Functional Expression and Subcellular Localization of the Affatoxin ...

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2008, p. 6385–6396 0099-2240/08/$08.00⫹0 doi:10.1128/AEM.01185-08 Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Vol. 74, No. 20

Functional Expression and Subcellular Localization of the Aflatoxin Pathway Enzyme Ver-1 Fused to Enhanced Green Fluorescent Protein䌤† Sung-Yong Hong1 and John E. Linz1,2,3,4* Department of Food Science and Human Nutrition,1 National Food Safety and Toxicology Center,2 Department of Microbiology and Molecular Genetics,3 and Center for Integrative Toxicology,4 Michigan State University, East Lansing, Michigan 48824 Received 28 May 2008/Accepted 14 August 2008

Aflatoxin, a mycotoxin synthesized by Aspergillus spp., is among the most potent naturally occurring carcinogens known. Little is known about the subcellular organization of aflatoxin synthesis. Previously, we used transmission electron microscopy and immunogold labeling to demonstrate that the late aflatoxin enzyme OmtA localizes primarily to vacuoles in fungal cells on the substrate surface of colonies. In the present work, we monitored subcellular localization of Ver-1 in real time in living cells. Aspergillus parasiticus strain CS10-N2 was transformed with plasmid constructs that express enhanced green fluorescent protein (EGFP) fused to Ver-1. Analysis of transformants demonstrated that EGFP fused to Ver-1 at either the N or C terminus functionally complemented nonfunctional Ver-1 in recipient cells. Western blot analysis detected predominantly full-length Ver-1 fusion proteins in transformants. Confocal laser scanning microscopy demonstrated that Ver-1 fusion proteins localized in the cytoplasm and in the lumen of up to 80% of the vacuoles in hyphae grown for 48 h on solid media. Control EGFP (no Ver-1) expressed in transformants was observed in only 13% of the vacuoles at this time. These data support a model in which middle and late aflatoxin enzymes are synthesized in the cytoplasm and transported to vacuoles, where they participate in aflatoxin synthesis. on solid media; we observed very little Nor-1 or Ver-1 in this location, and these proteins were not detected in vacuoles. ver-1 encodes a 28-kDa NADPH-dependent reductase involved in conversion of versicolorin A (VA) to demethylsterigmatocystin (15, 17, 37). Only one (ver-1A) of the two copies of ver-1 (ver-1A and ver-1B) in A. parasiticus SU-1 encodes a functional enzyme (24). In strain CS10-N2, both ver-1 genes are nonfunctional; this strain accumulates VA. VA and late AF pathway intermediates possess a bisfuran ring. The double bond in this structure is highly susceptible to 8,9-epoxide formation; this mutagenic and genotoxic compound can generate adducts with DNA and protein (29). We hypothesized that early AF biosynthetic pathway enzymes function in the cytoplasm, whereas middle and late pathway enzymes function in vacuoles to protect cells from the toxicity associated with VA and late AF pathway intermediates. In the present work, we developed an enhanced green fluorescent protein (EGFP) reporter system as an independent method to test our hypothesis. These data support a model in which middle and late AF enzymes are synthesized in the cytoplasm and transported to vacuoles, where they participate in AF synthesis.

Aflatoxins (AF) are toxic and carcinogenic secondary metabolites synthesized primarily by the filamentous fungi Aspergillus parasiticus and Aspergillus flavus when they grow on economically important food and feed crops, including peanuts, tree nuts, corn, and cottonseed (5, 11, 12, 28, 33). AF contamination of food and feed results in large economic losses and significant human and animal health risks (7, 14). AF biosynthesis is a complex process that requires at least 17 enzyme activities encoded by 26 or more individual genes; these are clustered within a 70-kb region on one chromosome (42, 43). The biochemistry and molecular biology of AF synthesis have been studied intensively, but little is known about the subcellular organization of the AF pathway. Several enzyme activities involved in AFB1 biosynthesis were detected in a microsomal fraction (4, 19, 41), suggesting membrane localization; other activities were found in the cytoplasm or loosely bound to membranes (4, 19, 35, 41). Previously, we used immunogold labeling and transmission electron microscopy (TEM) to refine the localization analysis (21). Early (Nor-1), middle (Ver-1), and late (OmtA) AF biosynthetic pathway enzymes were observed primarily in the cytoplasm of fungal colonies grown 24 to 48 h on a solid, AFinducing medium. However, OmtA also was detected primarily in vacuoles in cells near the substrate surface of fungal colonies

MATERIALS AND METHODS Fungal strains and culture conditions. A. parasiticus NR-1 (carrying niaD, which encodes nitrate reductase), used as the recipient for control plasmids expressing EGFP (i.e., carrying the niaD selectable marker), was derived from A. parasiticus NRRL 5862 (SU-1 [ATCC 56775]) (18). A. parasiticus CS10-N2 (ver-1 niaD pyrG wh-1) (kindly provided by P.-K. Chang, USDA/ARS Southern Regional Research Center), used as the recipient strain for plasmids expressing EGFP fused to Ver-1 (carrying niaD), was derived from A. parasiticus CS10 (ver-1 pyrG wh-1) (3, 20, 38, 39). A. parasiticus was cultured in YES liquid medium (2% yeast extract, 6% sucrose [pH 5.8]) or YES plus 20 mM uracil

* Corresponding author. Mailing address: Department of Food Science and Human Nutrition, 234B GM Trout Building, Michigan State University, East Lansing, MI 48824. Phone: (517) 355-8474. Fax: (517) 353-8963. E-mail: [email protected]. † Supplemental material for this article may be found at http://aem .asm.org/. 䌤 Published ahead of print on 29 August 2008. 6385

6386

HONG AND LINZ

FIG. 1. Restriction endonuclease map of plasmid pAPGFPVNB. The 0.6-kb ver-1 promoter was fused in frame to the 0.7-kb egfp coding region, followed by the 2.1-kb ver-1 terminator. The 7.4-kb niaD fragment was inserted as a selectable marker for transformation of the recipient strain NR-1 (niaD).

(YES20) at 30°C in the dark with shaking at 150 rpm (batch fermentation) for genomic DNA isolation, for total protein extraction, to measure mycelial dry weight, and to analyze EGFP fluorescence and AF concentration as described previously (25, 39). Either Czapek-Dox (CZ; Difco Laboratories, Detroit, MI) supplemented with 1% peptone or YES liquid medium was used to grow the recipient strain NR-1 for transformation. Potato dextrose broth (PDB; Difco Laboratories, Detroit, MI) supplemented with 20 mM uracil (PDB20) was used to grow the recipient strain CS10-N2 for transformation (39). CZ agar supplemented with 20% sucrose and CZ agar containing 20% sucrose and 20 mM uracil, (CZ20) and Cove’s trace element solution (13) were used as selective media for transformants of strains NR-1 and CS10-N2, respectively. Coconut agar medium plus 20 mM uracil (CAM20) was used to screen AF accumulation in CS10-N2 transformants under UV light at 365 nm (8) and for EGFP expression in transformants (fluorescence microscopy). We conducted CLSM analysis of fungal colonies grown on YES or YES20 agar blocks (slide culture). Fungal colonies grown on YES20 agar (1.5% agar) were extracted to generate AF and AF intermediates from transformants for thin-layer chromatography (TLC) and enzyme-linked immunosorbent assay (ELISA) analyses. Either potato dextrose agar (Difco Laboratories, Detroit, MI) or CZ20 was used for conidiospore preparation (37). Construction of pAPGFPVNB. The expression plasmid pAPGFPVNB (Fig. 1) was constructed using the ver-1 promoter and terminator fragments, an egfp gene fragment, and pNANG-3 (27) as a plasmid backbone. The 0.6-kb ver-1 promoter and 2.1-kb ver-1 terminator fragments were generated by PCR with Pfu DNA polymerase (Stratagene, La Jolla, CA), appropriate primers, and cosmid NorA (24) as a template using standard procedures (26). See Table 1 for all primer sequences. The 0.7-kb egfp gene was generated by PCR using pEGFP-N1 (Clonetech Laboratories, Palo Alto, CA) as a template. PCR was performed in a Gene Amp PCR system 2400 thermal cycler (Perkin-Elmer Life Sciences Inc., Boston, MA). The reaction conditions were as follows: 94°C for 5 min followed by 25 cycles of 94°C for 1 min, annealing for 1 min (see Table 1 for annealing temperatures), and extension at 72°C (time dependent on PCR fragment size: 2 min/1 kb). The reaction was completed with a final extension at 72°C for 10 min. The PCR fragments were digested with appropriate restriction enzymes and cloned into pNEB-N1 (27), resulting in pGFPV. DNA fragments were subcloned from pGFPV into pNANG-3 (27), resulting in pAPGFPVNB1. The ver-1 promoter and egfp gene fragments in pAPGFPVNB1 were replaced with modified ver-1 promoter and modified egfp gene fragments to generate pAPGFPVNB2 and -3 (Table 1). Construction of plasmids expressing EGFP fused to Ver-1. pAPGFPVNB3 served as the plasmid backbone. To express EGFP fused to the C terminus of Ver-1, a 2.0-kb ver-1 promoter/gene fragment was generated by PCR with Pfu DNA polymerase, appropriate primers, and cosmid NorA (24) as a template (26). PCR conditions similar to those for pAPGFPVNB3 were used (Table 1). PCR fragments digested with PacI and NotI were cloned into pAPGFPVNB3 (Fig. 1) cut with the same enzymes, resulting in pAPCGFPVFNB (see Fig. 3). To express EGFP fused to the N terminus of Ver-1, a 0.9-kb ver-1 gene fragment was generated by PCR with Pfu DNA polymerase, appropriate primers, and cosmid NorA (24) as a template using standard procedures (26). The 0.7-kb egfp gene fragment was generated by PCR with Pfu DNA polymerase and appropriate primers using pEGFP-N1 as a template. PCR fragments were cloned into the

APPL. ENVIRON. MICROBIOL. SmaI site of pUC19, resulting in pUCGFP and pUCVER. DNA fragments containing the ver-1 gene were subcloned from pUCVER into pUCGFP cut with SgfI and SalI, resulting in pUCGFPVER. DNA fragments containing the gfp gene and the ver-1 gene were then subcloned from pUCGFPVER into pAPGFPVNB3 (Fig. 1) cut with NotI and FseI, resulting in pAPNGFPVFNB. Transformation of A. parasiticus: screening of NR-1 and CS10-N2 transformants. Transformation of A. parasiticus NR-1 with pAPGFPVNB and CS10-N2 with pAPCGFPVFNB or pAPNGFPVFNB was performed by a polyethylene glycol method (30) with minor modifications as described previously (38). NR-1 transformants were screened for EGFP under a Nikon Eclipse E600 fluorescence microscope (Nikon, Inc., Melville, NY) using a 450- to 490-nm excitation/515-nm emission filter. We screened CS10-N2 transformants for blue fluorescent haloes (AF) under UV light at 365 nm and for EGFP as described above. Slide culture. Slide culture was performed by a published method (16) with minor modifications described previously (23). Genomic DNA isolation from A. parasiticus. Genomic DNA was isolated by a phenol-chloroform method (1) with minor modifications as described previously (38). Southern hybridization and PCR analyses. Southern hybridization analyses were conducted using standard procedures (26). Approximately 10 ␮g of genomic DNA from NR-1 transformants was cut with HincII, or that from the CS10-N2 transformants was cut with PstI. The resulting fragments were separated by agarose gel electrophoresis and transferred onto Nytran supercharge membrane (Schleicher and Schell, Inc., Keene, NH) by capillary action. We radiolabeled the 0.6-kb ver-1A promoter fragment for NR-1 transformants and the 0.7-kb egfp gene fragment for CS10-N2 transformants to use as probes. PCR analysis of NR-1 and CS10-N2 transformants was performed with genomic DNA and primers specific to the promoter or terminator of ver-1 to confirm integration sites of the plasmids and to determine if fusion proteins carried a functional Ver-1 protein. The DNA sequence of the ver-1A gene fused to egfp was confirmed at the Research Technology Support Facility (Macromolecular Structure, Sequencing and Synthesis Facility) at Michigan State University. AF and AF intermediate analyses by TLC and ELISA. AF and AF intermediates were extracted by a published method (34). TLC was conducted on AF and AF intermediate extracts using a TEA solvent system (toluene-ethyl acetateacetic acid at 50:30:4 [vol/vol/vol]) (9). The AFB1 concentration in the cell extracts was determined by direct competitive ELISA with AFB1 monoclonal antibodies (kindly provided by J. Pestka, Michigan State University) as described previously (32). Western blot analysis of EGFP fused to Ver-1. Conidiospores (2 ⫻ 106) were cultured in 100 ml of YES20 at 30°C in the dark with shaking at 150 rpm. Western blot analysis was conducted on fungal extracts prepared after 48 h using standard procedures (25). The protein concentration in extracts was determined by a modified Bradford assay using a commercial protein assay reagent (Bio-Rad Laboratories, Hercules, CA) (6). Approximately 30 to 50 ␮g of total proteins was separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Immunodetection was carried out with immunoglobulin G (IgG) antibody against Ver-1 protein (25) or EGFP (Clonetech Laboratories, Palo Alto, CA) as the primary antibody, goat anti-rabbit IgG-alkaline phosphatase conjugate (Sigma Chemical Co., St. Louis, MO) as a secondary antibody, and BCIP-NBT (5⬘-bromo-4-chloro-3-indolyl phosphate–nitroblue tetrazolium) colorimetric detection system (Roche Molecular Biochemicals, Indianapolis, IN). A Benchmark prestained protein ladder (Invitrogen, Carlsbad, CA) was used as a molecular mass marker. Time course of EGFP expression and AF production. Approximately 2 ⫻ 106 conidia were cultured in 100 ml of YES or YES20 at 30°C in the dark with shaking at 150 rpm as described previously (25). Flasks were removed at different time points after inoculation for total protein extraction and analyses of mycelial dry weight and AF concentration. Mycelia were harvested by filtration through Miracloth (Calbiochem, La Jolla, CA), frozen in liquid nitrogen, and stored at ⫺80°C. Slide culture was performed as described above. Coverslips were removed at different time points after inoculation for analysis of AF concentration. Measurement of EGFP fluorescence. Cell extracts prepared as described for Western blotting were analyzed for EGFP fluorescence. Samples were dispensed into FluoroNunc Maxisorp 96-microwell plates (Nunc, Roskilde, Denmark) and analyzed with a Cytofluor II (Biosearch Co., Bedford, MA) using 470-nm excitation/510-nm emission filters. Fluorescence values were normalized against total protein concentration and expressed as relative units of EGFP fluorescence per ␮g protein. Measurement of mycelial dry weight and AF concentration. Dry weight was determined after complete drying of the harvested mycelia at 100°C. The AFB1 concentration in the filtrate was determined by direct competitive ELISA (32).

VOL. 74, 2008

SUBCELLULAR LOCALIZATION OF EGFP FUSED TO Ver-1

6387

TABLE 1. Primer sequences used in this study Primera ver-1A promoter B1

Orientation

Sequenceb

Restriction enzyme site

Annealing temp (°C)

Forward Reverse

5⬘ CTCTTAATTAACAAATACACCTACTACACGAC 3⬘ 5⬘ CTCGCGGCCGCACATGCTGACGGGATCGTG 3⬘

PacI NotI

55 55

B2

Forward Reverse

5⬘ CTCTTAATTAACAAATACACCTACTACACGAC 3⬘ 5⬘ ACGGCGGCCGCTCACCATGCTGACGGGATCGTG 3⬘

PacI NotI

55 55

B3

Forward Reverse

5⬘ CTCTTAATTAACAAATACACCTACTACACGAC 3⬘ 5⬘ ATGCGGCCGCGATCGTGTATGGTAGAGATTT 3⬘

PacI NotI

50 50

Forward Reverse

5⬘ GTCGGCCGGCCTAAACCTTCACAGCTATATACTCG 3⬘ 5⬘ GCCGGCGCGCCTGCTGATGGTGGGAAGAG 3⬘

FseI AscI

55 55

Forward Reverse

5⬘ ATAGCGGCCGCGTGAGCAAGGGCGAGGAG 3⬘ 5⬘ GTCGGCCGGCCTTTACTTGTACAGCTCGTCCAT 3⬘

NotI FseI

55 55

B2

Forward Reverse

5⬘ ATGGTGAGCGGCCGCGAGGAGCTG 3⬘ 5⬘ GTCGGCCGGCCTTTACTTGTACAGCTCGTCCAT 3⬘

NotI FseI

55 55

B3

Forward Reverse

5⬘ CCGGGCGGCCGCATGGTGAGCAAGGGCGAG 3⬘ 5⬘ GTCGGCCGGCCTTTACTTGTACAGCTCGTCCAT 3⬘

NotI FseI

55 55

Forward

5⬘ GGCAACTACAAGACCCGCG 3⬘

None

68

Downstream of ver-1A terminator

Reverse

5⬘ AGCCACCGTGAGCGTCC 3⬘

None

68

ver-1A gene (2.6-kb marker)

Forward

5⬘ ATCCTGACCAGCTCTAACACCG 3⬘

None

68

Upstream of ver-1A promoter (B3 5⬘ integrant)

Forward

5⬘ CAGAGGCTCAGTCACTTGTTC 3⬘

None

63

egfp gene 5⬘ integrant

Reverse

5⬘ TGCGCTCCTGGACGTAG 3⬘

None

63

ver-1A gene 0.95-kb marker

Reverse

5⬘ CAATTCCAGCGTTCGATG 3⬘

None

63

Forward Reverse

5⬘ TCCGGGTTAATTAAGATGCCGAACCATTTGAC 3⬘ 5⬘ ACTATAGCGGCCGCCAGCCACTCGAAAAGCGCCACC 3⬘

PacI NotI

55 55

Forward Reverse

5⬘ CCGGGCGGCCGCATGGTGAGCAAGGGCGAG 3⬘ 5⬘ GCCGCGATCGCCCTTGTACAGCTCGTCCATGCC 3⬘

NotI SgfI

60 60

Forward

SgfI

60

Reverse

5⬘ CTGGCGATCGCGGAGCTGGTGCAATGTCGGATAATCA CCGTTTAGAT 3⬘ 5⬘ AGCGGCCGGCCATTATCGAAAAGCGCCACC 3⬘

FseI

60

Reverse

5⬘ ACACATGAGAGCCAGCAAGATAA 3⬘

None

68

ver-1A terminator

egfp gene B1

egfp gene 3⬘ integrant

ver-1A promoter/gene, C

egfp gene, N

ver-1A gene, N

Downstream of ver-1B terminator (3⬘ integrant)

a B1, B2, and B3 represent pAPGFPVNB1, pAPGFPVNB2, and pAPGFPVNB3, respectively. C represents the C-terminal egfp fusion, and N represents the N-terminal egfp fusion. b Underlined sequences show the positions of the restriction enzyme sites.

6388

HONG AND LINZ

APPL. ENVIRON. MICROBIOL.

FIG. 2. Southern hybridization and PCR analyses of integration sites, EGFP expression, and AFB1 production in transformants carrying pAPGFPVNB. For Southern hybridization analyses, genomic DNA was isolated from A. parasiticus, digested with HincII, and hybridized with the ver-1A promoter probe. For PCR analyses, genomic DNA was amplified with an egfp primer and a second primer specific to a 3⬘ or 5⬘ ver-1A sequence, as shown in Table 1. (A) Southern hybridization analysis of transformants carrying pAPGFPVNB. Lanes: 1, strain NR-1 (recipient); 2 to 11, transformants carrying pAPGFPVNB B3-1 (niaD integration), B3-15, B3-46, B3-101, B3-105, B3-120, B3-146, B3-160, B3-186, and B3-194, respectively. Plasmid integration at niaD or 3⬘ ver-1A generates 1.0-, 2.8-, and 8.2-kb DNA fragments; plasmid integration at 5⬘ ver-1A generates 1.0-, 3.7-, and 7.2-kb DNA fragments. (B) PCR analysis of 3⬘ ver-1A or niaD integrants of pAPGFPVNB. Lanes: 1, strain NR-1 (recipient); 2 to 8, transformants carrying pAPGFPVNB B3-1 (niaD integration), B3-15, B3-101, B3-105, B3-146, B3-160, and B3-194 (3⬘ ver-1A integration), respectively. M, ␭ HindIII; S, 2.6-kb size marker. (C) PCR analysis of 5⬘ ver-1A or niaD integrants of pAPGFPVNB. Lanes: 1, strain NR-1 (recipient); 2 to 5, transformants carrying pAPGFPVNB B3-1 (niaD integration), B3-46, B3-120, and B3-186 (5⬘ ver-1A integration), respectively. M, ␭ HindIII; S, 0.95-kb size marker. For the 2.6-kb and 0.95-kb size markers, the egfp primer was replaced with a ver-1A primer to generate the same fragment sizes as those in 3⬘ or 5⬘ ver-1A integrants. (D) EGFP fluorescence activity and AFB1 concentration in EGFP⫹ transformant B3-15 and the recipient strain NR-1 were measured after 24, 48, and 72 h of incubation at 30°C with shaking at 150 rpm in YES medium. D.W, dry weight.

For analysis of AF accumulation in slide culture, AF were extracted from agar blocks with 5 ml of chloroform and then 5 ml of acetone, dried by evaporation, and dissolved in 1 ml of 70% methanol. The AFB1 concentration was determined by ELISA. Microscopy. For conventional fluorescence microscopy, slide culture was performed as described above. Coverslips were washed three times with PBS and observed using a Nikon Labophot fluorescence microscope (Nikon, Inc., Melville, NY) using a 450- to 490-nm excitation/520-nm emission filter. For CLSM, slide culture was conducted as described above. Coverslips were removed at different time points after inoculation. Fungal vacuoles were treated with FM 4-64 or 7-amino-4-chloromethylcoumarin (CMAC) (31, 36) to stain vacuolar membranes and luminal contents, respectively. Coverslips with fungal hyphae attached were placed in YES20 medium containing 8 ␮M FM 4-64 or 10 ␮M CMAC. For FM 4-64, coverslips were incubated at 30°C for 10 min and washed

with fresh media without the dye for 30 min. For CMAC, coverslips were incubated at 30°C for 30 min and washed with fresh media without the dye at 37°C for 30 min. Coverslips were observed using a Zeiss LSM 5 Pa or Zeiss LSM 510 Meta CLSM (Carl Zeiss, Inc., Germany). All single optical sections and extended-focus images from Z stacks (Z section interval, 0.46 ␮m) were captured using a Zeiss Plan-Apochromat (63x/1.40 oil) objective. EGFP fluorescence (488 nm excitation/509 nm emission) was detected using a BP 505-530 emission filter set under excitation with the 488-nm argon-ion laser line. FM 4-64 fluorescence (558 nm excitation/734 nm emission) was detected using an LP 650 emission filter set under excitation with the 633-nm helium-neon laser line. CMAC fluorescence (353 nm excitation/466 nm emission) was detected using a BP 420-480 emission filter set under excitation with the 405-nm diode laser line. To analyze vacuoles in liquid culture, conidiospores (2 ⫻ 106) were cultured in 100 ml of YES20 medium at 30°C in the dark with shaking at 150 rpm (25).

VOL. 74, 2008

SUBCELLULAR LOCALIZATION OF EGFP FUSED TO Ver-1

6389

Flasks were removed at different time points after inoculation. Fungal vacuoles were stained in Eppendorf tubes with FM 4-64, and fungal mycelia were observed using a Zeiss LSM 5-Pa CLSM (Carl Zeiss Inc., Germany). To quantify numbers of vacuoles carrying EGFP, large and medium vacuoles (⬎5 ␮m) were counted in two or three hyphae from 1 microscopic field and this was repeated in a total of 30 fields. The data were analyzed by two-way analysis of variance followed by Tukey’s test for multiple comparisons using SigmaStat (SPSS, Inc., Chicago, IL). Statistical significance among samples was defined by P ⱕ 0.05.

RESULTS Transformation of A. parasiticus NR-1 with pAPGFPVNB: screening for EGFP-positive transformants. To effectively use the GFP reporter system in A. parasiticus, we needed to demonstrate that we could drive GFP expression with an AF promoter, that AF promoter activity in the reporter construct would parallel wild-type promoter activity in the chromosome, and that GFP would be stable and could be detected easily in the A. parasiticus mycelium. To accomplish these goals, plasmid pAPGFPVNB (Fig. 1) was constructed by standard methods. This plasmid carried the ver-1 promoter and terminator fused to EGFP and an niaD selectable marker. We transformed pAPGFPVNB into A. parasiticus NR-1 (niaD) and generated 312 transformants. All transformants were screened for EGFP expression (green fluorescence) on YES agar (a rich AF-inducing growth medium) using a Nikon fluorescence microscope. Fourteen transformants (4%) expressing EGFP (EGFP⫹) were identified (data not shown) and subjected to further analysis. Determination of integration sites of pAPGFPVNB within the chromosome. Previous work in our laboratory demonstrated that integration of reporter constructs within the AF gene cluster was important for correct regulation of AF promoter activity (10, 25). Southern hybridization and PCR analyses were performed to confirm the location of reporter plasmid integration into the fungal genome. The reporter plasmid theoretically could integrate by homologous recombination at one or more of five sites: site 1, niaD; sites 2 and 3, ver-1 terminator in the ver-1A or ver-1B locus; and sites 4 and 5, ver-1 promoter within the ver-1A or ver-1B locus. Southern hybridization analysis confirmed that pAPGFPVNB integration into at least one of the five theoretical sites in each of the 14 EGFP⫹ transformants (Fig. 2A). PCR analysis with aver-1A– egfp terminator primer pair or an ver-1A–egfp promoter pair (Table 1) confirmed that all 14 EGFP⫹ transformants carried the reporter at either the ver-1A promoter or terminator (Fig. 2B and C). In cells transformed with pNiaD-A1 (negative control that carries the niaD selectable marker only), wild-type niaD in the vector replaced the mutant niaD allele in the chromosome by double-crossover (gene replacement) (see Fig. S1 in the supplemental material). In cells transformed with pNANG-3 (a negative control that carries niaD and a 10amino-acid nor-1 coding region and terminator fused to the ␤-glucuronidase reporter gene [GUS]) (27), either the niaD selectable marker replaced the mutant niaD allele in the chromosome by gene replacement or the plasmid integrated in the nor-1 terminator by single crossover (see Fig. S1 in the supplemental material). Time course of EGFP expression and AFB1 accumulation. Isolate B3-15, 1 of the 14 EGFP⫹ transformants, was cultured

FIG. 3. Restriction endonuclease map of plasmid pAPCGFPVFNB. The 2.0-kb ver-1 promoter/ORF was fused in frame to the 0.7-kb egfp coding region, followed by the 2.1-kb ver-1 terminator. The 7.4-kb niaD fragment was inserted as a selectable marker for transformation of the recipient strain, CS10-N2.

in a liquid, AF-inducing medium (YES) and EGFP fluorescence (fluorometer) and AFB1 (the primary AF produced in culture) accumulation (ELISA) were analyzed after 24, 48, and 72 h of incubation. Dry weights of B3-15 and the recipient strain NR-1 were similar at each time point (Fig. 2D), suggesting similar growth rates in these two strains. A transition from active growth to the stationary phase was observed between 48 and 72 h as previously reported (10, 25). AFB1 was not detected in B3-15 or NR-1 at 24 h, but high levels of AFB1 were detected in both strains at 48 and 72 h (Fig. 2D); this pattern of AFB1 accumulation is similar to that described previously (10, 25). EGFP fluorescence was barely detectable in NR-1, in cells transformed with pNiaD-A1, or in cells transformed with pNANG-3 at any time point (Fig. 2D and data not shown). In contrast, fluorescence was low but detectable at 24 h in B3-15, and increased at a high rate between 24 and 72 h; this pattern paralleled the pattern of AF accumulation (Fig. 2D). In summary, the pattern of EGFP expression driven by the ver-1 promoter in B3-15 was similar to the pattern of expression of the wild-type ver-1 promoter (25) and paralleled AFB1 accumulation. These observations confirmed that we could utilize EGFP as an effective tool to monitor Ver-1 expression and subcellular localization. Transformation of A. parasiticus CS10-N2 with pAPCGFPVFNB or pAPNGFPVFNB: screening for AF and EGFP in transformants. We constructed two plasmids designed to express EGFP fused to Ver-1 at either the N terminus (pAPNGFPVFNB) or C terminus (pAPCGFPVFNB) (Fig. 3). Five to 10 ␮g of each reporter plasmid was transformed into 108 protoplasts of A. parasiticus strain CS10-N2 (ver-1 wh-1 niaD pyrG), generating 673 transformants. Strain CS10-N2 does not accumulate AF but does accumulate the AF pathway intermediate VA; it carries a mutant ver-1A allele that generates a nonfunctional Ver-1A protein due to a specific amino acid substitution (see below). Transformants were screened for AF production on CAM20; AF-accumulating transformants produce blue fluorescent haloes around colonies on CAM20, as detected under UV light (365 nm). Four transformants carrying pAPCGFPVFNB (out of 210 transformants analyzed) produced blue fluorescent haloes, suggesting the plasmid restored AF synthesis. We screened all 210 transformants for

6390

HONG AND LINZ

APPL. ENVIRON. MICROBIOL.

FIG. 4. TLC and ELISA analyses of extracts from transformants carrying pAPCGFPVFNB and the recipient strain, CS10-N2. (A) TLC analysis. Lanes: 1, extract from the recipient strain CS10-N2; 2 and 3, V86 (AF⫹ and EGFP⫹) and V152 (AF⫹ and EGFP⫹), respectively. Standards: A, AFB1, -B2, -G1, and -G2 as standard mixture; V, VA standard. TEA (50:30:4 [vol/vol/vol] toluene-ethyl acetate-acetic acid) was used as a solvent system. Fluorescence was detected under UV light at 365 nm. (B) ELISA analysis of extracts from transformants carrying pAPCGFPVFNB, the recipient strain, CS10-N2, and the wild-type strain, SU-1. Extracts from V2 (AF⫺ and EGFP⫺), V1 (AF⫺ and EGFP⫹), V107 (AF⫹ and EGFP⫺), V86 (AF [⫹] and EGFP [⫹]), CS10-N2 (recipient strain), and SU-1 (wild-type) were analyzed for AFB1 production by ELISA.

EGFP expression under the Nikon fluorescence microscope (green fluorescence within the mycelium). We observed green fluorescence in isolates V86 and V152 (two of the four AFproducing transformants), suggesting they expressed functional EGFP (data not shown). We conducted similar screening on transformants carrying pAPNGFPVFNB. The plasmid restored AF production in 7 of 230 transformants analyzed (blue haloes around colonies on CAM20). These seven isolates (designated NV27, NV60, NV67, NV79, NV165, NV195, and NV218) also produced EGFP (green) fluorescence (data not shown). TLC and ELISA analyses of transformants. To confirm complementation of nonfunctional Ver-1 in A. parasiticus CS10-N2 by Ver-1 fusion proteins, TLC analysis was performed on chloroform-acetone extracts from transformants grown for 4 days on YES20 agar. TLC confirmed that isolates

V86 and V152 accumulated AF and no longer accumulated detectable VA (Fig. 4A). Using ELISA, we compared AFB1 accumulation in isolate V86 with that in wild-type strain SU-1; isolate V86 accumulated similar quantities of AFB1 to SU-1 (Fig. 4B). These data suggested that isolates V86 and V152 expressed a Ver-1–EGFP fusion that functionally complemented the nonfunctional Ver-1 in A. parasiticus CS10-N2. TLC and ELISA analyses were also conducted on seven isolates carrying pAPNGFPVFNB. Isolates NV27, NV60, NV67, NV79, NV165, NV195, and NV218 accumulated AF but also accumulated reduced, but detectable quantities of VA (see Fig. S2 in the supplemental material). Isolates NV27, NV60, and NV67 were compared to SU-1 by ELISA and shown to accumulate about 33% of the AFB1 detected in SU-1 (see Fig. S2 in the supplemental material). These data suggest that isolates NV27, NV60, and NV67 express a Ver-1–EGFP

FIG. 5. Western blot analysis of Ver-1–EGFP fusions expressed in transformants carrying pAPCGFPVFNB, the recipient strain, CS10-N2, and the wild-type strain, SU-1. Fungal proteins were extracted from transformants, and CS10-N2 and SU-1 grown in 100 ml of YES20 for 48 h at 30°C with shaking at 150 rpm. Approximately 30 to 50 ␮g of proteins were separated by 12% SDS-PAGE, transferred onto polyvinylidene difluoride membranes, and probed with Ver-1 or EGFP polyclonal antibody. (A) Ver-1 antibody detection. Lanes: 1, SU-1; 2, CS10-N2; 3, V86 (AF⫹ and EGFP⫹); and 4, V152 (AF⫹ and EGFP⫹). M, molecular mass marker. Ver-1–EGFP fusion has a molecular mass of 55 kDa, and the 28-kDa protein represents native Ver-1. (B) EGFP antibody detection. Lanes: 1, SU-1; 2, CS10-N2; 3, V86; 4, V152; and 5, recombinant EGFP (rEGFP). rEGFP was used as a positive control, and the 30-kDa rEGFP contains a 27-kDa EGFP fused to a 3-kDa protein for affinity chromatography purification.

VOL. 74, 2008

SUBCELLULAR LOCALIZATION OF EGFP FUSED TO Ver-1

fusion that functionally complements the nonfunctional Ver-1 in A. parasiticus CS10-N2. Functional complementation of the nonfunctional Ver-1 in transformants producing Ver-1–EGFP fusions strongly suggests that these proteins localize properly in the cell. Western blot analysis of EGFP fused to Ver-1. To confirm that transformed cells expressed Ver-1–EGFP fusion protein, we performed Western blot analysis on cells grown in liquid YES20 for 48 h using anti-Ver-1 antibody or anti-EGFP antibody (Fig. 5A and B, respectively). A 55-kDa fusion protein was detected in isolates V86 and V152 (carrying pAPCGFPVFNB) with either antibody; this represents the expected mass of the Ver-1–EGFP fusion (Ver-1, 28 kDa; EGFP, 27 kDa). Anti-Ver-1 antibodies also detected a 28-kDa Ver-1 protein in strain SU-1, CS10-N2, and all transformants. There was no observable degradation of either the Ver-1–EGFP fusion or the 28-kDa Ver-1 protein at any time point analyzed. These data suggest that full-length Ver-1 fusion protein is expressed in isolates V86 and V152, and this protein is subject to little or no turnover during the growth period. Similar analysis of isolates NV27, NV60, NV67, NV79, NV165, NV195, and NV218 (carrying pAPNGFPVFNB) identified a 55-kDa fusion protein that reacted with both anti-Ver-1 (see Fig. S3 in the supplemental material) and anti-EGFP (data not shown) antibodies. However, isolates NV1, NV63, and NV109 used as negative controls did not accumulate AF, did not express detectable green fluorescence, and did not express a 55-kDa fusion protein. However, we did detect a 28-kDa Ver-1 in all transformants analyzed. Analysis of the EGFP fused to Ver-1: does it carry wild-type Ver-1? We next analyzed transformants to determine if the Ver-1 fusion protein expressed in transformants was directly responsible for complementation of nonfunctional Ver-1 and restored AF synthesis in the recipient strain. We knew that CS10-N2 (ver-1 niaD pyrG wh-1) carries a nonfunctional ver-1A allele; we did not know if this gene carried a mutation (3, 20). We cloned the nonfunctional ver-1A allele from CS10-N2 by PCR and analyzed the nucleotide sequence of this DNA fragment. A single point mutation (G-to-A transition) was identified at nucleotide residue 287 in ver-1A in CS10-N2; this mutation resulted in a glycine-to-glutamic acid substitution. We then determined if the fusion gene encoding the 55-kDa fusion in transformants carried functional (wild type) or nonfunctional ver-1. Depending on the site of plasmid integration, theoretically one could generate protein fusions carrying either a functional or nonfunctional Ver-1 (Fig. 6). PCR was performed with a ver-1A–egfp promoter primer pair or ver-1A–egfp terminator primer pair (Table 1) to ensure that we amplified ver-1A fused to egfp; we then conducted DNA sequence analysis on the recombinant DNA fragments. Isolate V86 carried wild-type ver-1A in the egfp fusion, while isolate V152 carried nonfunctional ver-1A (data not shown). The integration scheme (Fig. 6C) demonstrates that V152 could produce a functional recombinant Ver-1 protein generated by integration of the fusion plasmid downstream of the point mutation in the chromosomal copy of ver-1A. Similar analysis demonstrated that isolates NV27, NV60, NV67, and NV79 (carrying pAPNGFPVFNB) each carried wild-type ver-1A fused to egfp (data not shown).

6391

FIG. 6. Schematic of how production of EGFP fused to functional Ver-1 protein depends on the integration site of pAPCGFPVFNB in the ver-1A locus. (A) ver-1A locus. (B) Plasmid integration upstream of the point mutation in ver-1A results in production of EGFP fused to functional Ver-1 protein. (C) Plasmid integration downstream of the point mutation in ver-1A results in production of EGFP fused to nonfunctional Ver-1 protein. However, a functional Ver-1 protein is generated by the recombinant ver-1 gene located adjacent to the fusion gene. (D) 3⬘ ver-1A integration results in production of EGFP fused to functional Ver-1 protein. M represents a point mutation. Abbreviations for the DNA fragments are as follows: ver-1 p, ver-1 promoter; ver-1 t, ver-1 terminator.

Determination of integration sites of pAPCGFPVFNB and pAPNGFPVFNB within the chromosome. Southern hybridization and PCR analyses were conducted on transformants carrying pAPCGFPVFNB or pAPNGFPVFNB to identify the site of plasmid integration; the analysis was similar to analysis of pAPGFPVNB integration described above. The data confirmed that a single copy of pAPCGFPVFNB integrated into the ver-1A terminator in isolate V86 (see Fig. S4 in the supplemental material). In agreement with the predicted integration event described above, the data also demonstrated isolate V152 carried one copy of pAPCGFPVFNB at niaD (this is probably not expressed). The other copy integrated downstream of the point mutation in the chromosomal copy of

6392

HONG AND LINZ

APPL. ENVIRON. MICROBIOL.

FIG. 7. Subcellular localization of EGFP fused to Ver-1 in AF⫹ and EGFP⫹ transformants V86 and NV27. Fungal vacuoles were stained with 8 ␮M FM 4-64 or 10 ␮M CMAC and observed using a Zeiss LSM 5 Pa or Zeiss LSM 510 Meta CLSM after 24, 48, and 72 h of incubation at 30°C on YES20 agar blocks. (A and B) V86 stained with FM 4-64 at 48 h on YES20. Ver-1–EGFP fusion localized in red fluorescent vacuoles in panel A (higher magnification) or in the cytoplasm in panel B. (C) V86 stained with CMAC at 48 h on YES20. Ver-1–EGFP fusion localized in vacuoles in hyphae. (D) V86 stained with FM 4-64 at 72 h on YES20, with Ver-1–EGFP fusion localized in vacuoles and the cytoplasm. (E) NV27 stained with CMAC at 48 h on YES20. Ver-1–EGFP fusions localized in vacuoles and the cytoplasm. (F and G) NV27 stained with FM 4-64 at 72 h on YES20. Ver-1–EGFP fusion localized in vacuoles. Ver-1–EGFP fusion was associated with the vacuolar membrane in panel G. (H) B3-15 stained with FM 4-64 at 24 h on YES medium. Red fluorescent vacuolar membranes were observed in hyphae, but green fluorescence was not detected. (I) B3-15 stained with FM 4-64 at 48 h on YES medium. EGFP localized in the cytoplasm (higher magnification). Green fluorescence was excluded from vacuoles. (J) B3-15 stained with CMAC at 72 h on YES medium. EGFP localized in vacuoles of hyphae. Each panel shows a red fluorescence image (FM 4-64) or a blue fluorescence image (CMAC) (top left), a green fluorescence image (EGFP) (top right), a transmitted image (bright field or differential interference contrast) (bottom left), and a merged image (bottom right): the exceptions are panels A and I, in which only red and green fluorescence images are shown. Scale bars, 10 ␮m.

ver-1A. Similar analyses of isolates NV27, NV60, NV67, NV79, NV165, NV195, and NV218 demonstrated that a single copy of pAPNGFPVFNB integrated into the ver-1A terminator (see Fig. S5 in the supplemental material). CLSM. The subcellular location of EGFP fused to Ver-1 was analyzed in isolates V86 and NV27 by CLSM after growth for 24, 48, and 72 h on a solid, AF-inducing medium (YES20) (slide culture) (Fig. 7). We also analyzed B3-15, NR-1, and CS10-N2 as controls. EGFP was not detected at any time point in the recipient strains, NR-1 and CS10-N2 (data not shown).

EGFP fluorescence was not detected in B3-15, V86, and NV27 at 24 h (Fig. 7H and data not shown). However, EGFP fused to Ver-1 was detected in the cytoplasm in V86 and NV27 strains at 48 h (Fig. 7B and E); Ver-1 fusion proteins also localized to the lumen of up to 80% of the vacuoles in V86 and NV27 at 48 h (Fig. 7A, C, and E). The identity of these vacuoles was confirmed with the vacuolar membrane dye FM 4-64 and the vacuolar lumen dye CMAC (31, 36). FM 4-64 stains endosomes as well as vacuoles in Saccharomyces cerevisiae (40). CMAC is enzymatically converted to a blue fluo-

VOL. 74, 2008

SUBCELLULAR LOCALIZATION OF EGFP FUSED TO Ver-1

6393

FIG. 7—Continued.

rescent derivative in the vacuolar lumen (36). In the control strain B3-15 (which expresses EGFP only), we detected green fluorescence predominantly in the cytoplasm at 48 h (13% of the vacuoles were labeled) (Fig. 7I); at 72 h, approximately 80% of the vacuoles were labeled (Fig. 7J). Pairwise multiple comparisons confirmed that the level of vacuolar localization of green fluorescence in B3-15 at 48 h was significantly lower than that in V86 and NV27 at 48 h (P ⬍ 0.05) (Table 2). However, at 72 h, there was no significant difference in the levels of vacuolar localization in V86 (78%), NV27 (86%), and B3-15 (62%). These data suggested that Ver-1 in the protein fusion directed EGFP to the vacuole up to 24 h earlier than EGFP alone. Time course of AFB1 accumulation. AF accumulation by the fungus grown on YES solid medium (slide culture) was analyzed to determine the relationship between AF accumulation and the time of protein localization to the vacuole. Isolates V86 and B3-15 were cultured on YES20 agar blocks and YES20 liquid medium. AFB1 accumulation in these isolates was analyzed after 24, 48, and 72 h of incubation. AFB1 was not detected in either isolate at 24 h, but high levels of AFB1

accumulated between 24 and 48 h, as described previously (Fig. 8A and B) (10, 25). Little additional AF accumulation was observed between 48 and 72 h. These data strongly suggested that the highest rate of AF synthesis coincided with the highest rate of Ver-1–EGFP transport to the vacuole. Therefore, it is reasonable to propose that localization of Ver-1 to the vacuole is associated with AF biosynthesis and not with AF protein turnover. In contrast, EGFP localized to the vacuole after most AF synthesis occurred, suggesting that EGFP is either stored or turned over in that organelle. DISCUSSION In contrast to our previous TEM study (21), we conclude that the middle AF pathway enzyme Ver-1 localizes to the cytoplasm and to the vacuolar lumen in A. parasiticus colonies grown in slide culture on a solid, AF-inducing medium. Vacuolar localization occurs at the highest rate between 24 and 48 h; the highest rate of AF biosynthesis is observed in the same time frame in colonies grown on solid media in slide

6394

HONG AND LINZ

APPL. ENVIRON. MICROBIOL.

FIG. 7—Continued.

culture (in this study) and on agar plates (21). We did not observe any detectable degradation of Ver-1 or EGFP fused to Ver-1 (based on Western blotting) during the 24- to 48-h time frame, suggesting that these proteins are not turned over at this location (at least during active AF synthesis). These observations support our hypothesis that Ver-1 and OmtA (and likely other middle and late pathway enzymes) are synthesized in the cytoplasm and then localize to the vacuole to conduct

TABLE 2. Comparison of vacuolar localization of EGFP in transformant B3-15 with that of EGFP-tagged Ver-1 in transformants V86 and NV27 % of green fluorescent vacuoles ina: Time (h)

48 72

B3-15

V86

NV27

13.0 ⫾ 0.0 62.5 ⫾ 3.5

72.0 ⫾ 3.0 78.5 ⫾ 1.5

80.0 ⫾ 1.0 86.5 ⫾ 4.5

a Shown are the percentages of large- and mid-size green fluorescent vacuoles (⬎5 ␮m) in 30 microscopic fields (two to three hyphae per field).

AF synthesis. We are now purifying and analyzing vacuoles to confirm this hypothesis. In contrast to the present study, Ver-1 was observed primarily in the cytoplasm of 24- to 48-h-old cells using TEM after immunogold labeling (21). One possible explanation for this discrepancy is that we conducted localization in living tissue and in real time (in the present study) instead of in fixed and sectioned samples (in the previous study). Alternatively, the acidic pH (pH 5 to 6) of vacuoles may negatively affect Ver-1 antibody binding to Ver-1 localized in vacuoles in the previous study. However, other reports support our recent data. Liang conducted cell fractionation analysis and observed that Ver-1 was associated with structures similar in size to lysosomes and could be found in the cytoplasm fraction (23). Our data are also consistent with a recent study using coimmunoprecipitation, which suggests that Ver-1, VBS, and OmtA form a multiprotein complex to carry out AF synthesis (A. Chanda, unpublished data). Isolate B3-15 (control) expressed EGFP driven by the ver-1

VOL. 74, 2008

SUBCELLULAR LOCALIZATION OF EGFP FUSED TO Ver-1

6395

FIG. 9. Proposed model for vacuolar localization of Ver-1 and AF production in fungal cells. According to the model, Ver-1 is synthesized in the cytoplasm and transported to vacuoles by the Cvt pathway. Ver-1 is packaged into double-membrane-bound Cvt vesicles under conditions that promote active growth. In contrast, under starvation conditions, Ver-1 is taken up into larger, double-membrane-bound autophagosomes by the autophagy pathway. The Cvt vesicles or autophagosomes then fuse with the vacuole, and the resulting Cvt bodies or autophagic bodies are broken down by vacuolar hydrolases to release Ver-1 into the vacuolar lumen. We propose that AF intermediates are also transported to vacuoles and that Ver-1 is involved in AF synthesis within the vacuoles. Finally, AF is released to the growth medium through small vacuoles or vesicles. Black arrows indicate transport of Ver-1, and white arrows indicate transport of substrates and end products. Acetyl CoA, acetyl coenzyme A.

FIG. 8. AFB1 production in transformant V86 (expressing a Ver1–EGFP fusion) and transformant B3-15 (expressing EGFP only) in liquid and slide cultures. AFB1 was measured after 24, 48, and 72 h of incubation at 30°C with shaking at 150 rpm in 100 ml of YES20 or on YES20 agar. (A) Liquid culture. (B) Slide culture. D.W, dry weight.

promoter. The growth rate and the timing and pattern of EGFP synthesis in B3-15 paralleled the timing of Ver-1 protein accumulation and AF accumulation in SU-1 (wild type) and NR-1 (recipient strain). This means that EGFP in this strain was synthesized at highest levels from 24 to 48 h, similar to the Ver-1 fusion protein. Nevertheless, EGFP localized to vacuoles at significant levels at 72 h, up to 24 h later than fusion proteins carrying Ver-1; in addition, EGFP localized to vacuoles after the highest rate of AF synthesis diminished. These data strongly suggest that the vacuole-targeting pathways recognize Ver-1 at an earlier time point than the control protein, EGFP. Our data also suggest that both proteins are synthesized in the cytoplasm since they were first detected here prior to vacuolar localization. There are two primary protein-targeting pathways that direct cytoplasmic proteins to the vacuole in fungi and plants; these are the cytoplasm-to-vacuole targeting pathway (Cvt) and the autophagy pathway (2). Aminopeptidase I (API) uti-

lizes the Cvt pathway for vacuolar targeting. API lacks Nglycosylation motifs and does not utilize the typical secretory pathway. Pro-API is synthesized on cytoplasmic ribosomes and then packaged in vesicles that form around the protein “cargo.” The cargo protein is carried to the vacuole and becomes incorporated via fusion of the vesicle with the developing vacuole. In the process, a 45-amino-acid targeting propeptide is cleaved from the amino terminus of pro-API by protease B. The Cvt pathway is constitutively expressed and demonstrates significant specificity in the proteins targeted to the vacuole; these proteins usually contain specific targeting motifs within the open reading frame (ORF). In contrast, the autophagy pathway is induced by nutrient limitation, normally at or near the end of active growth (2). Cells package cellular proteins in autophagosomes that fuse with vacuoles. This generalized transport machinery demonstrates little specificity and provides a mechanism for protein turnover to generate stores of amino acids through hydrolysis of the stored proteins in the vacuole. Vacuolar localization of Ver-1 occurs just after its synthesis initiates in the cytoplasm. Ver-1 (unlike another focus of our studies, the middle AF pathway enzyme VBS) does not carry typical glycosylation motifs, strongly suggesting it is not transported by the secretory pathway. In addition, we have noted in several studies that Ver-1 protein (as well as Nor-1 and OmtA) is subject to proteolytic cleavage at a single site and the level of cleavage appears to increase in parallel with the rate of AF synthesis (22, 25, 44). Based on these observations, we hypothesize that Ver-1 utilizes the Cvt pathway for vacuolar localization (see the model in Fig. 9) and that control EGFP is transported to vacuoles via the autophagy pathway in response to nutrient limitation. Current work is designed to test these

6396

HONG AND LINZ

hypotheses. Our initial focus is to identify the role of Ver-1 protein cleavage in enzyme activity and vacuolar localization. Most, if not all, vacuoles carried Ver-1 when AF synthesis occurred at the highest rate. These data suggest most vacuoles are actively involved in AF synthesis. We are currently expanding these studies to include analysis of other secondary metabolites.

APPL. ENVIRON. MICROBIOL.

21.

22.

23.

ACKNOWLEDGMENTS This work was supported by NIH grant CA52003-16 and the Michigan Agricultural Experiment Station. We thank Melinda K. Frame (Center for Advanced Microscopy at Michigan State University) for help with CLSM, Perng-Kuang Chang (USDA/ARS Southern Regional Research Center) for providing strain CS10-N2, and Stephen A. Osmani (Ohio State University) for providing a repeated Gly-Ala sequence to construct egfp fused to ver-1. REFERENCES 1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 2003. Current protocols in molecular biology. John Wiley and Sons, New York, NY. 2. Baba, M., M. Osumi, S. V. Scott, D. J. Klionsky, and Y. Ohsumi. 1997. Two distinct pathways for targeting proteins from the cytoplasm to the vacuole/ lysosome. J. Cell Biol. 139:1687–1695. 3. Bennett, J. W., and L. A. Goldblatt. 1973. Isolation of mutants of Aspergillus flavus and Aspergillus parasiticus with altered aflatoxin producing ability. Sabouraudia 11:235–241. 4. Bhatnagar, D., T. E. Cleveland, and E. B. Lillehoj. 1989. Enzymes in aflatoxin B1 biosynthesis: strategies for identifying pertinent genes. Mycopathologia. 107:75–83. 5. Bhatnagar, D., K. C. Ehrlich, and T. E. Cleveland. 2003. Molecular genetic analysis and regulation of aflatoxin biosynthesis. Appl. Microbiol. Biotechnol. 61:83–93. 6. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248–254. 7. CAST. 2003. Mycotoxins: risks in plant, animal, and human systems. Council for Agricultural Science and Technology, Ames, IA. 8. Chang, P. K., C. D. Skory, and J. E. Linz. 1992. Cloning of a gene associated with aflatoxin B1 biosynthesis in Aspergillus parasiticus. Curr. Genet. 21:231– 233. 9. Chang, P.-K., K. Yabe, and J. Yu. 2004. The Aspergillus parasiticus estAencoded esterase converts versiconal hemiacetal acetate to versiconal and versiconol acetate to versiconol in aflatoxin biosynthesis. Appl. Environ. Microbiol. 70:3593–3599. 10. Chiou, C.-H., M. Miller, D. L. Wilson, F. Trail, and J. E. Linz. 2002. Chromosomal location plays a role in regulation of aflatoxin gene expression in Aspergillus parasiticus. Appl. Environ. Microbiol. 68:306–315. 11. Cotty, P. J., P. Bayman, D. S. Egel, and D. S. Elias. 1994. Agriculture, aflatoxins, and Aspergillus, p. 1–27. In K. A. Powell, A. Fenwick, and J. F. Peberdy (ed.), The genus Aspergillus. Plenum Press, New York, NY. 12. Cotty, P. J., and R. Jaime-Garcia. 2007. Influences of climate on aflatoxin producing fungi and aflatoxin contamination. Int. J. Food Microbiol. 119: 109–115. 13. Cove, D. J. 1966. The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochim. Biophys. Acta 113:51–56. 14. Dvorackova, I. 1990. Aflatoxins and human health. CRC Press, Boca Raton, FL. 15. Ehrlich, K. C., B. Montalbano, S. M. Boue´, and D. Bhatnagar. 2005. An aflatoxin biosynthesis cluster gene encodes a novel oxidase required for conversion of versicolorin A to sterigmatocystin. Appl. Environ. Microbiol. 71:8963–8965. 16. Harris, J. L. 1986. Modified method for fungal slide culture. J. Clin. Microbiol. 24:460–461. 17. Henry, K. M., and C. A. Townsend. 2005. Ordering the reductive and cytochrome P450 oxidative steps in demethylsterigmatocystin formation yields general insights into the biosynthesis of aflatoxin and related fungal metabolites. J. Am. Chem. Soc. 127:3724–3733. 18. Horng, J. S., P. K. Chang, J. J. Pestka, and J. E. Linz. 1990. Development of a homologous transformation system for Aspergillus parasiticus with the gene encoding nitrate reductase. Mol. Gen. Genet. 224:294–296. 19. Lax, A. R., T. E. Cleveland, D. Bhatnagar, and L. S. Lee. 1986. Enzymatic conversion of sterigmatocystin to aflatoxin B1 through O-methylsterigmatocystin. Plant Physiol. 80(Suppl.):19. 20. Lee, L. S., J. W. Bennett, A. F. Cucullu, and J. B. Stanley. 1975. Synthesis of

24.

25.

26.

27.

28.

29.

30.

31.

32. 33. 34.

35.

36. 37.

38.

39.

40. 41.

42.

43.

44.

versicolorin A by a mutant strain of Aspergillus parasiticus deficient in aflatoxin production. J. Agric. Food Chem. 23:1132–1134. Lee, L. W., C. H. Chiou, K. L. Klomparens, J. W. Cary, and J. E. Linz. 2004. Subcellular localization of aflatoxin biosynthetic enzymes Nor-1, Ver-1, and OmtA in time-dependent fractionated colonies of Aspergillus parasiticus. Arch. Microbiol. 181:204–214. Lee, L. W., C. H. Chiou, and J. E. Linz. 2002. Function of native OmtA in vivo and expression and distribution of this protein in colonies of Aspergillus parasiticus. Appl. Environ. Microbiol. 68:5718–5727. Liang, S. H. 1996. The function and expression of the ver-1 gene and localization of the Ver-1 protein involved in aflatoxin biosynthesis in Aspergillus parasiticus. Ph.D. dissertation. Michigan State University, East Lansing. Liang, S. H., C. D. Skory, and J. E. Linz. 1996. Characterization of the function of the ver-1A and ver-1B genes, involved in aflatoxin biosynthesis in Aspergillus parasiticus. Appl. Environ. Microbiol. 62:4568–4575. Liang, S. H., T. S. Wu, R. Lee, F. S. Chu, and J. E. Linz. 1997. Analysis of mechanisms regulating expression of the ver-1 gene, involved in aflatoxin biosynthesis. Appl. Environ. Microbiol. 63:1058–1065. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Miller, M. J. 2003. Transcriptional regulation of the Aspergillus parasiticus aflatoxin biosynthetic pathway gene nor-1. Ph.D. dissertation. Michigan State University, East Lansing. Miller, M. J., and J. E. Linz. 2006. Genetic mechanisms involved in regulation of mycotoxin biosynthesis, p. 1505–1542. In K. Shetty, G. Paliyath, A. Pometto, and R. E. Levin (ed.), Food biotechnology, 2nd ed. Taylor and Francis Group, New York, NY. Mori, H., J. Kitamura, S. Sugie, K. Kawai, and T. Hamasaki. 1985. Genotoxicity of fungal metabolites related to aflatoxin B1 biosynthesis. Mutat. Res. 143:121–125. Oakley, B. R., J. E. Rinehart, B. L. Mitchell, C. E. Oakley, C. Carmona, G. L. Gray, and G. S. May. 1987. Cloning, mapping and molecular analysis of the pyrG (orotidine-5⬘-phosphate decarboxylase) gene of Aspergillus nidulans. Gene 61:385–399. Ohneda, M., M. Arioka, H. Nakajima, and K. Kitamoto. 2002. Visualization of vacuoles in Aspergillus oryzae by expression of CPY-EGFP. Fungal Genet. Biol. 37:29–38. Pestka, J. J. 1988. Enhanced surveillance of foodborne mycotoxins by immunochemical assay. J. Assoc. Off. Anal. Chem. 71:1075–1081. Richard, J. L. 2007. Some major mycotoxins and their mycotoxicoses—an overview. Int. J. Food Microbiol. 119:3–10. Roze, L. V., R. M. Beaudry, N. P. Keller, and J. E. Linz. 2004. Regulation of aflatoxin synthesis by FadA/cAMP/protein kinase A signaling in Aspergillus parasiticus. Mycopathologia 158:219–232. Sakuno, E., K. Yabe, and H. Nakajima. 2003. Involvement of two cytosolic enzymes and a novel intermediate, 5⬘-oxoaverantin, in the pathway from 5⬘-hydroxyaverantin to averufin in aflatoxin biosynthesis. Appl. Environ. Microbiol. 69:6418–6426. Shoji, J. Y., M. Arioka, and K. Kitamoto. 2006. Vacuolar membrane dynamics in the filamentous fungus Aspergillus oryzae. Eukaryot. Cell 5:411–421. Skory, C. D., P. K. Chang, J. Cary, and J. E. Linz. 1992. Isolation and characterization of a gene from Aspergillus parasiticus associated with the conversion of versicolorin A to sterigmatocystin in aflatoxin biosynthesis. Appl. Environ. Microbiol. 58:3527–3537. Skory, C. D., J. S. Horng, J. J. Pestka, and J. E. Linz. 1990. Transformation of Aspergillus parasiticus with a homologous gene (pyrG) involved in pyrimidine biosynthesis. Appl. Environ. Microbiol. 56:3315–3320. Takahashi, T., P.-K. Chang, K. Matsushima, J. Yu, K. Abe, D. Bhatnagar, T. E. Cleveland, and Y. Koyama. 2002. Nonfunctionality of Aspergillus sojae aflR in a strain of Aspergillus parasiticus with a disrupted aflR gene. Appl. Environ. Microbiol. 68:3737–3743. Vida, T. A., and S. D. Emr. 1995. A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast. J. Cell Biol. 128:779–792. Yabe, K., M. Nakamura, and T. Hamasaki. 1999. Enzymatic formation of G-group aflatoxins and biosynthetic relationship between G- and B-group aflatoxins. Appl. Environ. Microbiol. 65:3867–3872. Yu, J., P.-K. Chang, J. W. Cary, M. Wright, D. Bhatnagar, T. E. Cleveland, G. A. Payne, and J. E. Linz. 1995. Comparative mapping of aflatoxin pathway gene clusters in Aspergillus parasiticus and Aspergillus flavus. Appl. Environ. Microbiol. 61:2365–2371. Yu, J., P.-K. Chang, K. C. Ehrlich, J. W. Cary, D. Bhatnagar, T. E. Cleveland, G. A. Payne, J. E. Linz, C. P. Woloshuk, and J. W. Bennett. 2004. Clustered pathway genes in aflatoxin biosynthesis. Appl. Environ. Microbiol. 70:1253–1262. Zhou, R. 1997. The function, accumulation, and localization of the Nor-1 protein involved in aflatoxin biosynthesis: the function of the fluP gene associated with sporulation in Aspergillus parasiticus. Ph.D. dissertation. Michigan State University, East Lansing.