), were highlighted. Yeast two-hybrid assay. Yeast two-hybrid screening was performed using a GAL4 fusion protein as described previously (20). The bait fusion protein contained the C-terminal oncodomain of HAdV5 E4orf6 (aa 204 to 294). Saccharomyces cerevisiae strain Y153 was transformed with the pGBKT7-E4orf6-onco bait plasmid by the lithium acetate method and stably maintained in the absence of tryptophan. Yeast cells were subsequently transformed with a pACT-based cDNA library derived from Epstein-Barr virus-transformed human peripheral lymphocytes (87) and grown on His-Leu-Trp dropout plates (⬃820,000 primary transformants). By using the 5-bromo-4-chloro-3-indolyl-␤-D-galactopyranoside filter assay, His⫹ colonies were tested for beta-galactosidase activity. Prey plasmids were isolated and propagated in Escherichia coli strain DH5␣ and sequenced using primers Gal4 rev 951 and YADH fwd 686 (Table 3). GST pulldown assay. Recombinant glutathione S-transferase (GST) fusion proteins were expressed from pGEX-2Tk plasmids in Escherichia coli TOPP6 cells. Cells were grown to an optical density at 600 nm of 0.7, isopropyl-␤-D-thiogalactopyranoside was added to a concentration of 0.5 mM, and cells were incubated for an additional 2 h at 30°C. Extracts were obtained by incubation of pelleted bacteria in 10 mM Tris (pH 8), 150 mM NaCl, and 1 mM EDTA with lysozyme for 15 min, followed by addition of 5 mM dithiothreitol (DTT) and 10% Sarkosyl (N-laurylsarcosine) and subsequent sonication. After centrifugation (10 min, 4°C, 10,000 rpm), 1.5 ml of 10% Triton X-100 was added to the clarified supernatant, sterile filtered (pore size of 0.45 ␮m), and incubated for 1 h with glutathione Sepharose 4B (GE Healthcare) on a rotator at 4°C. The Sepharose beads were washed six times with Tris-buffered saline (TBS) with protease inhibitors, and similar amounts of GST or GST fusion protein, as determined by SDS-PAGE followed by Coomassie blue staining, were incubated overnight at 4°C with reticulocyte lysate containing in vitro-translated 35S-labeled target proteins. Proteins were translated using a TNT coupled reticulocyte lysate system as described by the manufacturer (Pro-

mega). After incubation, Sepharose beads were pelleted by centrifugation (5 min, 4°C, 6,000 rpm), washed three times with TBS complemented with protease inhibitors, and boiled for 3 min at 95°C in 2⫻ Laemmli buffer. Eluted proteins were separated by SDS-PAGE and detected by phosphorimaging of dried gels. Protein immunoprecipitation and Western blotting. Cell pellets were resuspended in RIPA lysis buffer (50 mM Tris-HCl [pH 8.0], 150 mM NaCl, 5 mM EDTA, 0.1% SDS, 1% Nonidet P-40) supplemented with a protease inhibitor cocktail containing 1% (vol/vol) phenylmethylsulfonyl fluoride (PMSF), 0.1% (vol/vol) aprotinin, 1 ␮g/ml leupeptin, 1 ␮g/ml pepstatin, and 1 mM DTT. After 30 min of incubation on ice, protein lysates were sonicated and cleared by centrifugation at 14,000 rpm at 4°C. For immunoprecipitation, protein A-Sepharose (3 mg/IP) was coupled with anti-FLAG M2 antibody (1.5 ␮l/IP) or HoxB7 mouse monoclonal antibody (MAb) (Santa Cruz; 5 ␮l/IP) and incubated with Pansorbin (50 ␮l/lysate; Calbiochem)-preextracted cell lysates for 1 h or overnight at 4°C. Immunoprecipitates were washed 3 times with RIPA lysis buffer, boiled for 3 min at 95°C in 2⫻ Laemmli buffer, and analyzed by immunoblotting. For immunoblotting, proteins were separated by SDS-PAGE and transferred to nitrocellulose membranes (Schleicher & Schuell/ Whatman). Membranes were blocked in 5% milk powder and probed with primary and secondary antibodies. The bands were visualized by enhanced chemiluminescence on X-ray films (CEA RP new medical X-ray film) as recommended by the manufacturer (Pierce). Antibodies. Primary antibodies specific for HAdV5 proteins used in this study included E1A mouse MAb M73 (33), E1B-55K mouse MAb 2A6 (72), E2A-72K mouse MAb B6-8 (68), E4orf6 mouse MAb RSA3 (45), E4orf6 rabbit polyclonal antibody 1807 (8), and HAdV5 rabbit polyclonal serum L133 (36). Primary antibodies specific for cellular proteins included HoxB7 mouse MAb (Santa Cruz), Mre11 rabbit polyclonal antibody pNB 100-142 (Novus Biologicals, Inc.), and ␤-actin mouse MAb AC-15 (Sigma-Aldrich, Inc.). Furthermore, anti-FLAG mouse MAb M2 (Sigma-Aldrich, Inc.) and anti-HA MAb 3F10 (Roche Applied Science, Inc.) were used. The following horseradish peroxidase-conjugated secondary antibodies were used for detection: anti-rabbit IgG and antimouse IgG (Jackson/Dianova). Fluorescent secondary antibodies were affinity-purified fluorescein isothiocyanate (FITC)-conjugated donkey anti-rabbit IgG and Texas Red-conjugated donkey anti-mouse IgG (Invitrogen), and they were used at a 1:100 dilution. Indirect immunofluorescence. For indirect immunofluorescence, cells were grown on glass coverslips as described recently (37). Cells were fixed in ice-cold methanol at ⫺20°C for 15 min and permeabilized in PBS-0.5% Triton X-100 for 30 min at room temperature. After 1 h of blocking in TBS-bovine serum albumin and glycine (BG) buffer (TBS with 5 mg/ml of bovine serum albumin and 5 mg/ml of glycine), cells were treated for 1 h with the primary antibody diluted in PBS and washed three times in PBS-0.1% Tween 20, followed by incubation with the corresponding FITC- or Texas Red-conjugated secondary antibody (Invitrogen). Coverslips were washed three times in PBS0.1% Tween 20 and mounted in Glow medium (Energene), and digital images were acquired on a DMRB fluorescence microscope (Leica) with a charge-coupled device camera (Diagnostic Instruments). Im-

TABLE 3 Primers used for yeast two-hybrid, HoxB7 knockdown, and viral DNA synthesis experiments Primer

Descriptiona

Sequence (5=–3=)

951 686 1606 1607 64 110

Gal4 rev YADH fwd shRNA-HoxB7 fwd shRNA-HoxB7 rev E1B-55K-qPCR-fw E1B-55K-qPCR-rev

TCTTCAGACACTTGGCGCA CTGCACAATATTTCAAGCTATACC GATCCCCGAGCCGAGTTCCTTCAACATTCAAGAGATGTTGAAGGAACTCGGCTCTTTTTA AGCTTAAAAAGAGCCGAGTTCCTTCAACATCTCTTGAATGTTGAAGGAACTCGGCTCGGG CGCGGGATCCATGGAGCGAAGAAACCCATCTGAGC CGGTGTCTGGTCATTAAGCTAAAA

a


8298

jvi.asm.org

Journal of Virology


FIG 1 E4orf6 interacts with HoxB7 in vitro and in human cells. (A) In vitro-translated [35S]methionine-labeled HoxB7 was incubated with GST-E4orf6 or GST alone, and as a control, GST-E4orf6 was incubated without HoxB7. After precipitation, proteins were separated by SDS-PAGE and visualized by autoradiography. Half the amount of labeled HoxB7 was loaded as input. (B) GST inputs (GST and GST-E4orf6) used for panel A were separated by SDS-PAGE and stained with Coomassie blue. Three concentrations of bovine serum albumin (BSA) were loaded as controls, and molecular mass markers served to position the kDa sizes indicated. (C) H1299 cells were transfected with plasmids encoding E4orf6-HA and HoxB7-FLAG as indicated and harvested at 48 h posttransfection. Total cell extracts were prepared and immunoprecipitated (IP) with mouse monoclonal anti-FLAG M2 antibody (top panel). Proteins from the IP and input samples separated by SDS-PAGE were subjected to immunoblotting using rat anti-HA MAb, anti-FLAG M2, or ␤-actin antibody as indicated on the right; ␤-actin served as a loading control.

ages were cropped using Adobe Photoshop CS4 and assembled with Adobe Illustrator CS4.

RESULTS

Cellular homeobox transcription factor HoxB7 is a novel HAdV5 E4orf6 interaction partner. To identify host cell factors interacting with HAdV5 E4orf6, we screened a cDNA library with the carboxy terminus of E4orf6 fused to the Gal4 DNA binding domain as the bait in a yeast two-hybrid screen. Prior to screening, we tested the bait fusion protein for autoactivation of the lacZ reporter. One of the potential interaction partners found in the yeast two-hybrid screen encoded a partial cDNA for HoxB7 (nt 372 to 1170), a protein belonging to the homeobox protein family of transcription factors (61). To further investigate this interaction, bacterially expressed and purified GST-E4orf6 was incubated with in vitro-translated, 35 S-labeled HoxB7. Only GST-E4orf6, not GST alone, bound to


HoxB7, while no interaction was observed between GST-E4orf6 and an in vitro-translated control protein, confirming a direct interaction between HAdV5 E4orf6 and the cellular homeobox protein HoxB7 (Fig. 1A and B). To verify the E4orf6-HoxB7 interaction in human cells, we performed coimmunoprecipitation analysis. H1299 cells were transiently transfected with vectors expressing wild-type E4orf6, the E4orf6 L245P mutant, or onco-E4orf6 and FLAG-tagged HoxB7 protein. Total protein was harvested at 48 h posttransfection and precipitated with a MAb detecting FLAG-specific epitopes (Fig. 1C). Both full-length E4orf6 and onco-E4orf6 could be coprecipitated with the FLAG-specific MAb, confirming the interaction of E4orf6 and HoxB7 observed in the yeast two-hybrid screen (Fig. 1C, upper panel, lanes 4 and 6). Interestingly, the L245P mutant of E4orf6 was also able to interact with HoxB7, which indicates that the binding region is located outside the al-

jvi.asm.org 8299

Müller et al.

FIG 2 E4orf6 interacts with HoxB7 independently of E1B-55K and the E3 ubiquitin ligase complex. (A) H1299 cells were infected with wild-type virus (H5pg4100) and mutant viruses (E4orf6-null H5pm4154, E4orf4-null H5pm4166, and E1B-55K-null H5pm4149) at a multiplicity of infection of 50 focusforming units (FFU) per cell and harvested at 24 h postinfection. Total cell extracts were prepared and immunoprecipitated (IP) with mouse anti-HoxB7 MAb (top panel). IP and input proteins separated by SDS-PAGE were subjected to immunoblotting using rabbit polyclonal E4orf6 (1807) and mouse monoclonal HoxB7 antibodies as indicated on the right. ␤-Actin was immunoblotted as a loading control. (B) H1299 cells were infected with wild-type virus (H5pg4100) and mutant viruses (H5pm4149, H5pm4154, and H5pm4139, with a mutated E4orf6 protein) at a multiplicity of infection of 50 FFU per cell and harvested at 24 h postinfection. Total cell extracts were prepared and immunoprecipitated (IP) with mouse anti-HoxB7 MAb (top panel). IP and input proteins separated by SDS-PAGE were subjected to immunoblotting using rabbit polyclonal E4orf6 (1807) and mouse monoclonal HoxB7 antibodies as indicated on the right. ␤-Actin was immunoblotted as a loading control.

pha helix, since this mutation was shown to disrupt the helical structure (58). The yeast two-hybrid, GST pulldown, and coimmunoprecipitation experiments substantiate a direct E4orf6HoxB7 interaction in the absence of other viral factors. Next, we wanted to test whether E4orf6 binding of the homeobox protein also occurs during the course of HAdV5 infection. In line with previous reports (62), HoxB7 shows a relatively high expression level in human lung tumor cells (62; data not shown). Therefore, we infected human H1299 cells with wild-type HAdV5 and various virus mutants and harvested total cell extracts at 24 h postinfection. In all virus-infected cells, except for E4orf6-negative Hpm4154-infected cells (Fig. 2A, upper panel, lane 3), the E4orf6 protein was coimmunoprecipitated with a mouse antibody recognizing endogenous HoxB7, indicating an interaction of both proteins during productive HAdV5 infection (Fig. 2A, upper panel). Consistent with previous reports, the virus mutant Hpm4166 (lacking E4orf4) exhibited modestly higher E4orf6 protein expression (Fig. 2A, lane 4) (47) and therefore resulted in more efficient coimmunoprecipitation with endogenous HoxB7 (Fig. 2A, upper panel, lane 4). Interestingly, compared to the case for wild-type virus, enhanced amounts of E4orf6 protein were coprecipitated in H5pm4149-infected cells lacking E1B-55K expression (Fig. 2A, lane 5). This observation suggests a negative effect of E1B-55K on the E4orf6 binding of HoxB7. Since it was shown that formation of the functional HAdV5 E3 ubiquitin ligase complex is a prerequisite for E4orf6 interaction with E1B-55K (7), we further analyzed whether such ligase formation is involved in the cooperation between E4orf6 and HoxB7. A larger amount of immunoprecipitated protein was observed in the absence of E1B-55K (Fig. 2B, lane 3). Similar data were obtained

8300

jvi.asm.org

for H5pm4139-infected cells, which lacked the functional interaction of E4orf6 with cellular components of the E3 ubiquitin ligase complex: a significantly increased fraction of E4orf6 protein interacted with HoxB7 compared to the case in wild-type virus-infected cells (Fig. 2B, lane 4). Taken together, these data strongly suggest that E4orf6 and HoxB7 interact preferentially in the absence of E1B-55K and the E3 ubiquitin ligase complex. Generation and phenotypic analysis of human HoxB7 knockdown cells. To date, there are no data available linking HoxB7 to HAdV5 infection. To assess the role and elucidate the functional consequences of the E4orf6-HoxB7 interaction, we established monoclonal H1299 cell lines stably expressing a shRNA construct directed against HoxB7 (shHoxB7). In three of these cell lines (shHoxB7-2, shHoxB7-3, and shHoxB7-9), HoxB7 mRNA (Fig. 3A) and protein expression (Fig. 3B) were successfully knocked down compared to those in control cells (pSuper). Prior to our analysis, we further investigated proliferation (Fig. 3C) and cell morphology (Fig. 3D) in the absence and presence of HoxB7, and no significant difference was observed. Additionally, the infectivity of wild-type HAdV5 was not altered in the HoxB7 knockdown cells, as assayed by qPCR with E1B-55K-specific primers early after infection (Fig. 3E). Depletion of homeobox protein HoxB7 restricts efficient HAdV5 replication. To investigate the effect of HoxB7 depletion on productive HAdV5 replication, we determined virus progeny production in HoxB7 knockdown and parental cells (Fig. 4). In line with already published data (37), in parental (pSuper) cells the virus mutant H5pm4149, lacking E1B-55K and its related proteins, was defective for growth compared to wild-type H5pg4100

Journal of Virology


FIG 3 Reduction of HoxB7 mRNA and proteins in shRNA-transduced shHoxB7 cell lines. (A) Total RNA was extracted from control (pSuper) and different shHoxB7 knockdown cells, reverse transcribed, and quantified by RT-PCR using primers specific for HoxB7 (Table 1). The data were normalized to 18S rRNA levels. (B) Total cell extracts were prepared from control (pSuper) and shHoxB7 knockdown cells, and proteins were separated by SDS-PAGE and subjected to immunoblotting using a mouse HoxB7 MAb. ␤-Actin served as a loading control. (C) Control (pSuper) and shHoxB7 knockdown cells were seeded at 2 ⫻ 104 cells. At different time points, cells were harvested and viable cells were counted after trypan blue staining. (D) Light microscopy of control (pSuper) and shHoxB7 knockdown cells. (E) Control (pSuper) and shHoxB7-2 knockdown cells were infected with wild-type virus (H5pg4100) at a multiplicity of infection of 25 FFU per cell and harvested at 2 h postinfection. Total cell extracts were prepared and treated with proteinase K. Quantitative PCR was performed using E1B-55K-specific primers. The results represent the averages for three independent experiments. Error bars indicate the standard errors of the means.

(Fig. 4A). The same defect was observed in infected cells lacking E4orf6 (infected with H5pm4154) (7). In the absence of HoxB7, we detected overall reduced virus yields, although the ratio varied for each virus (Fig. 4A). While wildtype virus (H5pg4100) progeny production was 2-fold lower, E1B55K- and E4orf6-defective viruses produced almost 10-fold lower yields. The same observations were made in virus yield experiments using two other HoxB7 knockdown cell clones (data not shown), supporting evidence for HoxB7 homeobox transcription playing a role in positively regulating productive HAdV5 replication. To further substantiate our data, we analyzed viral late protein


expression in the absence and presence of the cellular homeobox protein (Fig. 4B). Consistent with the synthesis of new viral particles, we observed clearly reduced viral late protein synthesis in the HoxB7 knockdown cells during the course of infection with all virus mutants tested (Fig. 4B). Our results indicate that the homeobox protein HoxB7 supports efficient viral replication. Homeobox protein HoxB7 knockdown has no effect on E4orf6 intracellular functions. To exclude the possibility that altered cellular localization of E4orf6 or E1B-55K causes the defects observed in the absence of HoxB7, we performed in situ immunofluorescence analysis (Fig. 5A). Consistent with previous observa-

jvi.asm.org 8301

Müller et al.

FIG 4 HoxB7 depletion decreases HAdV5 progeny production and late viral protein synthesis. (A) Control (pSuper) and shHoxB7-2 knockdown cells were infected with wild-type virus (H5pg4100) and mutant viruses (E1B-55K-null H5pm4149 and E4orf6-null H5pm4154) at a multiplicity of infection of 10 FFU per cell. Viral particles were harvested at 48 and 72 h postinfection, and virus yields were determined by quantitative E2A-72K immunofluorescence staining of W162-infected cells. (B) Control (pSuper) (top panels) and shHoxB7-2 knockdown cells (bottom panels) were infected with wild-type virus (H5pg4100) and mutant viruses (H5pm4154 and H5pm4149) at a multiplicity of infection of 25 FFU per cell and harvested at 24, 48, and 72 h postinfection. Total cell extracts were prepared, and proteins were separated by SDS-PAGE and subjected to immunoblotting using rabbit antiserum to HAdV5 capsid L133, which detects the viral proteins indicated on the right. For the highly expressed, slower-migrating proteins, short exposures are displayed, and for the more weakly expressed, fast-migrating proteins, long exposures are displayed.

8302

jvi.asm.org

Journal of Virology


FIG 5 HoxB7 depletion exhibits no effects on subcellular localization of E1B-55K or E4orf6 or on E3 ubiquitin ligase activity. (A) Control (pSuper) and shHoxB7-2 knockdown cells were left uninfected (mock) or infected with wild-type virus (H5pg4100) or mutant viruses (E4orf6-null H5pm4154 and E1B-55Knull H5pm4149) at a multiplicity of infection of 25 FFU per cell, fixed at 24 h postinfection, and stained with mouse monoclonal 2A6 (E1B-55K) and rabbit polyclonal 1807 (E4orf6) antibodies. Nuclei are shown in blue, labeled with DAPI. E4orf6 protein localization in wild-type H5pg4100- and E1B-55K-null H5pm4149-infected cells is exclusively nuclear, while E4orf6 is not visible in mock- and E4orf6-null H5pm4154-infected cells. Localization of E1B-55K in wild-type H5pg4100 and E4orf6-null H5pm4154 virus-infected cells is nuclear, with distinct cytoplasmic aggregates. In the absence of HoxB7, the cytoplasmic accumulation of E1B-55K, especially in the H5pm4154 mutant, is enhanced. No E1B-55K protein was detected in mock- and H5pm4149-infected cells. (B) Control (pSuper) and shHoxB7-2 knockdown cells were infected with wild-type virus (H5pg4100) and mutant viruses (H5pm4149 and H5pm4154) at a multiplicity of infection of 25 FFU per cell and harvested at 24, 48, and 72 h postinfection. Total cell extracts were prepared, and proteins separated by SDS-PAGE were subjected to immunoblotting using a rabbit polyclonal Mre11 antibody. ␤-Actin served as a loading control.

tions, E4orf6 localized predominantly in the nucleus (28, 60), while E1B-55K was also diffusely distributed with distinct cytoplasmic aggregates (27, 43, 60). The localization patterns of both viral proteins were similar in both parental and HoxB7 knockdown cells, although a greater fraction of E1B-55K seemed to be located in cytoplasmic aggregates in the shHoxB7 cells than in control cells (Fig. 5A). We further analyzed the functional cooperation of E4orf6 with E1B-55K in the absence of HoxB7. Both viral proteins are known


to form an E3 ligase complex, ubiquitinating various cellular targets for proteasomal degradation (4, 6, 7, 17, 18, 32, 57, 64–66; reviewed in references 74, 76, 81, and 83). Our analysis elucidated that degradation patterns of the cellular target Mre11 are very similar in HoxB7 knockdown cells and parental cell lines infected with different virus derivatives (Fig. 5B). As expected, after infection with the wild-type virus, Mre11 expression in both cell lines was reduced, and at 48 h and 72 h postinfection, it was not detectable at all. For the E1B-55K-null and E4orf6-null viruses, slight

jvi.asm.org 8303

Müller et al.

differences in Mre11 levels in pSuper and shHoxB7 cells could be observed. While Mre11 expression was slightly reduced in pSuper cells, this effect did not occur in shHoxB7 cells. Besides the wellcharacterized degradation of Mre11 by E3 ubiquitin ligases, this cellular protein is also known to be targeted by the adenovirus E4orf3 protein and relocalized to cytoplasmic aggregates (2, 84). An interaction of E4orf3 with HoxB7 was not investigated so far and therefore could be the reason for differences in Mre11 levels. Taken together, E4orf6-HoxB7 binding does not influence the functional cooperation between E4orf6 and E1B-55K in virusinfected cells. However, virus progeny production and viral late protein synthesis were greatly reduced in HoxB7 knockdown cells (Fig. 4), again strongly supporting the hypothesis that HoxB7 is a positive factor for HAdV5 replication. HoxB7 depletion reduces HAdV5 early gene products. Next, we examined HAdV5 DNA synthesis in HoxB7-depleted cells by performing quantitative PCR at different time points after viral infection. Viral DNA synthesis of all viruses tested was reduced to roughly equivalent levels in HoxB7 knockdown cells (Fig. 6A). While in wild-type virus-infected cells, this represented an approximately 2-fold reduction, the absence of E4orf6 (H5pm4154) resulted in a 3-fold reduction in viral DNA synthesis compared to levels in parental pSuper cells (Fig. 6A). Reductions in DNA synthesis in virus-infected HoxB7 knockdown cells lacking E1B-55K expression (H5pm4149) ranged between levels obtained in these cells infected with H5pm4154 and H5pg4100. Additional experiments at very early time points (from 8 h to 16 h postinfection) confirmed the negative effect of HoxB7 depletion on viral DNA synthesis (data not shown). To further investigate the effect of HoxB7 on HAdV5 infection, expression of early viral proteins was analyzed at different time points of infection. Expression of the early viral proteins E1A, E2A, E1B-55K, and E4orf6 was slightly reduced in HoxB7 knockdown cells compared to control cells (Fig. 6B). Consistent with these data, analysis of viral early mRNA expression in wild-type H5pm4100-infected cells showed that early HAdV5 messages for E1A, E1B, and E4orf6 were reduced in HoxB7-depleted cells (Fig. 6C). E1A and E1B mRNA levels were 2- to 3-fold lower in the absence of HoxB7, while E4orf6 mRNA expression was only slightly diminished. Compared to wild-type virus-infected cells, mRNA levels of E1B-55K were generally lower in H5pm4149- and H5pm4154-infected cells, while E4orf6 mRNA was somewhat reduced in H5pm4149 virus-infected cells (lacking E1B-55K) and was not detectable in H5pm4154-infected cells. Lower E1B and E4orf6 mRNA levels might be caused by nonsense-mediated mRNA decay (10, 23), a mechanism triggered by premature stop codons introduced into the coding sequence of E1B-55K or E4orf6 to generate negative virus mutants. However, the further reductions in HoxB7 knockdown cells compared to the parental cells suggest that HoxB7 is a positive regulator early in HAdV5 infection, presumably at the transcriptional level. HoxB7 activates transcription of HAdV5 promoters. Since our data point to HoxB7 positively affecting viral early gene transcription, we used transient reporter assays to elucidate the effect of HoxB7 on the activity of adenoviral promoters. Measured luciferase activity and therefore promoter activities of various HAdV5 promoters (E1A, E1B, pIX, E2early [E2e], and major late promoters [MLP]) were lower in HoxB7 knockdown cells than in the parental cells. Significant reductions could be observed for the E1A (7-fold), E2e (17-fold), and major late (4-fold) promoters,

8304

jvi.asm.org

indicating a positive influence of HoxB7 on viral promoter activity (Fig. 7A). To validate our data, we next tested the ability of HoxB7 to bind HAdV5 promoter sequences. After infecting H1299 cells, chromatin was precipitated with a HoxB7-specific MAb or control IgG, and complexed viral DNA was analyzed by quantitative real-time PCR. Our ChIP assay confirmed that HoxB7 interacts specifically with the E1B and E2e promoter regions of wild-type HAdV5 (H5pg4100) (Fig. 7B). In the absence of E4orf6, HoxB7 binding to E1A, E1B, and pIX promoter sequences was enhanced, whereas HoxB7 binding to E2e promoter regions was reduced (H5pm4154) (Fig. 7B). Taken together, our results suggest that the transcription factor HoxB7 directly interacts with specific HAdV5 promoter regions and that expression of the cellular homeobox protein enhances viral gene expression from these promoters. Moreover, it appears that the E4orf6 protein influences the binding of HoxB7 to different promoters and, consequently, their activity. DISCUSSION

HoxB7 belongs to a family of transcription factors, called homeobox proteins, that affect expression of various proteins (61). The discovery that homeobox proteins regulate embryonic development in Drosophila melanogaster exposed their functions as key regulators during embryogenesis in all bilateral animals (61). Homeobox proteins were then found to be essential for organogenesis (e.g., of the lung, thymus, or mammary gland) (39), and recently, additional roles were observed in differentiation of adult tissue (e.g., skin and blood) (26, 41, 52, 77, 82). Hox proteins act as transcription factors by binding regulatory DNA regions via the homeodomain, a 61-aa helix-turn-helix DNA binding motif, either activating or repressing transcription of many target genes (46, 61). Based on this information, numerous target genes have been predicted using computer analysis and microarray experiments, but not all of them could be confirmed experimentally as direct targets (14, 42, 86). However, there is good evidence for direct regulation by one or even more Hox proteins for 35 target genes in different organisms. These genes encode cell-cell signaling molecules or transcription factors and products involved in cell adhesion, cell death, cell migration, and regulation of the cell cycle (61). Since HOX gene products are important factors during cellular differentiation and interact with various cellular factors, they might also be linked to viral infections. Indeed, Hox proteins have been described to influence gene expression and viral replication of two DNA viruses. Recently, Kadota and colleagues identified a functional correlation between human cytomegalovirus (HCMV) immediate-early gene transcription and HoxB5 expression (35), and herpes simplex virus 1 (HSV-1) replicates more efficiently in the corneas of transgenic mice with enhanced HoxA5 expression (24, 48). In our study, we discovered for the first time a functional connection between a homeobox protein and HAdV5. In a yeast twohybrid screen, HoxB7 was identified as a novel cellular interaction partner of the adenoviral early gene product E4orf6. Our experiments confirmed a specific interaction between adenoviral E4orf6 and HoxB7 both in vitro and in vivo. Interestingly, this interaction is enhanced in the absence of E1B-55K and the E3 ubiquitin ligase complex, as shown by immunoprecipitation experiments with an E1B-55K-negative virus mutant and an E4orf6 BC box mutant.

Journal of Virology


FIG 6 HoxB7 depletion represses HAdV5 DNA, early protein, and mRNA synthesis. (A) Control (pSuper) and shHoxB7-2 knockdown cells were infected with wild-type virus (H5pg4100) and mutant viruses (E1B-55K-null H5pm4149 and E4orf6-null H5pm4154) at a multiplicity of infection of 25 FFU per cell and harvested at 16, 24, and 48 h postinfection. Total cell extracts were prepared and treated with proteinase K. Semiquantitative PCR was performed using E1B-55K-specific primers. (B) Control (pSuper) and shHoxB7 knockdown cells were infected with wild-type virus (H5pg4100) and mutant viruses (H5pm4149 and H5pm4154) at a multiplicity of infection of 25 FFU per cell and harvested at 24, 48, and 72 h postinfection. Total cell extracts were prepared, and proteins were separated by SDS-PAGE and subjected to immunoblotting using mouse MAbs M73 (E1A), B6-8 (E2A), and 2A6 (E1B-55K) and the rabbit polyclonal antibody 1807 (E4orf6). (C) Control (pSuper) and shHoxB7-2 knockdown cells were infected with wild-type virus (H5pg4100) and mutant viruses (H5pm4149 and H5pm4154) at a multiplicity of infection of 25 FFU per cell and harvested at 16, 24, and 48 h postinfection. Total RNA was extracted, reverse transcribed, and quantified by RT-PCR analysis using primers specific for E1A, E1B, and E4orf6 (Table 1). The data were normalized to 18S rRNA levels.


jvi.asm.org 8305

Müller et al.

FIG 7 HoxB7-activating function of viral transcription by binding to HAdV5 promoters is affected by E4orf6. (A) Control (pSuper) and shHoxB7-2 knockdown cells were transfected with plasmids encoding firefly luciferase under the control of the E1A, E1B, pIX, E2e, and major late (MLP) promoters. Fortyeight hours after transfection, samples were lysed, absolute luciferase activity was measured, and activity of the HAdV5 promoter in pSuper cells was normalized to 100%. Data are means and standard deviations for three independent experiments. (B) H1299 cells were infected with wild-type virus (H5pg4100) and E4orf6-negative virus (H5pm4154) at a multiplicity of infection of 10 FFU. Cells were fixed with formaldehyde, and ChIP analysis was performed with a HoxB7 mouse MAb as described in Materials and Methods. The average CT value was determined from triplicate reactions and normalized against nonspecific IgG controls by use of a standard curve for each primer pair. Error bars indicate the standard errors of the means. The identities of the products obtained were confirmed by melting curve analysis. The y axis indicates the percentage of immunoprecipitated signal from the input (100%). The dotted line highlights values above 1% of input, commonly stated as significant chromatin/protein binding.

Previous reports demonstrated that only about 50% of total E4orf6 protein expressed in late-stage infected cells associates with E1B-55K (16). This suggests that different functional fractions of the E4orf6 protein are present in virus-infected cells (69). It is therefore tempting to speculate that E4orf6 not associated with E1B-55K interacts more efficiently with HoxB7. E4orf6 and E1B55K are known to form an E3 ubiquitin ligase in cooperation with various cellular factors, initiating proteasomal degradation of cellular substrates to support maximum viral replication (4, 18, 64; reviewed in references 74 and 83). It is believed that the E3 ligase is essential for nucleocytoplasmic export of late viral mRNAs and blocking of cellular mRNA transport (7, 15, 88). As our data indicate, E3 ubiquitin ligase activity is not affected by depleting HoxB7, since Mre11 degradation is altered only slightly.

8306

jvi.asm.org

Recent findings showed that the intracellular localization of both early viral factors is crucial for their functions during HAdV5 replication (21, 54, 59). However, HoxB7 had no significant effect on intracellular localization of E4orf6 or E1B-55K. E1B-55K cytoplasmic accumulation was enhanced to some extent in HoxB7depleted cells, but this seems not to be sufficient to explain the defects observed in these cells. Using a HoxB7 knockdown cell line, we observed a positive role of HoxB7 in adenovirus replication. Our experiments demonstrate that the absence of HoxB7 leads to less early viral mRNA and thus to early viral protein expression, resulting in considerably less viral late protein expression and inefficient viral progeny production. Intriguingly, the strongest effect on viral progeny production in the absence of HoxB7 was observed in the E4orf6negative virus H5pm4154. Although knockdown of HoxB7 reduced viral progeny production, additional depletion of E4orf6 amplified this effect. HoxB7 plays a positive role in the very early phase of HAdV5 infection by interacting with and activating viral promoters, affecting expression of viral gene products. This is likely the reason that the homeobox transcription factor HoxB7 is important for efficient viral progeny production. Similar observations were made for the HoxA5 protein, which binds to a specific region in immediate-early promoters of HSV-1, resulting in increased viral replication (24). In sum, studies with HSV-1, HCMV, and now HAdV5 indicate that DNA virus gene expression is highly regulated by different proteins of the homeobox family of transcription factors. The consequences are not virus family specific but provoke global changes in transcriptional activity allowing transcriptional activation of viral promoters. Together, these results suggest that different viruses evolved to interact with different Hox proteins in certain tissues, possibly because various Hox proteins have tissue-specific functions and expression patterns (41, 61, 82). Nevertheless, since 39 Hox proteins have been identified, it is tempting to speculate that further Hox proteins are involved in regulating viral transcription. Ongoing studies are seeking to identify additional homeobox proteins involved in regulating HAdV5 replication. It is well known that Hox proteins bind to similar target sequences in vitro via their homeodomain, mostly recognizing TAAT core sequences (11). Thus, the affinity and specificity of DNA binding are controlled by the presence of tissue-specific cofactors (50) and, presumably, tissue-specific chromatin alterations (25). Since the absence of E4orf6 results in more efficient HoxB7 binding to adenoviral promoters, our data suggest that E4orf6 regulates binding of HoxB7 to HAdV5 DNA. So far, a direct effect of E4orf6 on promoter activity cannot be excluded completely. In this context, recent findings describe the functional interaction of E4orf6 with the transcription factor RUNX-1 (44), most likely affecting the intranuclear localization of E1B-55K. RUNX-1 colocalizes adjacent to nuclear sites of viral transcription; however, the effect of this transcription factor was not examined. Moreover, a new function of E4orf6 was recently unveiled, as the protein seems to be involved in transactivation of parvovirus B19 replication in endothelial cells (63). Besides E1A expression, E4orf6 expression enhances the activity of the parvovirus p6 promoter. Consistent with our study, a fraction of E4orf6 that is not associated with E1B-55K seems to be involved. Together with recently published data, our observations indicate a novel role for E4orf6 in regulating HAdV5 transcription. Future experiments should address whether homeobox-related transcription factors

Journal of Virology


might represent a new group of E4orf6 interaction partners involved in HAdV5 replication. Moreover, evidence is growing that misregulation of certain homeobox proteins is linked to leukemia and solid tumors of different organs (1, 12, 13, 29, 40, 67). While underlying mechanisms are not completely understood, this is believed to involve altering the balance between proliferation and differentiation in the corresponding cells (12). Modulation of Hox functions may affect gene expression and interferes with host cell homeostasis. These changes may be linked closely to genomic instability and predispose cells to oncogenic transformation. In this context, our recent studies already provided evidence that the E4orf6 protein is encoded by a viral oncogene and promotes focus formation of primary baby rat kidney (BRK) cells in cooperation with HAdV5 E1 proteins (51, 53). The mechanism by which the E4orf6 protein enhances adenoviral transformation is not fully understood. It is very likely related to the ability of E4orf6 to interact with and modulate functional properties of p53 (19, 53). In concordance with the current study, we assume that the functional interaction of the E4orf6 oncodomain with HoxB7 may also contribute to cell transformation by modulating E4orf6 and/or HoxB7 functions and gene expression. Therefore, elucidating the role of homeobox proteins in both HAdV5 transcriptional regulation and adenoviral transformation of primary cells will be of substantial importance for defining new mechanisms of oncogenic transformation. These findings might also help to identify novel therapeutic approaches to modern cancer therapy. ACKNOWLEDGMENTS We thank Judith Gasson (UCLA) for providing the HoxB7-FLAG construct. The Heinrich Pette Institute, Leibniz Institute for Experimental Virology, is supported by the Freie und Hansestadt Hamburg and the Bundesministerium für Gesundheit (BMG). Part of this work was supported by the Erich und Gertrud Roggenbuck Stiftung, the Horst Müggenburg Stiftung, and the Wilhelm Sander Stiftung.

REFERENCES 1. Abate-Shen C. 2002. Deregulated homeobox gene expression in cancer: cause or consequence? Nat. Rev. Cancer 2:777–785. 2. Araujo FD, Stracker TH, Carson CT, Lee DV, Weitzman MD. 2005. Adenovirus type 5 E4orf3 protein targets the Mre11 complex to cytoplasmic aggresomes. J. Virol. 79:11382–11391. 3. Babich A, Feldman LT, Nevins Jr, Darnell JE, Jr, Weinberger C. 1983. Effect of adenovirus on metabolism of specific host mRNAs: transport control and specific translational discrimination. Mol. Cell. Biol. 3:1212– 1221. 4. Baker A, Rohleder KJ, Hanakahi LA, Ketner G. 2007. Adenovirus E4 34k and E1b 55k oncoproteins target host DNA ligase IV for proteasomal degradation. J. Virol. 81:7034 –7040. 5. Blackford AN, et al. 2010. Adenovirus 12 E4orf6 inhibits ATR activation by promoting TOPBP1 degradation. Proc. Natl. Acad. Sci. U. S. A. 107: 12251–12256. 6. Blanchette P, et al. 2004. Both BC-box motifs of adenovirus protein E4orf6 are required to efficiently assemble an E3 ligase complex that degrades p53. Mol. Cell. Biol. 24:9619 –9629. 7. Blanchette P, et al. 2008. Control of mRNA export by adenovirus E4orf6 and E1B55K proteins during productive infection requires E4orf6 ubiquitin ligase activity. J. Virol. 82:2642–2651. 8. Boivin D, Morrison MR, Marcellus RC, Querido E, Branton PE. 1999. Analysis of synthesis, stability, phosphorylation, and interacting polypeptides of the 34-kilodalton product of open reading frame 6 of the early region 4 protein of human adenovirus type 5. J. Virol. 73:1245–1253. 9. Brown LM, Gonzalez RA, Novotny J, Flint SJ. 2001. Structure of the adenovirus E4 Orf6 protein predicted by fold recognition and comparative protein modeling. Proteins 44:97–109.


10. Byers PH. 2002. Killing the messenger: new insights into nonsensemediated mRNA decay. J. Clin. Invest. 109:3– 6. 11. Chan SK, Mann RS. 1996. A structural model for a homeotic proteinextradenticle-DNA complex accounts for the choice of HOX protein in the heterodimer. Proc. Natl. Acad. Sci. U. S. A. 93:5223–5228. 12. Chen H, Sukumar S. 2003. HOX genes: emerging stars in cancer. Cancer Biol. Ther. 2:524 –525. 13. Cillo C, Cantile M, Faiella A, Boncinelli E. 2001. Homeobox genes in normal and malignant cells. J. Cell. Physiol. 188:161–169. 14. Cobb J, Duboule D. 2005. Comparative analysis of genes downstream of the Hoxd cluster in developing digits and external genitalia. Development 132:3055–3067. 15. Corbin-Lickfett KA, Bridge E. 2003. Adenovirus E4-34kDa requires active proteasomes to promote late gene expression. Virology 315:234 –244. 16. Cutt JR, Shenk T, Hearing P. 1987. Analysis of adenovirus early region 4-encoded polypeptides synthesized in productively infected cells. J. Virol. 61:543–552. 17. Dallaire F, Blanchette P, Branton PE. 2009. A proteomic approach to identify candidate substrates of human adenovirus E4orf6-E1B55K and other viral cullin-based E3 ubiquitin ligases. J. Virol. 83:12172–12184. 18. Dallaire F, Blanchette P, Groitl P, Dobner T, Branton PE. 2009. Identification of integrin alpha3 as a new substrate of the adenovirus E4orf6/ E1B 55-kilodalton E3 ubiquitin ligase complex. J. Virol. 83:5329 –5338. 19. Dobner T, Horikoshi N, Rubenwolf S, Shenk T. 1996. Blockage by adenovirus E4orf6 of transcriptional activation by the p53 tumor suppressor. Science 272:1470 –1473. 20. Durfee T, et al. 1993. The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Dev. 7:555–569. 21. Endter C, Kzhyshkowska J, Stauber R, Dobner T. 2001. SUMO-1 modification required for transformation by adenovirus type 5 early region 1B 55-kDa oncoprotein. Proc. Natl. Acad. Sci. U. S. A. 98:11312–11317. 22. Forrester NA, et al. 2012. Adenovirus E4orf3 targets transcriptional intermediary factor 1␥ for proteasome-dependent degradation during infection. J. Virol. 86:3167–3179. 23. Frischmeyer PA, Dietz HC. 1999. Nonsense-mediated mRNA decay in health and disease. Hum. Mol. Genet. 8:1893–1900. 24. Galle LE, Taus NS, Maggs DJ, Moore CP, Mitchell WJ. 2001. Increased severity of herpes simplex virus type 1-induced keratitis in Hox A5 transgenic mice. Curr. Eye Res. 23:435– 442. 25. Getzenberg RH. 1994. Nuclear matrix and the regulation of gene expression: tissue specificity. J. Cell Biochem. 55:22–31. 26. Giampaolo A, et al. 1994. Key functional role and lineage-specific expression of selected HOXB genes in purified hematopoietic progenitor differentiation. Blood 84:3637–3647. 27. Gonzalez RA, Flint SJ. 2002. Effects of mutations in the adenoviral E1B 55-kilodalton protein coding sequence on viral late mRNA metabolism. J. Virol. 76:4507– 4519. 28. Goodrum FD, Shenk T, Ornelles DA. 1996. Adenovirus early region 4 34-kilodalton protein directs the nuclear localization of the early region 1B 55-kilodalton protein in primate cells. J. Virol. 70:6323– 6335. 29. Grier DG, et al. 2005. The pathophysiology of HOX genes and their role in cancer. J. Pathol. 205:154 –171. 30. Groitl P, Dobner T. 2007. Construction of adenovirus type 5 early region 1 and 4 virus mutants. Methods Mol. Med. 130:29 –39. 31. Gunther T, Grundhoff A. 2010. The epigenetic landscape of latent Kaposi sarcoma-associated herpesvirus genomes. PLoS Pathog. 6:e1000935. doi: 10.1371/journal.ppat.1000935. 32. Harada JN, Shevchenko A, Pallas DC, Berk AJ. 2002. Analysis of the adenovirus E1B-55K-anchored proteome reveals its link to ubiquitination machinery. J. Virol. 76:9194 –9206. 33. Harlow E, Franza BR, Jr, Schley C. 1985. Monoclonal antibodies specific for adenovirus early region 1A proteins: extensive heterogeneity in early region 1A products. J. Virol. 55:533–546. 34. Imperiale MJ, Akusjärvi G, Leppard KN. 1995. Post-transcriptional control of adenovirus gene expression. Curr. Top. Microbiol. Immunol. 199:139 –171. 35. Kadota C, Nagahama M, Tsutsui Y. 1992. Relationship between HOX2 homeobox gene expression and the human cytomegalovirus immediate early genes. J. Gen. Virol. 73:975–981. 36. Kindsmüller K, et al. 2007. Intranuclear targeting and nuclear export of the adenovirus E1B-55K protein are regulated by SUMO1 conjugation. Proc. Natl. Acad. Sci. U. S. A. 104:6684 – 6689. 37. Kindsmüller K, et al. 2009. A 49-kilodalton isoform of the adenovirus

jvi.asm.org 8307

Müller et al.

38. 39. 40. 41. 42. 43. 44. 45.

46. 47. 48. 49. 50. 51. 52. 53.

54. 55. 56. 57. 58. 59. 60.

61. 62. 63.

type 5 early region 1B 55-kilodalton protein is sufficient to support virus replication. J. Virol. 83:9045–9056. Komatsu T, Haruki H, Nagata K. 2011. Cellular and viral chromatin proteins are positive factors in the regulation of adenovirus gene expression. Nucleic Acids Res. 39:889 –901. Krumlauf R. 1994. Hox genes in vertebrate development. Cell 78:191–201. Lawrence HJ, Fischbach NA, Largman C. 2005. HOX genes: not just myeloid oncogenes any more. Leukemia 19:1328 –1330. Lawrence HJ, Sauvageau G, Humphries RK, Largman C. 1996. The role of HOX homeobox genes in normal and leukemic hematopoiesis. Stem Cells 14:281–291. Lei H, Wang H, Juan AH, Ruddle FH. 2005. The identification of Hoxc8 target genes. Proc. Natl. Acad. Sci. U. S. A. 102:2420 –2424. Lethbridge KJ, Scott GE, Leppard KN. 2003. Nuclear matrix localization and SUMO-1 modification of adenovirus type 5 E1b 55K protein are controlled by E4 Orf6 protein. J. Gen. Virol. 84:259 –268. Marshall LJ, et al. 2008. RUNX1 permits E4orf6-directed nuclear localization of the adenovirus E1B-55K protein and associates with centers of viral DNA and RNA synthesis. J. Virol. 82:6395– 6408. Marton MJ, Baim SB, Ornelles DA, Shenk T. 1990. The adenovirus E4 17-kilodalton protein complexes with the cellular transcription factor E2F, altering its DNA-binding properties and stimulating E1Aindependent accumulation of E2 mRNA. J. Virol. 64:2345–2359. Mavilio F. 1993. Regulation of vertebrate homeobox-containing genes by morphogens. Eur. J. Biochem. 212:273–288. Miron MJ, et al. 2009. Localization and importance of the adenovirus E4orf4 protein during lytic infection. J. Virol. 83:1689 –1699. Mitchell WJ, De Santo RJ, Zhang SD, Odenwald WF, Arnheiter H. 1993. Herpes simplex virus pathogenesis in transgenic mice is altered by the homeodomain protein Hox 1.3. J. Virol. 67:4484 – 4491. Mitsudomi T, et al. 1992. p53 gene mutations in non-small-cell lung cancer cell lines and their correlation with the presence of ras mutations and clinical features. Oncogene 7:171–180. Moens CB, Selleri L. 2006. Hox cofactors in vertebrate development. Dev. Biol. 291:193–206. Moore M, Horikoshi N, Shenk T. 1996. Oncogenic potential of the adenovirus E4orf6 protein. Proc. Natl. Acad. Sci. U. S. A. 93:11295–11301. Morasso MI, Markova NG, Sargent TD. 1996. Regulation of epidermal differentiation by a Distal-less homeodomain gene. J. Cell Biol. 135:1879–1887. Nevels M, Rubenwolf S, Spruss T, Wolf H, Dobner T. 1997. The adenovirus E4orf6 protein can promote E1A/E1B-induced focus formation by interfering with p53 tumor suppressor function. Proc. Natl. Acad. Sci. U. S. A. 94:1206 –1211. Nevels M, Rubenwolf S, Spruss T, Wolf H, Dobner T. 2000. Two distinct activities contribute to the oncogenic potential of the adenovirus type 5 E4orf6 protein. J. Virol. 74:5168 –5181. ¨ hman K, Akusjärvi G. 1994. Human adenovirus encodes Nordqvist K, O two proteins which have opposite effects on accumulation of alternatively spliced mRNAs. Mol. Cell. Biol. 14:437– 445. ¨ hman K, Nordqvist K, Akusjärvi G. 1993. Two adenovirus proteins O with redundant activities in virus growth facilitates tripartite leader mRNA accumulation. Virology 194:50 –58. Orazio NI, Naeger CM, Karlseder J, Weitzman MD. 2011. The adenovirus E1b55K/E4orf6 complex induces degradation of the Bloom helicase during infection. J. Virol. 85:1887–1892. Orlando JS, Ornelles DA. 1999. An arginine-faced amphipathic alpha helix is required for adenovirus type 5 e4orf6 protein function. J. Virol. 73:4600 – 4610. Orlando JS, Ornelles DA. 2002. E4orf6 variants with separate abilities to augment adenovirus replication and direct nuclear localization of the E1B 55-kilodalton protein. J. Virol. 76:1475–1487. Ornelles DA, Shenk T. 1991. Localization of the adenovirus early region 1B 55-kilodalton protein during lytic infection: association with nuclear viral inclusions requires the early region 4 34-kilodalton protein. J. Virol. 65:424 – 429. Pearson JC, Lemons D, McGinnis W. 2005. Modulating Hox gene functions during animal body patterning. Nat. Rev. Genet. 6:893–904. Plowright L, Harrington KJ, Pandha HS, Morgan R. 2009. HOX transcription factors are potential therapeutic targets in non-small-cell lung cancer (targeting HOX genes in lung cancer). Br. J. Cancer 100:470 – 475. Pozzuto T, et al. 2011. Transactivation of human parvovirus B19 gene expression in endothelial cells by adenoviral helper functions. Virology 411:50 – 64.

8308

jvi.asm.org

64. Querido E, et al. 2001. Degradation of p53 by adenovirus E4orf6 and E1B55K proteins occurs via a novel mechanism involving a Cullincontaining complex. Genes Dev. 15:3104 –3117. 65. Querido E, et al. 1997. Regulation of p53 levels by the E1B 55-kilodalton protein and E4orf6 in adenovirus-infected cells. J. Virol. 71:3788 –3798. 66. Querido E, et al. 2001. Identification of three functions of the adenovirus e4orf6 protein that mediate p53 degradation by the E4orf6-E1B55K complex. J. Virol. 75:699 –709. 67. Raman V, et al. 2000. Compromised HOXA5 function can limit p53 expression in human breast tumours. Nature 405:974 –978. 68. Reich NC, Sarnow P, Duprey E, Levine AJ. 1983. Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNAbinding protein. Virology 128:480 – 484. 69. Rubenwolf S, Schutt H, Nevels M, Wolf H, Dobner T. 1997. Structural analysis of the adenovirus type 5 E1B 55-kilodalton-E4orf6 protein complex. J. Virol. 71:1115–1123. 70. Saka Y, Esashi F, Matsusaka T, Mochida S, Yanagida M. 1997. Damage and replication checkpoint control in fission yeast is ensured by interactions of Crb2, a protein with BRCT motif, with Cut5 and Chk1. Genes Dev. 11:3387–3400. 71. Saka Y, et al. 1994. Fission yeast cut5 links nuclear chromatin and M phase regulator in the replication checkpoint control. EMBO J. 13:5319–5329. 72. Sarnow P, Sullivan CA, Levine AJ. 1982. A monoclonal antibody detecting the adenovirus type 5-E1b-58Kd tumor antigen: characterization of the E1b-58Kd tumor antigen in adenovirus-infected and -transformed cells. Virology 120:510 –517. 73. Schreiner S, et al. 2012. Transcriptional activation of the adenoviral genome is mediated by capsid protein. PLoS Pathog. 8:e1002549. doi: 10.1371/journal.ppat.1002549. 74. Schreiner S, Wimmer P, Dobner T. 2012. Adenovirus degradation of cellular proteins. Future Microbiol. 7:211–225. 75. Schreiner S, et al. 2011. Adenovirus type 5 early region 1B 55K oncoprotein-dependent degradation of cellular factor Daxx is required for efficient transformation of primary rodent cells. J. Virol. 85:8752– 8765. 76. Schreiner S, et al. 2010. Proteasome-dependent degradation of Daxx by the viral E1B-55K protein in human adenovirus-infected cells. J. Virol. 84:7029 –7038. 77. Scott GA, Goldsmith LA. 1993. Homeobox genes and skin development: a review. J. Invest. Dermatol. 101:3– 8. 78. Si H, Verma SC, Robertson ES. 2006. Proteomic analysis of the Kaposi’s sarcoma-associated herpesvirus terminal repeat element binding proteins. J. Virol. 80:9017–9030. 79. Sieber T, Dobner T. 2007. Adenovirus type 5 early region 1B 156R protein promotes cell transformation independently of repression of p53stimulated transcription. J. Virol. 81:95–105. 80. Smiley JK, Young MA, Flint SJ. 1990. Intranuclear location of the adenovirus type 5 E1B 55-kilodalton protein. J. Virol. 64:4558 – 4564. 81. Steegenga WT, Riteco N, Jochemsen AG, Fallaux FJ, Bos JL. 1998. The large E1B protein together with the E4orf6 protein target p53 for active degradation in adenovirus infected cells. Oncogene 16:349 –357. 82. Stelnicki EJ, et al. 1998. HOX homeobox genes exhibit spatial and temporal changes in expression during human skin development. J. Invest. Dermatol. 110:110 –115. 83. Stracker TH, Carson CT, Weitzman MD. 2002. Adenovirus oncoproteins inactivate the Mre11-Rad50-NBS1 DNA repair complex. Nature 418:348 –352. 84. Stracker TH, et al. 2005. Serotype-specific reorganization of the Mre11 complex by adenoviral E4orf3 proteins. J. Virol. 79:6664 – 6673. 85. Wendt J, et al. 2006. Induction of p21CIP/WAF-1 and G2 arrest by ionizing irradiation impedes caspase-3-mediated apoptosis in human carcinoma cells. Oncogene 25:972–980. 86. Williams TM, et al. 2005. Candidate downstream regulated genes of HOX group 13 transcription factors with and without monomeric DNA binding capability. Dev. Biol. 279:462– 480. 87. Winkler M, aus Dem Siepen T, Stamminger T. 2000. Functional interaction between pleiotropic transactivator pUL69 of human cytomegalovirus and the human homolog of yeast chromatin regulatory protein SPT6. J. Virol. 74:8053– 8064. 88. Woo JL, Berk AJ. 2007. Adenovirus ubiquitin-protein ligase stimulates viral late mRNA nuclear export. J. Virol. 81:575–587. 89. Zhao LY, Colosimo AL, Liu Y, Wan Y, Liao D. 2003. Adenovirus E1B 55-kilodalton oncoprotein binds to Daxx and eliminates enhancement of p53-dependent transcription by Daxx. J. Virol. 77:11809 –11821.

Journal of Virology