9196 CuRRENT MICROBIOLOGY Vol. 50 (2005), pp. 324--328 DOl: 10.1007/s00284-005-4485-x
Current Microbiology An International Journal © Springer Science+Business Media,
Inc. 2005
Functional Expression of Bacterial Zymobacter palmae Pyruvate Decarboxylase Gene in Lactococcus lactis Siqing Liu,l Bruce S. Dien,2 Michael A. Cotta2 I Bioproducts and Biocatalysis Research Unit, National Center for Agriculture Utilization Research, USDA, ARS, 1815 N. University St., Peoria, IL 61604, USA 2Fennentation Biotechnology Research Unit, ational Center for Agriculture Utilization Research, USDA, ARS, 1815 . University St., Peoria, IL 61604, USA
Received: 14 October 2004 / Accepted: 31 January 2005
Abstract. A pyruvate decarboxylase (PDC) gene from bacterial Zymobacter palmae (Zymopdc) was cloned, characterized, and introduced into Lactococcus lactis via a shuttle vector pAK80 as part of a research strategy to develop an efficient ethanol-producing lactic acid bacteria (LAB). The expression levels of Zymopdc gene in the host, as measured by a colorimetric assay based on PDC catalyzed formation of (R)-phenylacetylcarbinol ((R)-PAC), appeared to be dependent on the strength of corresponding Gram-positive promoters. A constitutive, highly expressed promoter conferred the greatest PDC activity, and an acid-inducible promoter demonstrated acid-inducible expression. The metabolic production of ethanol and other products was examined in flask fermentations. More than eightfold increases in acetaldehyde concentrations were detected in two recombinant strains. However, no detectable differences for ethanol fermentation in these engineered strains were observed compared with that of the strain carrying lacZ reporter.
Naturally occurring homo-ethanol-producing microorganisms such as Saccharomyces cerevisiae and Zymomonas mobilis are preferred choices for fermentation of starch-derived glucose. However, strains of these microorganisms ferment lignocellulose-associated sugars poorly, especially the pentose sugars including xylose and arabinose. Therefore, new microorganisms are needed that can ferment the mixed sugars contained in biomass to produce ethanol and other bioproducts. LAB are a group of facultatively anaerobic and Gram-positive bacteria. Some strains ferment mixed sugars including hexoses and pentoses for energy production and, therefore, are potential hosts for constructing novel biocatalysts. Genetically modified LAB have been successfully applied in the fermentation industry for production of lactic acid, B-vitamins, and low-calorie sugar alcohols like sorbitol and mannitol [6, 7]. If efficient ethanol production genes can be engi-
Correspondence to: Siqing Liu; email:
[email protected]
neered into LAB, this group of microorganisms would be more adaptive for industrial ethanol fermentation. The genetic manipulations of pentose-utilizing strains such as Lactobacillus pentosus and Lactobacillus brevis are immature due to the low transformation efficiency and lack of functional expression system. We initiated this project using the comparable L. lactis as a model system to carry out pathway engineering. Once the ethanol fermentation pathway can be proved functional, similar approaches will be used to engineer the pentosefermenting Lactobacillus species for ultimate development of novel strains for ethanol and other bio-product production from biomass. The terminal pathway of ethanol production from pyruvate involves sequential enzymatic reactions carried out by pyruvate decarboxylase (pDC, EC 4.1.1.1) and alcohol dehydrogenase (ADH, EC 1.1.1.1). PDC catalyses the decarboxylation of pyruvate to acetaldehyde and CO 2, Acetaldehyde is then reduced to ethanol by ADH. Unlike ADH, which is widely distributed in all forms of life [4], PDC is not present in animal cells and
325
Liu et al.: Zymopdc Gene Expression in L lactis Table 1. Oligonucleotides used in this study Z5'I46 BamHI Z3'890 Z5'790 Z3'I992 SaIl Z5'Bam2IO Z5'ATG BamHI Z3'1992 Kpnl
CCAGGATCCCTGCGAATCAATCAGCACAT TTGCTACCGACCAGCATGACGACGTTCT TGAACTCGAAGTTGACCAGACCAGTGT AATTGTCGACAGCCCCTCTTACGGGTAT CCAGGATCCGACGATGAATTAATGGAGGT TTCGGATCCATGTATACCGTTGGT ATTGGTACCAGCCCCTCTTACGGGTAT
pAK80 692Zpdc -35 -10 +1 Xhol-AnnTGGITGCCAmGITAACGCTGCCTCCTCTCCCTAGTGCTATAATAAAAATG GCCATmGGAACAGACITCTACTAITITGITGTCTAGTAGGATCCgacgatgaattaatggagg tttacccctgATG-Zpdc-Sa/l pAK80769Zpdc -35 -10 +1 Xhol-AITmGGITGCCAmGTTATIGACACCTCCTCTCCCTAGTGCTATAATAAAAATG GCCAITnGGAACAGACITCTACTAITITGITGTCTAGTAGGATCCgacgatgaattaatggagg tttacccctgATG-Zpdc-Sa/l pAK80 772Zpdc -35 -10 +1 Xhol-AITATGCTTTGGCAGTTTAITCTTGACATGTAGTGAGGGGGCTGCTATAATAAAATAG GCCAITITGGAACAGACTTCTACTAITnGITGTCTAGTAGGATCCgacgatgaattaatggagg tttacccctgATG-Zpdc-San
rarely in bacteria [9]. Only four bacterial pdc genes have been isolated. These are derived from Z. mobilis [2], Sarcina ventriculi [17], Acetobacter pasteurianus [1], and Z. palmae [15]. The PDC from Z. palmae has the highest specific activity and lowest Km for pyruvate among all the bacterial PDC examined [15]. In addition, the Z. palmae PDC is reported to be thermostable, another desirable trait for creating bacterial biocatalyst for ethanol fermentation. In this report, we describe the results of our recent study in transforming a bacterial Z. palmae pdc gene into L. lactis subsp lactis LM0230 strain, and fermentation analyses of metabolic products from the engineered strains.
Materials and Methods Bacterial strains and growth conditions. Z. palmae DSMZ 1049I T was grown in MY medium as described [15]. L. lactis subsp lactis LM0230 [12] was grown in MI7 or MRS (Becton Dickinson, Sparks, MD). For pH-induced expression, the LM0230 cells were grown in MI7 for pH 5.5 and M17Arg for pH 7.0 [II). E. coli DhSCt and BL2IpLysS were grown in Luria-Bertani (LB) with 100 ~g/ml ampicillin and 35 ~g/mi chloramphenicol when required, Plasmid AMJ772, AMJ769, and AMJ692 were kindly provided by Dr. Madsen at the Biotechnological Institute, Denmark [11]. DNA manipulation, and sequencing. Chromosomal DNA from Z. palmae was prepared using the Bactozol Kit (Molecular Research
Fig. 1. Gram-positive promoter constructs used for L lactic subsp lactis LM0230 transformation. ucleotides in lowercase are from Zymopdc 5' untranslated sequences, and nucleotide sequences in uppercase are the promoter sequences from p692, p769, and p772 promoters as described by Madsen et al. [11]. Sequences of -35, -10, and SD site are in bold and the + 1 transcription initiation site is also indicated.
Center, Inc., Cincinnati, OH). D A manipulations in E. coli were performed as described [16). Plasmid isolations from L lactis were carried out according to the method of O'Sullivan and Klaenhammer [13]. D A sequences were done via the ABI Prism 310 using the Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) and analyzed at the following web sites: http://www. ncbi.nlm.nih.gov/, http://www.sdsc.edu/Researchlbiology. Cloning of the Z. palmae pdc gene. The oligonucleotides used in this study are listed in Table 1. Genomic PCRs were performed using primers Z5'146BamH, Z3'890 to amplify the first half of the Zymopdc; Z5'790, Z3'1992SaU to amplify the second half of the gene. The amplified fragments were digested with BamHIlPstl (the Pstl is within the Zymopdc gene), PstllSalI, respectively, and cloned into pBluescript SK to obtain the full-length 1847-bp Zymopdc clone. E. coli expression of the Zymopdc gene. The Zymopdc was PCR amplified using primers Z5'ATGBamH, Z3' 1992Kpnl, and subcloned into pRSETa (Invitrogen, Carlsbad, CA) at BamHIIKpnl sites. The resultant pRSETaZpdc was then introduced in E. coli BL21 (DE3) pLysS, and IPTG-induced expression was carried out following manufacturer's instruction (Invitrogen). Protein concentration was determined using a BIO-RAD protein assay kit (BIO-RAD Laboratories, Hercules, CA).
Transformation of L. lactis subsp lactis LM0230. To generate Gram-positive promoter-driven Zymopdc (Fig. 1), the 4.0-kb BamHISall LacZ gene fragments from pAMJ772, AMJ769, and AMJ692 were replaced with the 1782-bp BamHI-Sall Zymopdc, which was amplified from the Zymopdc using primers Z5'Bam21O and Z3'I992SaII. The resultant plasmids P772Zymopdc, P769Zymopdc, and P692Zymopdc were transformed into L lactis subsp lactis LM0230 as described [10].
326 kDa 206 116 98
CURRENT MICROBIOLOGY
2
3
4
5
6
Vol. 50 (2005)
A c
2
ea.
3.0
0)
E
(j)
c co N co
55
§
37
.E
2.0
1.0
11 'c ::J
Fig. 2. SDS-PAGE analysis of the overexpressed Z. palmae PDC in E. coli BL21 (DE3) pLysS. Lane 1: BioRad SDS-PAGE Broad Range prestained standard; Lane 2, 3: BL21 plysS pRSETaZpdc -IPTG, + IPTG, respectively. Lanes 4---{j: Fractions from Ni column purification of histagged Z. palmae PDC.
0.0-
~v
~s~
V
Fermentation of L. laetis subsp laetis LM0230. Flask fermentations were used for the assessment of ethanol production by recombinant L lactis subsp lactis LM0230 strains. Fermentations were carried out in duplicate as described [12]. Concentrations of glucose and fermentation products were measured by HPLC as described [3].
V
4.0
B
Pyruvate decarboxylase assay. Cell lysates from E. coli BL 21 cells harboring pRSETZpdc and recombinant LM0230 strains were obtained using beadbeater (Biospec Products, Bartlesville, OK). The reaction mixture containing 140-240 Ilglrnl protein, 30 mM acetaldehyde, 40 mM benzaldehyde, 2 mM TPP, and 20 mM MgS0 4 in 500 III of 50 mM sodium phosphate buffer (pH 6.5) was incubated for 30 min at 25°C, and the supernatant assayed immediately for (R)-PAC by adding 20 jl1 tetrawlium red containing 0.2% 2,3,5-triphenyltetrawlium chloride, and 10 jl13M aOH. The amount of formazane formed from tetrawlium red reduced by (R)-PAC was measured at 510 nm. The PDC activities were defined as units of formazane (Ilmol) formed per min.
~~tl> ~CJ
c
'Q)
0
a.
3.0
0)
E c co N co
2.0
.E
1.0
(j)
§
11 'c ::J
4.0 - r - - - - - - - - - - - - - - - - - - - - , M17Arg (pH 7.0) M17(pH 5.5)
3.0
Results Goning of the Z. palmae pdc gene. The 1847-bp Zymopdc DNA sequence cloned from genomic PCR contains 93-bp 5' flanking sequences including -35 region, 1668-bp open reading frame (ORF) coding for 556 amino acids, plus 83 bp of 3' flanking sequences after the stop codon. This clone has 4 nucleotide differences from sequences deposited in OenBank. The published COT (R at 154th ) was found to be OCT (A), TCO (S at 391 st) is TCA (S), and AAT (N at 519 th ) is OAT for D. Characterization of Z. palmae PDC. The pRSETZpdc construct contains ORF of Zymopdc linked in frame with the N-terminal peptide of the vector. Overexpression of the pRSETZpdc in BL21pLysS led to the production of a fusion protein with 36 extra amino acids. The purified PDC on a SDS gel corresponded to approximately 63 kDa (Fig. 2). Additional proteins of about 50 and 30 kDa were also observed. A colorimetric PDC assay. Under in vivo conditions, pyruvate is the only substrate for PDC that converts
2.0
Fig. 3. (A) PDC activities of overexpressed Z. palmae pdc in E. coli BL21(DE3) pLysS cells. (B) PDC activities of engineered L. lactis subsp lactis LM0230 strains that were transformed with Z. palmae pdc driven by Gram-positive promoters in a pAK80 shuttle vector. (C) Comparison of PDC activities in acid-inducible promoter p692-driven PDC and p692-driven lacZ constructs transformed L. lactis subsp lactis LM0230 cells grown in two different media of pH of 5.5 and pH 7.0.
pyruvate to acetaldehyde, but under in vitro assay conditions, the PDC has been used for its catalytic activities of transforming benzaldehyde to (R)-PAC [14]. Over a linear range of time and protein concentration, the formazane produced is proportional to the amounts of
327
Liu et al.: Zymopdc Gene Expression in L lactis Table 2. Fermentation products of recombinant L lactis subsp lactis LM0230 strains Recombinant Strains P692Zymopdc P772Zymopdc P769Zymopdc p692LacZ
Glucose used (mM) 65.81 68.89 67.00 71.84
± ± ± ±
0.59 0.71 0.71 0.39
Lactate (mM)
Acetate (mM)
51.68 65.89 51.40 71.33
53.82 53.05 52.46 52.71
± ± ± ±
0.08 1.80 1.26 0.71
(R)-PAC formed and, therefore, PDC catalytic activities. This assay was adapted here to measure PDC activities in recombinant bacterial extracts that have been engineered to overproduce PDC. Specific PDC activities were detected from the pRSETaZymopdc-transformed, IPTG-induced BL2I cells (Fig. 3A). This indicated that the cloned Zymopdc produced a functional PDC in recombinant E. coli.
PDC expression in Gram-positive host. The pAMJ series containing functional Gram-positive promoters that directed high levels of lacZ expression in L. lactis ssp. cremoris MG 1363 [11] were transformed into L. lactic subsp lactis LM 0230. The ~-gal assays confirmed the strength of these promoters in LM0230: pAMJ769 gave the greatest activity, pAMJ772 intermediate activity, and p692LacZ the lowest activity (data not shown). These Gram-positive promoters were fused with Zymopdc in the shuttle vector pAK80 (Fig. 1). PDC activities were detected in three recombinant LM0230 strains (Fig. 3B). The highly expressed, constitutive promoter construct p769Zymopdc conferred the greatest PDC activity, the p772Zymopdc showed relatively lower PDC activity. The acid-inducible promoter construct p692Zymopdc produced a threefold increase in PDC activity under acidic growth conditions (Fig. 3C, MI7; pH 5.5) when compared to neutral (MI7Arg; pH 7.0). Fermentation of engineered L. laetis strains. Four LM0230 strains containing 692Zpdc, 772Zpdc, 769Zpdc, and 692LacZ were further analyzed for fermentation products. An approximately eightfold increase in acetaldehyde concentrations were detected in fermentations inoculated with either recombinant strain p692Zpdc or p769Zymopdc compared to the controls (Table 2). However, the observed ethanol concentrations (15.22-16.09 mM) in the engineered strains were similar to that produced in the LacZ control strain.
± ± ± ±
0.36 0.24 0.12 0.00
Acetoin (mM) 4.54 3.81 4.03 3.75
± ± ± ±
0.16 0.08 0.09 0.00
Acetaldehyde (mM) 11.36 1.36 11.59 1.37
± ± ± ±
1.29 0.00 1.61 0.32
Ethanol (mM) 15.56 15.98 15.33 16.09
± ± ± ±
0.00 0.16 0.15 0.00
enzyme activity in the recipient cells. The assay used here is based on the assumption that the (R)-PAC formed by PDC transformation corresponds to the PDC enzymatic activities as a result of Z. palmae pdc gene expression in E. coli and L. lactis. This assay does not require NADH and, therefore, is free of interference from related alcohol dehydrogenase background [12]. The major pathway for ethanol synthesis is catalyzed by PDC and ADH. The pdc and adh genes from Z. mobilis have been assembled into an efficient PET (froduction of EThanol) operon and resulted successfully in ethanol production in E. coli [3, 8], but very low ethanol in LAB [5, 12]. Use of an alternate PDC is a possible strategy for overcoming low levels of expression and poor ethanol yields in LAB. We aimed to increase PDC activities by introducing the unique Z. palmae PDC since this PDC was reported as thermostable and has the highest specific activity and lowest K m for pyruvate among all the bacterial PDC examined [15]. Flask fermentation of engineered L. lactis subsp lactis LM0230 showed that a greater than 8-fold increase in the level of acetylaldehyde was detected in P692Zymopdc and P769Zymopdc strains. This suggests that xeno-PDC expression converted pyruvate to acetaldehyde efficiently, but endogenous ADH was not sufficient to reduce the acetaldehyde into ethanol. It would be helpful to incorporate an adh gene after the Zymopdc in the same shuttle vector for enhanced ethanol production. ACKNOWLEDGMENTS We thank Dr. Soren Madsen for providing plasmids pAMJ772, pAMJ769, and pAMJ692. We thank Theresa Holly and Patricia O'Bryan for excellent technical assistance and Dr. ancy ichols for helpful discussion.
Literature Cited
Discussion The objective of the current study was to introduce functional PDC into LAB as a means to convert pyruvate into ethanol. Assessment of PDC expression in recombinant strains required quantification of the
1. Chandra Raj K, Ingram LO, Maupin-Furlow JA (2001) Pyruvate decarboxylase: a key enzyme for the oxidative metabolism of lactic acid by Acetobacter pasteurianus. Arch Microbiol 176:443451 2. Conway T, Osman YA, Konnan n, Hoffmann EM, Ingram LO (1987) Promoter and nucleotide sequences of the Zymomonas mobilis pyruvate decarboxylase. J Bacteriol 169:949-954
328
CURRENT MICROBIOLOGY Vol. 50 (2005)
3. Dien BS, Nichols NN, O'Bryan PJ, Bothast RJ (2000) Development of new ethanologenic Escherichia coli strains for fermentation of lignocellulosic biomass. Appl Biochem Biotechnol 84-86:181-196 4. Esposito L, Sica P, Raia CA, Giordano A, Rossi M, Mazzarella L, Zagari A (2002) Crystal structure of the alcohol dehydrogenase from the hyperthermophilic archaeon Sulfolobus solfataricus at 1.85 A resolution. J Mol BioI 318:463-477 5. Gold RS, Meagher MM, Tong S, Hutkins RW, Conway T (1996) Cloning and expression of the Zymomonas mobilis "production of ethanol" genes in Lactobacillus casei. CUIT Microbiol 33:256-260 6. Hugenholtz J, Kleerebezem M (1999) Metabolic engineering of lactic acid bacteria: overview of the approaches and results of pathway rerouting involved in food fermentations. CUIT Opin Biotechnol 10:492-497 7. Hugenholtz J, Sybesma W, Groot MN, Wisselink W, Ladero V, Burgess K, van Sinderen 0, Piard JC, Eggink G, Smid EJ, Savoy G, Sesma P, Jansen T, Hols P, Kleerebezem M (2002) Metabolic engineering of lactic acid bacteria for the production of nutraceuticals. Antonie Van Leeuwenhoek 82:217-235 8. Ingram LO, Conway T, Clark DP, Sewell GW, Preston JF (1987) Genetic engineering of ethanol production in Escherichia coli. Appl Environ Microbiol 53:2420-2425 9. Konig S (1998) Subunit structure, function and organisation of pyruvate decarboxylases from various organisms. Biochim Biophys Acta 1385:271-286 10. Lokman BC, Leer RJ, van Sorge R, Pouwels PH (1994) Promoter analysis and transcriptional regulation of Lactobacillus pentosus
11.
12.
13.
14.
15.
16.
17.
genes involved in xylose catabolism. Mol Gen Genet 245:117125 Madsen SM, Arnau J, Vrang A, Givskov M, Israelsen H (1999) Molecular characterization of the pH-inducible and growth phasedependent promoter P170 of Lactococcus lactis. Mol Microbiol 32:75-87 Nichols NN, Dien BS, Bothast RJ (2003) Engineering lactic acid bacteria with pyruvate decarboxylase and alcohol dehydrogenase genes for ethanol production from Zymomonas mobilis. J Ind Microbiol Biotechnol 30:315-321 O'Sullivan OJ, Klaenhammer TR (1993) Rapid Mini-Prep Isolation of High-Quality Plasmid DNA from Lactococcus and Lactobacillus spp. Appl Environ Microbiol 59:2730-2733 Pohl M (1997) Protein design on pyruvate decarboxylase (PDq by site-directed mutagenesis. Application to mechanistical investigations, and tailoring PDC for the use in organic synthesis. Adv Biochem Eng Biotechnol 58:15-43 Raj KC, Talarico LA, Ingram LO, Maupin-Furlow JA (2002) Cloning and characterization of the Zymobacter palmae pyruvate decarboxylase gene (Pdc) and comparison to bacterial homologues. Appl Environ Microbiol 68:28692876 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press Talarico LA, Ingram LO, Maupin-Furlow JA (2001) Production of the Gram-positive Sarcina ventriculi pyruvate decarboxylase in Escherichia coli. Microbiology 147:2425-2435
SU~Plied by the U.S. Department of AgricUlture, National Center for Agricultural Utilization Research,
Peoria, Illinois
