Functional Specialization of Sensory Cilia by an RFX ... - Genetics

Copyright Ó 2010 by the Genetics Society of America DOI: 10.1534/genetics.110.122879

Functional Specialization of Sensory Cilia by an RFX Transcription Factor Isoform Juan Wang,* Hillel T. Schwartz†,1 and Maureen M. Barr*,2 *Department of Genetics, Rutgers, The State University of New Jersey, Piscataway, New Jersey 08854 and †Department of Biology, Massachusetts Institute Of Technology, Cambridge, Massachusetts 02139 Manuscript received September 2, 2010 Accepted for publication October 4, 2010 ABSTRACT In animals, RFX transcription factors govern ciliogenesis by binding to an X-box motif in the promoters of ciliogenic genes. In Caenorhabditis elegans, the sole RFX transcription factor (TF) daf-19 null mutant lacks all sensory cilia, fails to express many ciliogenic genes, and is defective in many sensory behaviors, including male mating. The daf-19c isoform is expressed in all ciliated sensory neurons and is necessary and sufficient for activating X-box containing ciliogenesis genes. Here, we describe the daf-19(n4132) mutant that is defective in expression of the sensory polycystic kidney disease (PKD) gene battery and male mating behavior, without affecting expression of ciliogenic genes or ciliogenesis. daf-19(n4132) disrupts expression of a new isoform, daf-19m (for function in male mating). daf-19m is expressed in malespecific PKD and core IL2 neurons via internal promoters and remote enhancer elements located in introns of the daf-19 genomic locus. daf-19m genetically programs the sensory functions of a subset of ciliated neurons, independent of daf-19c. In the male-specific HOB neuron, DAF-19M acts downstream of the zinc finger TF EGL-46, indicating that a TF cascade controls the PKD gene battery in this cell-type specific context. We conclude that the RFX TF DAF-19 regulates ciliogenesis via X-box containing ciliogenic genes and controls ciliary specialization by regulating non-X-box containing sensory genes. This study reveals a more extensive role for RFX TFs in generating fully functional cilia.

C

ILIA and flagella are highly conserved structures that fulfill important functions in motility, development, and sensation (Marshall and Nonaka 2006; Scholey and Anderson 2006). All cilia and flagella share three general properties: a microtubulebased axoneme, a ciliary membrane containing receptors and channels, and a ciliogenic intraflagellar transport (IFT) machinery ( Jekely and Arendt 2006; Satir and Christensen 2007; Sloboda and Rosenbaum 2007; Scholey 2008). Cavalier-Smith (1978) has proposed that the ancestral eukaryote was a ciliated unicellular organism (Cavalier-Smith 1978). The evolutionarily conserved cilium has undergone remarkable diversification in structure, length, morphology, molecular composition, and function (Silverman and Leroux 2009). The principles of ciliary specialization are not well understood. Regulatory factor X (RFX) transcription factors (TFs) play a conserved role in ciliogenesis in the nematode, Supporting information is available online at http://www.genetics.org/ cgi/content/full/genetics.110.122879/DC1. Available freely online through the author-supported open access option. 1 Present address: California Institute of Technology, 1200 E. California Blvd., Pasadena, CA 91125. 2 Corresponding author: Department of Genetics, Rutgers University, 145 Bevier Road, Piscataway, NJ 08854. E-mail: [email protected] Genetics 186: 1295–1307 (December 2010)

Drosophila, zebrafish, and mammals (Swoboda et al. 2000; Dubruille et al. 2002; Bonnafe et al. 2004; Liu et al. 2007; Thomas et al. 2010). RFX TFs share a characteristic winged helix DNA binding domain and bind to an X-box motif in the promoters of target genes (Reith et al. 1990, 1994; Emery et al. 1996; Gajiwala et al. 2000). Studies on Caenorhabditis elegans daf-19, the sole RFX TF in the worm, provided important insight into the role of RFX TFs in regulating ciliogenesis and ciliogenic gene batteries (Swoboda et al. 2000; Blacque et al. 2005; Chen et al. 2006; Senti and Swoboda 2008; Senti et al. 2009). daf-19 null mutants fail to express many ciliogenic genes, lack all sensory cilia, and are defective in many sensory behaviors (Perkins et al. 1986; Collet et al. 1998; Swoboda et al. 2000; Efimenko et al. 2005). daf-19 encodes three isoforms: DAF-19A/B functions in nonciliated neurons to maintain synaptic activity in the adult, while DAF-19C is expressed in all ciliated sensory neurons to regulate ciliogenesis (Senti and Swoboda 2008). The human genome encodes seven RFX TFs (Aftab et al. 2008). In mammals, RFX3 regulates genes involved in ciliary assembly and motility (Bonnafe et al. 2004; El Zein et al. 2009). RFX4 is also a ciliary TF (Ashique et al. 2009). In vertebrates, other ciliary TFs have been identified, including HNF1b, Foxj1, and Noto (Gresh et al. 2004; Beckers et al. 2007; Yu et al. 2008). The mechanisms of RFX target

1296

J. Wang, H. T. Schwartz and M. M. Barr

specificity and the relationships between ciliary TFs are not known. The C. elegans nervous system is well endowed with sensory cilia located on the distal ends of sensory dendrites. Sixty sensory neurons are ciliated in the core nervous system (common in both sexes) (Ward et al. 1975; Ware et al. 1975; Perkins et al. 1986). The male has an additional 48 sex-specific ciliated sensory neurons required for mating behaviors (Sulston et al. 1980; Liu and Sternberg 1995; Barr and Sternberg 1999). These cilia may exhibit unique morphologies, express distinct repertoires of receptors and signaling molecules, and function in a variety of sensory modalities (Bae and Barr 2008). In core amphid sensilla, amphid channel cilia are simple single or biciliated rod-like structures that originate from transition zones to 9 1 0 arrangement of doublet microtubules in middle segments and 9 1 0 singlet microtubules in distal segments (Ward et al. 1975; Perkins et al. 1986). Conversely, the amphid wing neurons (AWA/B/C) possess elaborate branched structures (Ward et al. 1975; Perkins et al. 1986; Mukhopadhyay et al. 2007). The C. elegans Foxj1 homolog fkh-2 is required for AWB specification and is regulated by daf-19 (Mukhopadhyay et al. 2007). General cilium structure mutants such as daf-19 are defective in multiple sensory behaviors, including male mating behaviors (Perkins et al. 1986; Barr and Sternberg 1999; Simon and Sternberg 2002; White et al. 2007). A subset of 21 male-specific ciliated neurons may be defined by their unique ultrastructural anatomy, functional properties, and gene expression profiles. Four CEM cephalic, one HOB hook, and 16 ray neurons (RnB where n ¼ rays 1–9, but not ray 6) possess B-type cilia that are exposed to the environment and lie adjacent to A-type cilia embedded in the cuticle (Ward et al. 1975; Sulston et al. 1980; Jauregui et al. 2008). The CEM, HOB, and RnB neurons are implicated in chemotaxis to mates, response, and vulva location, respectively (Barr and Sternberg 1999; Chasnov et al. 2007; White et al. 2007; Jauregui et al. 2008). These male-specific neurons express the autosomal dominant polycystic kidney disease (ADPKD) gene homologs lov-1 and pkd-2, the kinesin-like protein gene klp-6, and five coexpressed with polycystin (cwp) genes, herein called the ‘‘PKD neurons’’ and ‘‘PKD gene battery,’’ respectively (Barr and Sternberg 1999; Barr et al. 2001; Portman and Emmons 2004; Peden and Barr 2005; Miller and Portman 2010). Only ray R6B does not possess an exposed cilium or express the PKD gene battery. Consistent with sensory function in RnB and HOB neurons, lov-1, pkd-2, and klp-6 mutant males are response (Rsp) and location of vulva (Lov) defective. Six IL2 core neurons also express klp-6 (Peden and Barr 2005). The axonemes of the PKD and IL2 neurons are similar in that they possess singlet microtubules of varying numbers, which are distinct from axonemes of the core amphid and phasmid neurons. Although the

PKD and IL2 neurons have several features in common, they are also individually specified via distinct lineagedriven mechanisms and express different sets of neurotransmitters and neuropeptides (Lints and Emmons 1999; Nathoo et al. 2001; Shaham and Bargmann 2002; Yu et al. 2003; Lints et al. 2004; Peden et al. 2007; Schwartz and Horvitz 2007). This raises the question of how the shared traits of PKD and IL2 neurons are patterned and how the PKD gene battery is regulated to generate functional sensory cilia. Previous studies showed that a null allele of daf-19 disrupted pkd-2 expression, although the pkd-2 promoter does not contain an X box ( Yu et al. 2003). Here, we identify a cis-regulatory mutation in the daf-19 locus that produces Rsp, Lov, and PKD gene battery expression defects without affecting ciliogenesis. daf-19(n4132) disrupts daf-19m, a daf-19 isoform required for male mating and that specifically acts in PKD and IL2 ciliated sensory neurons. In these neurons, DAF-19M is both necessary and sufficient for activating the PKD gene battery without affecting ciliogenic gene expression or IL2 ciliogenesis. These studies reveal how the complex genomic architecture of an RFX TF enables a single gene to encode a pan-ciliary isoform (DAF-19C) that regulates ciliogenesis and a tissue-specific isoform (DAF-19M) that controls cilia specialization.

MATERIALS AND METHODS Strains, plasmids, and PCR products: Growth and culture of C. elegans strains were carried out as described (Brenner 1974). Male-enriched strain him-5(e1490)V (high incidence of males) was used as the wild-type reference strain for these studies (Hodgkin 1983). The daf-19 m86, sa190, sa232, m334, and m407 mutant alleles form dauers constitutively, but 20– 30% are nondauers when raised at 15°. We maintained these daf-19 alleles at 15° and shifted them to 20° one day before the assay. All other strains were grown at 20° unless otherwise stated. Strains used for this study are listed in supporting information, Table S1 and File S1. daf-19 genomic DNA fragments were generated by PCR and described in Table S2. CWP-1TGFP, Posm-9TGFP, Punc-119Tdaf-19mDDIMTGFP, Pdaf-19mTGFP, and P1-5daf-19mTGFP were made by PCR– splice by overlap extension (SOE) (Hobert 2002) or cloning into Fire lab vectors, as described in Table S2. Determining gene expression pattern: All expression analysis was carried out using transgenic GFP reporters. At least six stable lines were generated and scored for each transgene. Behavioral assays: Response and location-of-vulva efficiency assays were carried out according to Barr and Sternberg (1999). Briefly, 12 unc-31(e169) young adult hermaphrodites were placed on a 1-cm bacteria lawn on an NGM agar plate. Males were added to the mating plate and observed for 5 min. Response efficiency reflects the percentage of males that successfully responded to hermaphrodite contact within 10 min. An individual male’s vulva-location ability was calculated as inverse of the number of times the male encountered the vulva before successfully locating it. In all experiments, at least 20 animals were scored per experimental trial. Triplicate trials were performed for each line to obtain statistical data. Mating efficiency assays were carried out as described by Hodgkin (1983). Mating efficiencies were calculated as the

Ciliary Specialization in C. elegans percentage of cross progeny divided by the number of total progeny. Dye-filling assay: A modified dye-filling method was used so that in addition to amphid and phasmid neurons, IL2 neurons were also stained (Burket et al. 2006). Stock solution (2.5 mg/ml) of 1,19-dioctadecyl-3,3,39,39-tetramethylindocarbocyanine perchlorate (DiI, Molecular Probe cat. no. D-282) in N,Ndimethylformamide was stored at 4°. Healthy worms were washed off plates with 50 mm calcium acetate, then washed with 50 mm calcium acetate two more times. Worms were immersed in 10 mg/ml DiI in 50 mm calcium acetate and rotated gently for 2 hr. Worms were washed with water twice and plated on fresh bacteria lawns for 30 min before scoring. Mapping of n4132 and cloning of daf-19m: Three-factor mapping placed n4132 on chromosome II to the right of unc-4. Deficiency strains were used to map n4132 to the 1.99– 2.35 region. mnDf83 and mnDf29 failed to complement n4132, while mnDf71, mnDf25, mnDf28, mnDf12, mnDf22, and mnDf27 complemented n4132. PCR-amplified genomic DNA was used in n4132 rescue experiments. n4132 genomic DNA including 2 kb upstream and 1 kb downstream of the daf-19 gene was sequenced. A deletion flanked by the sequences ‘‘CACAAGCCACAAGCTA. . . . . .GCCACCGCCGAGCCA’’ [F33H1 GenBank: Z48783.1 10,466–10,969 nucleotides (nt)] was identified in n4132. daf-19m cDNA isolation: mRNA was isolated from mixed staged him-5(e1490) worms using the Oligotex mRNA Mini Kit (Qiagen cat. no. 70022). The cDNA corresponding to daf19m was generated from oligo dT primed first-strand cDNA by using SuperScript III First-Strand Synthesis System for RT–PCR (Invitrogen, Carlsbad, CA), followed by amplification with forward primer 59-atgagaagagtgtacgaaacg-39 and reverse primer 59-gacctgcaggatgatgacga-39. The daf-19m sequence is available at GenBank (EU812221.1). Bioinformatics: Family Relationship II (Brown et al. 2005) was used to identify conserved DNA sequences among Caenorhabditis species. Microscopy and image analysis: Live worms were mounted on 2% agarose pads with 10 mm levamisol as described previously (Bae et al. 2006). Fluorescence images were obtained with an Axioplan 2 (Carl Zeiss MicroImaging, Oberkochen, Germany) microscope equipped with a digital CCD camera (Photometrics Cascade 512B; Roper Scientific), captured with Metamorph software (Universal Imaging, West Chester, PA), and then deconvolved with AutoDeblur 1.4.1 (Media Cybernetics). Photoshop (Adobe) was used for image rotation, cropping, and brightness/contrast adjustments.

RESULTS

The n4132 mutation disrupts sensory but not ciliogenic gene expression in male-specific PKD neurons and core IL2 neurons: To understand how cilia are specialized for sensory functions, we characterized the n4132 mutant, which was isolated on the basis of the loss of Ppkd-2TGFP expression in male-specific CEM head neurons. n4132 mutant males do not express lov-1, pkd-2, or klp-6 GFP reporters in the male-specific CEMs, HOB, and RnB neurons, herein referred to as the PKD neurons (Figure 1, C, D, G, and H; Table 1). n4132 also disrupts KLP-6TGFP expression in the core IL2 neurons of males and hermaphrodites from embryogenesis through adulthood (Table 1). Five cwp (coex-

1297

pressed with polycystin) genes share an identical expression pattern with lov-1 and pkd-2 (Portman and Emmons 2004; Miller and Portman 2010), with a fulllength CWP-1TGFP translational fusion also expressed in IL2 neurons (Table 1). n4132 abolishes CWP-1T GFP expression in IL2 and PKD neurons (Table 1). The nlp-8 neuropeptide gene reporter is expressed in core neurons (PVT in the tail and some amphid neurons including ASK and ADL in the head) and in the malespecific HOB neuron (Nathoo et al. 2001). n4132 specifically disrupts Pnlp-8TGFP in HOB without affecting expression in core neurons (Table 1). The TRPV channel osm-9 is expressed in the male-specific PKD neurons, core IL2 neurons, and core neurons in the amphid and phasmid sensilla (Colbert et al. 1997; Knobel et al. 2008). In n4132 animals, osm-9 expression is disrupted only in the IL2 and PKD neurons (compare n4132 in Figure 1, K and L to wild type in Figure 1, I and J; Table 1). In contrast, the daf-19(m86) null allele abolishes osm-9 expression in PKD and all core neurons [compare daf-19(m86) in Figure 1, M and N to wild type in Figure 1, I and J]. To determine whether n4132 acts specifically in a subset of ciliated sensory neurons or plays a broad role in the ciliated nervous system, we examined a battery of ciliary GFP reporters. n4132 does not affect ciliogenic gene expression of intraflagellar transport (IFT) component OSM-6TGFP in PKD, core IL2, or other ciliated sensory neurons (compare n4132 in Figure 1, Q and R to wild type in Figure 1, O and P; Table 1). n4132 does not affect ciliogenic gene expression of other IFT reporters including osm-5, bbs-1, bbs-2, bbs-5, and daf-10 in PKD, core IL2, and other ciliated sensory neurons (Table 1). The odorant receptor odr-10 and guanylate cyclase (gcy-5 and gcy-32) genes that are expressed in the core nervous system are not affected by the n4132 mutation (Table 1). We conclude that the n4132 mutation specifically disrupts expression of sensory signaling genes in IL2 and PKD neurons (pkd-2, lov-1, klp-6, cwp-1, nlp-8, and osm-9) without affecting genes required for ciliogenesis or acting in other ciliated sensory neurons. Like pkd-2, lov-1, and klp-6 mutants, n4132 males exhibit response and Lov defects (Figure 2A). The response efficiency of n4132 males is not significantly different from the lov-1; pkd-2 double mutant (35% of mutant males respond to contact with a hermaphrodite compared to 95% of wild-type males, Figure 2A). However, n4132 males exhibit more severe Lov defects than lov-1; pkd-2 mutants (Figure 2A). n4132 mutant males are able to sire cross progeny in 24-hr mating efficiency assays, albeit at lower levels than lov-1; pkd-2 double mutant males (Figure 2B). We conclude that n4132 affects male mating behavior, consistent with a role in functional specialization of PKD ciliated sensory neurons. n4132 is a hypomorphic, recessive allele of daf-19: We mapped n4132 to a small region near the daf-19

1298


Figure 1.—daf-19(n4132) disrupts expression of sensory but not ciliogenesis genes in core IL2 and male-specific PKD neurons. The cartoon shows the cell body positions of CEM, IL2, and amphid neurons in the male head, HOB, RnB, and phasmid in the male tail. (A, B, E, F) In wild-type males, LOV-1TGFP and PKD-2TGFP are expressed in four CEM, one HOB, and 16 RnB (n ¼ 1–9 but not 6) neurons. (C, D, G, H) In n4132 males, LOV-1TGFP and PKD-2TGFP expression is completely abolished. Autofluorescence is observed in the intestine as well as the sclerotized hook and spicule structures of the male tail. (I and J) In wild type, osm-9 is expressed more broadly in ciliated sensory neurons, including the male-specific PKD neurons and core IL2, amphids, and phasmids (Colbert et al. 1997; Knobel et al. 2008). (K and L) In daf-19(n4132), osm-9 is not expressed in core IL2, male-specific CEM neurons, and 50% of HOB and RnB neurons. In those cells having osm-9 expression, the expression level is reduced (see also Table 1). (K and L) daf-19(n4132) does not affect osm-9 expression in core amphids or phasmids. (M and N) In daf-19(m86) null males, osm-9 expression is completely abolished. (O–R) In wild-type and n4132 males, the osm-6 ciliogenic gene is expressed in all ciliated neurons. Cil-

locus on chromosome II. Rescue of the PKD-2TGFP expression, response, and Lov defects was obtained by transforming n4132 animals with cosmid F33H1 or ORF F33H1.1, which contains the RFX TF gene daf-19. To identify the lesion in daf-19, we sequenced n4132 genomic DNA including 2 kb upstream and 1 kb downstream noncoding regions. The n4132 allele contains a 504-bp deletion within the fifth intron of the daf-19 genomic clone (F33H1, GenBank: Z48783.1) deleted 10,466–10,969 nt, Figure 3A). In contrast, the daf19(m86) null allele introduces a stop codon in exon 7 (F33H1, GenBank: Z48783.1; nt 9760 C to T) before all conserved domains, including the DNA binding domain (DBD) and DNA dimerization (DIM) domain (Figure 3A) (Swoboda et al. 2000). daf-19(m86) null animals resemble n4132 mutants in that pkd-2 expression in PKD neurons and nlp-8 expression in HOB is abolished ( Yu et al. 2003). However, n4132 is distinct from other daf-19 alleles (m86, sa190, and sa232), which do not express ciliogenic genes like osm-6 and do not form cilia. The daf-19 alleles m86, sa190, sa232, m334, and m407 also result in constitutive formation of dauer larvae (Daf-c) (Malone and Thomas 1994; Swoboda et al. 2000), whereas the n4132 mutant is not Daf-c (Table 2). In daf-19(m86), IL2, amphid, and phasmid ciliated sensory neurons fail to fill with lipophilic fluorescent dyes (Perkins et al. 1986). This dye-filling defective (Dyf) phenotype is indicative of cilium structure defects. In n4132 animals, IL2, amphid, and phasmid cilia are intact, as judged by fluorescent dye uptake (200/200 animals normal in dyefilling assays) and visualization of an OSM-6TGFP reporter in amphid, phasmid, and male-specific sensory cilia (Figure S1; Figure 1, compare panels O and P with Q and R). That the IL2 neurons of n4132 animals are not Dyf, do express ciliogenic reporters, but do not express sensory genes strongly suggests that daf-19(n4132) affects the function but not development of IL2 cilia. To genetically confirm that n4132 is an allele of daf-19, we performed complementation tests between n4132 and the daf-19 Daf-c alleles m86, sa190, sa232, m334, and m407 (Table 2). n4132 complements the Daf-c phenotypes of m86, sa190, sa232, m334, and m407. Conversely, the daf-19 alleles m86, sa190, and sa232 failed to complement n4132 PKD-2TGFP expression defects (Table 2). The Tc1 transposon insertion alleles of daf-19 m334 and m407 map to the fifth intron of the daf-19 genomic clone (Figure 3A), are in opposite orientations (m334 is 59 to 39 while m407 is 39 to 59) (Swoboda et al. 2000), and exhibit varying defects in PKD-2TGFP expression (Table 2). m334 is defective in PKD-2TGFP expression in the CEMs but has normal iary transition zones and ciliary axonemes are visible in wildtype and daf-19(n4132) males (arrowheads). In daf-19(m86) males, lov-1, pkd-2, and osm-6 expression is completely abolished (Swoboda et al. 2000; Yu et al. 2003). Bar, 10 mm.

Ciliary Specialization in C. elegans

1299

TABLE 1 Comparison of reporter expression pattern in wild type and daf-19 mutant worms Expression pattern Reporter

Hermaphrodite

LOV-1TGFP

CEM HOB RnB CEM HOB RnB

PKD-2TGFP

KLP-6TGFP

Male

IL2 IL2 CEM HOB RnB

CWP-1TGFP

Pnlp-8TGFP Posm-9TGFP

Posm-5TGFP OSM-6TGFP DAF-10TGFP bbs-1TGFP bbs-2TGFP bbs-5TGFP ODR-10TGFP gcy-5TGFP gcy-32TGFP

IL2 IL2 CEM HOB RnB HOB ASK and ADL IL2 Amphid and phasmid IL2 CEM HOB RnB Amphid and phasmid sensory neurons sensory neurons sensory neurons sensory neurons sensory neurons sensory neurons

All ciliated All ciliated All ciliated All ciliated All ciliated All ciliated AWA ASER URX, AQR, and PQR

expression in HOB and RnB tail neurons. The n4132/ m334 heterozygote has nearly normal PKD-2 expression: 92% of males express PKD-2TGFP in CEMs, 100% of males express PKD-2TGFP in HOB, and 83% of males express PKD-2TGFP in a subset of RnB neurons. The m407 allele does not affect PKD-2TGFP and only partially complements n4132. n4132/m407 heterozygotes exhibit normal HOB expression but only express PKD-2TGFP in only a subset of CEM and RnB neurons. These results indicate that pkd-2 expression in CEM, HOB, and RnB neurons is differentially regulated, that the directionality of the Tc1 insertion impacts PKD2TGFP expression, and that n4132 displays complex interactions with m334 and m407. We conclude that the n4132 mutation disrupts a particular aspect of daf-19 function by affecting sensory gene expression in PKD and IL2 neurons, but does not act globally in the ciliated nervous system.

Genotype (% worm with wild-type reporter expression) WT

daf-19(n4132)

100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100

0 0 0 0 0 0 24 13 0 0 2 0 0 0 0 0 0 100 0 99

96 98 98 96 96 100 100 100 100 100 100 100 100 100

0 0 47 40 98 100 100 100 100 100 100 100 100 100

n4132 specifically disrupts the daf-19m isoform: The predicted daf-19 gene encodes three isoforms, DAF-19A, DAF-19B, and DAF-19C with alternative splicing and an internal promoter (Figure 3A) (Senti and Swoboda 2008). daf-19a/b are required for synaptic maintenance while daf-19c is necessary and sufficient for ciliogenesis (Senti and Swoboda 2008; Senti et al. 2009). We identified a fourth cDNA isoform by RT–PCR using mRNA from mixed-stage, mixed-sex culture (Figure 3B) (accession no. EU812221.1). We refer to this new isoform as DAF-19M for its apparent function in regulating mating behavior and gene expression in PKD neurons. daf-19m starts with an unique exon containing a 166 bp 59-UTR and an 11-amino-acid (aa)-coding region not present in other isoforms, followed by exon 6 and the DNA sequence shared among all daf-19 isoforms (Figure 3C). Based on the cDNA sequence, daf-19m encodes a predicted 622-aa protein. All four

1300


Figure 2.—daf-19(n4132) males are response, Lov (location of vulva), and mating efficiency defective. (A) Response and location of vulva efficiency was scored for each genotype. n4132 males exhibit behavioral efficiency defects when compared to wild type (P , 0.01 for both Response Efficiency and Location of vulva Efficiency assay). n4132 and lov-1;pkd-2 have comparable response efficiencies. n4132 males have a more severe Lov defect than lov-1; pkd-2 double mutants. (B) n4132 males are able to sire progeny, but mating efficiency is significantly lower than lov-1; pkd-2 double mutant (P , 0.01). Error bars indicate standard error of the mean. An asterisk indicates a significant difference between n4132 and lov-1; pkd-2 (*P , 0.01). NS, not significantly different. Statistical analyses were performed by nonparametric Mann–Whitney tests with a two-tailed P-value.

daf-19 isoforms encode the same DNA binding and DNA dimerization domains. In the daf-19(n4132) background, the daf-19m but not daf-19a or daf-19b cDNA is absent as determined by RT–PCR (Figure 3B). From a mixture of cDNA clones, we obtained one copy of daf-19b and 29 daf-19a cDNAs, indicating the latter is more abundant. We infer that daf-19c is intact, because daf-19(n4132) animals form cilia as judged by dye filling, IFT reporters, and non-Daf-c phenotype. We conclude that daf-19(n4132) specifically disrupts daf-19m, a specific isoform of daf-19 required for functional specialization of a subset of ciliated neurons. To determine how the n4132 lesion affects daf-19m, we identified a minimal-sized fragment capable of phenotypic rescue. PCR2, a PCR amplicon that lacks

the predicted promoter and exons 1 to 2 of daf-19a/b (6826–17819 in F33H1 GenBank: Z48783.1), fully rescues the n4132 PKD-2TGFP expression and mating behavior defects (Figure 3C). A shorter fragment (PCR3) lacking all coding and noncoding regions of daf-19a/b to intron five (6828–14,217 in F33H1 GenBank: Z48783.1) and exons 1 and 2 of daf-19c, rescues PKD-2TGFP expression in tail but not head neurons. PCR3 also rescues n4132 Lov defects but not response defects. Introducing the n4132 molecular lesion into PCR3 to generate PCR4 (6828–14,217 in F33H1 GenBank: Z48783.1, with deletion 10,466 to 10,969) does not rescue any n4132 defects, indicating that those deleted elements are required to activate PKD-2TGFP expression in the tail. daf-19m is expressed in IL2 and PKD neurons via discrete regulatory elements: To determine DAF-19M site of action, we examined daf-19m expression patterns by fusing the putative daf-19m promoter, a 1-kb region upstream of exon 6 to GFP, resulting in the P1daf-19mTGFP reporter (Figure 4B). P1daf-19mTGFP is specifically expressed in the male tail HOB and RnB neurons but not in male-specific CEM head neurons or other ciliated neurons. This result is consistent with PCR3 rescue of PKD-2TGFP expression in tail HOB and RnB but not head CEM neurons. To determine the element(s) responsible for daf-19m activity in core IL2 and male-specific CEM head neurons, we used comparative genomics. The genomes of three Caenorhabditis species (elegans, briggsae, and remanei) contain daf-19, lov-1, pkd-2, and klp-6, suggesting a possible conserved transcriptional regulatory pathway. Interspecific comparisons of noncoding regions enable identification of cis-acting regulatory elements that control gene expression and that are evolutionarily constrained. By comparing intronic daf19 sequence of C. elegans, C. briggsae, and C. remanei, we identified a 22-bp conserved sequence in intron two of daf-19a/b and outside of the daf-19c regulatory and genomic regions, located 5572 bp from the daf-19m start codon (Figure 4A and Figure S2) (Senti and Swoboda 2008). Adding this 22-bp element to P1daf19mTGFP (generating P4daf-19mTGFP) drives GFP expression in the male-specific PKD head and tail neurons and core IL2 neurons (Figure 4, C–E). We conclude that this 22-bp sequence acts remotely as a daf-19m CEM/IL2 element. The CEM and IL2 neurons are born embryonically, yet daf-19m is expressed in distinct temporal patterns. In core IL2s, P4daf-19mTGFP is expressed throughout development in males and hermaphrodites. In male-specific CEMs, P4daf-19mTGFP expression commences in the mid to late L4 male, a stage that coincides with pkd-2 expression and the onset of sexual maturity. daf-19(n4132) animals have a deletion in the HOB/RnB region but retain the CEM/IL2 element, yet do not express the PKD sensory genes in both head and tail neurons.


1301

Figure 3.—n4132 is a hypomorphic allele of daf-19 that specifically disrupts DAF-19M, an isoform of the RFX TF required for male mating behaviors. (A) Genomic structure of daf-19 isoforms and the locus mutated in n4132. The daf-19(n4132) hypomorphic allele is a deletion in the fifth intron of the daf-19b predicted structure. White boxes are exons, light gray regions are untranslated regions (UTRs). (B) The daf-19m cDNA was amplified by RT–PCR from total mRNA of wild-type mixed-stage and mixed-sex cultures and sequenced (accession no. EU812221). In n4132 animals, the daf19m but not daf-19a/b cDNA is absent. (C) Diagram of daf-19m genomic rescue of daf-19(n4132) defects in PKD2TGFP expression and male mating behavior (RE, response efficiency; LE, location of vulva efficiency). daf-19m cDNA structure compared to the daf-19b isoform. daf-19m uses an internal promoter (in the fifth predicted intron) and a distal upstream element (in the second predicted intron) but shares the DBD and DIM domain with daf-19a/b. daf-19 genomic fragments were scored for the ability to rescue n4132 PKD-2TGFP expression and behavioral defects (restoration of RE and LE). Both PCR1 and PCR2 fully rescue daf-19(n4132) defects. PCR2 lacks the promoter and two exons of daf-19a/b and contains the daf-19c and daf-19m genomic regions. The shorter PCR3 fragment rescues PKD-2TGFP expression in tail (HOB and RnB) but not head (CEM) neurons. PCR3 rescues n4132 Lov but not response defects (normal LE, abnormal RE). PCR4, made by introducing the n4132 molecular lesion to PCR3, abolishes rescue of n4132.

These data indicate that the CEM/IL2 remote element depends upon the HOB/RnB promoter region. To identify the essential HOB/RnB element, the 504-bp n4132 molecular lesion was introduced to P1daf19mTGFP1, generating P2daf-19mTGFP. This lesion abolished HOB and RnB expression (P2daf-19mTGFP in Figure 4B). To define the HOB/RnB element, we compared this 504-bp region among C. elegans, C. briggsae, and C. remanei and identified a 13-bp conserved element located 93 bp from the daf-19m start codon (Figure 4A). Deletion of this 13-bp element (P3daf19mTGFP) destroyed HOB and RnB expression of daf-

19m (Figure 4B). Moreover, daf-19m expression from the CEM/IL2 element depends on this 13-bp element (P5daf-19mTGFP in Figure 4, F–H). In summary, we identified two elements that confer precise spatial and temporal regulation to daf-19m: the HOB/RnB element and the CEM/IL2 remote enhancer element. DAF-19M is sufficient to drive PKD-2TGFP expression and localization in core IL2 and male PKD neurons: To test daf-19m function, we fused a daf-19m cDNA or genomic fragment to GFP reporter and scored for rescue of n4132 PKD-2TGFP expression defects. DAF-19M is nuclear localized (Figure S3A), while PKD-

TABLE 2 Complementation tests between n4132 and other daf-19 alleles pkd-2 expression Genotype n4132/n4132 m86/m86 n4132/m86 n4132/sa190 n4132/sa232 m334/m334 n4132/m334 m407/m407 n4132/m407 a

Daf-C

CEM

HOB

RnB

Number

Non-Daf-C Daf-C Non-Daf-C Non-Daf-C Non-Daf-C Daf-C Non-Daf-C Daf-C Non-Daf-C

— — — — — — 1(92%) 1 183%b

— — — — — 1 1 1 1

— — — — — 1 183%a 1 130%b

.100 20 20 20 20 23 12 20 30

These males express PKD-2TGFP in two to five pairs of RnB (compared to eight pairs of RnB neurons in wild type). b One to three CEM neurons express PKD-2TGFP (as opposed to four CEM neurons in wild type).

1302


Figure 4.—daf-19m is exclusively expressed in male-specific PKD neurons and core IL2 neurons. (A) Discrete cis-regulatory elements regulate daf-19m expression in head (CEM/ IL2) and tail (HOB/RnB) neurons. The CEM/IL2 and HOB/RnB elements are conserved among Caenorhabditis species C. elegans (Ce), C. briggsae (Cb), and C. remanei (Cr). (B) Diagram of daf-19m promoterTGFP reporters and their relationship to daf-19 and the n4132 deletion. (C and F) In hermaphrodites, P4daf-19mTGFP is expressed in IL2 neurons (C) and abolished in P5daf-19mTGFP by deleting the HOB/RnB element (F). (D and E, G and H) In the male, P4daf19mTGFP is expressed in IL2 and CEM head neurons (D) and HOB and RnB tail neurons (E), and is completely abolished in P5daf19mTGFP, which removes the 13-bp HOB/RnB element (G and H). Bar, 10 mm.

2TGFP is nonnuclear and localized to the cell body and cilia (Figure S3B). The distinct DAF-19M nuclear and PKD-2 cytoplasmic/ciliary subcellular distribution patterns enable visualization of both reporters (Figure 5, B–J; Figure S3C). Expression of the full length daf-19m cDNA using the daf-19m P1 promoter did not rescue PKD-2TGFP expression in n4132 tail HOB/RnB or head CEM/IL2 neurons (data not shown). Swoboda et al. (2000) reported that a genomic segment (from 3 kb upstream of daf-19a/b start codon to the DNA binding domain coding region) fused to GFP (pJT1228) fully rescued daf-19(m86) ciliogenesis defects, indicating that the DIM domain is not required for transcription activation activity of daf-19 (Swoboda et al. 2000). We therefore generated a daf-19m genomic fragment containing the P1 promoter, 59-UTR and regions up to and including the DNA binding domain-encoding region fused to GFP reporter (P1daf-19mTDAF-19DDIMTGFP). This construct rescued n4132 PKD-2TGFP expression and localization in male tail HOB and RnB neurons. Including the 22-bp CEM/IL2 remote element in P4daf19mTDAF-19DDIMTGFP induced PKD-2TGFP expression and localization in CEM, HOB, and RnB neurons, similar to PKD-2TGFP expression and localization in

wild-type males. In PKD neurons, daf-19m is necessary and sufficient for functional specialization neurons, is not autoregulated, and does not require a DIM domain in this context. In IL2 neurons, P4daf-19mTDAF19DDIMTGFP ectopically induced PKD-2TGFP expression and ciliary localization in both male and hermaphrodite throughout embryogenesis, larval development, and adulthood in the n4132 background (Figure 5A). This result suggests that the DIM domain may be required for regulation of DAF-19M activity in IL2 neurons. To determine whether DAF-19M function is sufficient and independent of DAF-19C, we used a panneural promoter (Punc-119) to drive expression of the genomic DAF-19MDDIMTGFP fragment (Punc-119T DAF-19MDDIMTGFP) in wild-type, daf-19(n4132), and daf-19(m86) backgrounds. In the daf-19(m86) null mutant, Punc-119TDAF-19MDDIMTGFP does not rescue dyefilling phenotype in amphid, phasmid, or in IL2 neurons (0%, n ¼ 100), indicating that daf-19m cannot substitute for daf-19c function in ciliogenesis. However, Punc-119TDAF-19MDDIMTGFP does activate PKD2TGFP expression in male-specific PKD and core IL2 neurons of daf-19(m86) mutants, indicating that daf-19m


1303

Figure 5.—daf-19m function is restricted to IL2 and PKD neurons and is sufficient for PKD-2 expression. (A) Genomic structure and rescuing fragments of daf-19. daf-19 isoforms differ in the 59 exons. Isoform-specific exons are labeled accordingly (a, b, c, or m); no label indicates an exon conserved among all four isoforms. P1daf-19mTDAF19MDDIMTGFP rescues PKD2TGFP expression in the tail but not head neurons of n4132 males. Including the 22-bp CEM and IL2 element in P4daf19mTDAF-19MDDIMTGFP rescues PKD-2TGFP expression in head and tail neurons of n4132 animals. (B–J) Pan-neuronal expression of daf-19m (Punc119TDAF-19MDDIMTGFP) is sufficient to drive PKD-2TGFP expression and localization in core IL2 and male-specific PKD neurons, but is insufficient to induce PKD-2TGFP expression outside of the endogenous daf19m expressing neurons. (B and C) In wild-type hermaphrodites and males, pan-neural expression of daf-19mDDIM is sufficient to induce PKD-2TGFP expression and ciliary localization in core IL2. (C and D) In wild-type males, PKD-2TGFP expression remains restricted to IL2 and male-specific PKD neurons with Punc-119TDAF-19MDDIMTGFP. (E–J) In daf-19(n4132) and daf19(m86) backgrounds, pan-neuronal expression of daf-19mDDIM rescues PKD-2TGFP expression in male-specific PKD neurons and ectopically in core IL2 neurons, indicating that DAF-19M is necessary and sufficient for pkd-2 expression. PKD-2TGFP is nonnuclear and localizes to cell bodies (small arrows) and cilia (arrowheads) or dendritic tips in daf-19(m86) (H–J). Bar, 10 mm.

is sufficient to drive pkd-2 expression independent of daf-19a/b/c (Figure 5, H–J). In all three genetic backgrounds, Punc-119TDAF19MDDIMTGFP does not induce expression of PKD2TGFP in other ciliated neurons, with exception of IL2 neurons. This observation suggests that DAF-19M function is restricted to PKD and IL2 neurons by unidentified positive and/or negative regulators. Similarly, PKD2TGFP ciliary localization requires cell-type specific transporting components that are only present in PKD neurons (Bae et al. 2006), but have the potential to be ectopically expressed in IL2 neurons by DAF-19MDDIM overexpression. In IL2 neurons overexpressing daf19mDDIM (Punc-119TDAF-19MDDIMTGFP or P4daf19mTDAF-19MDDIMTGFP), PKD-2TGFP is expressed and localized to cilia or distal dendrites in cilia-less daf19(m86) animals, indicating that the cell type-specific transporting components are under the control of daf-19m. egl-46 acts upstream of daf-19m in a cell type-specific manner: Previous work of Sternberg and colleagues showed that the zinc finger TF EGL-46 is a cell-specific

TF that regulates HOB differentiation, while daf-19 regulates lov-1 and pkd-2 expression in all PKD neurons (Yu et al. 2003). The GFP-tagged daf-19 genomic clone that rescues daf-19 ciliogenesis defects is expressed in all ciliated neurons in the hermaphrodite as well as in all 36 ray neurons (RnA and RnB) and both hook neurons (HOA and HOB) in the male tail (Swoboda et al. 2000; Yu et al. 2003). Yu et al. (2003) also showed that daf-19(m86) is not defective in egl-46 expression, and egl-46 is not required for daf-19 expression, leading to the proposal that daf-19 and egl-46 act in distinct pathways to regulate gene expression in the HOB neuron. On the basis of work by the Swoboda lab (Senti and Swoboda 2008) and shown here, we now know that the GFP-tagged daf-19 genomic reporter (2.9 kb of the daf-19 promoter and 10 kb of daf-19 genomic sequence just downstream of the DBD domain fused to GFP) includes the promoters of all daf-19 isoforms: a, b, c, and m (Figure 3A). To determine the relationship of daf-19m and egl-46, we examined daf-19m expression in egl-46 mutant males. Surprisingly, we

1304

J. Wang, H. T. Schwartz and M. M. Barr Figure 6.—egl-46 is required for daf-19m expression in the HOB neuron. (A and D) In wild-type and egl-46 hermaphrodites, daf19m is expressed in IL2 neurons. (B and C) In the wild-type male, daf-19m is expressed in IL2 and CEM neurons in the head and the HOB and RnB neurons in the tail. (E) In the egl-46 male head, daf-19m is expressed in IL2 and CEM neurons. (F) In the egl46 male tail, daf-19m expression is lost in the HOB neuron but intact in RnB neurons. Arrowheads point to rays 4 and 5.

found that egl-46 is required for daf-19m expression only in HOB, but not in any other cell types (Figure 6). egl-46 hermaphrodites exhibit normal daf-19m expression in IL2 neurons (n ¼ 20 animals, 120/120 cells; Figure 6, A and D). In egl-46 males, 20/22 males do not express daf19m in HOB neuron (Figure 6F), while 22/22 males exhibit normal daf-19m expression in head CEM and IL2 neurons (Figure 6E) and tail RnB (Figure 6F). We conclude that that egl-46 acts upstream of daf-19m to regulate PKD gene expression specifically in the HOB neuron but not other PKD neurons. DISCUSSION

RFX TFs perform an evolutionarily conserved role in ciliogenesis (Silverman and Leroux 2009; Thomas et al. 2010). Cilia are highly specialized for functions in signal transduction, development, or motility (Marshall and Nonaka 2006). On the other hand, all cilia and flagella are built by the evolutionarily conserved intraflagellar transport (IFT) machinery, which was first identified in the unicellular algae Chlamydomonas (Kozminski et al. 1995). By contrast, ciliogenesis in metazoa depends on RFX TFs (Chu et al. 2010). The C. elegans genome encodes a sole RFX TF DAF-19, in contrast to two in Drosophila melanogaster, nine in Danio rerio, and seven in the genomes of Mus musculus and Homo sapiens (Chu et al. 2010; Thomas et al. 2010). Swoboda and colleagues demonstrated that the daf-19 locus encoded three isoforms, with the daf-19c isoform being necessary and sufficient for ciliogenesis (Swoboda et al. 2000; Senti and Swoboda 2008; Senti et al. 2009). Our study provides the first evidence that a fourth tissuespecific isoform, daf-19m, regulates the functional specialization but not formation of cilia. C. elegans diversifies gene function by internal promoters that generate spatial–temporal specific isoforms (Choi and Newman 2006). As the sole RFX TF in C. elegans, daf-19 encodes distinct isoforms that function in synaptic maintenance (DAF-19A/B), ciliogenesis (DAF-19C), and ciliary functional specialization (DAF19M) (Senti and Swoboda 2008). Senti et al. (2009)

showed that in some core ciliated neurons (ASER, ADF, ASH, AWC, PHA, and PHB) expression of the daf-19c isoform is necessary and sufficient to generate a fully functional cilium. However, in another ciliated neuron (ASJ), daf-19c expression is insufficient to rescue the ASJ dye-filling defect of daf-19(m86) null animals, suggesting additional function from the daf-19 locus is required to generate a fully functional cilium in some contexts. Our work shows that the daf-19m isoform is required for cilia specialization in the male-specific PKD neurons and core IL2 neurons. The daf-19m isoform is not required for dauer formation, ciliogenesis, or for expression of ciliogenic genes. Conversely, the daf-19 Tc1 insertion allele m407 is Daf-c without affecting PKD-2TGFP expression, indicating that these daf-19 functions are genetically separable. Expression of daf19m using a pan-neural promoter does not rescue daf19(m86) dye-filling defects but is sufficient to activate PKD-2TGFP expression and localization. These results indicate that daf-19m specifically regulates genes required for sensory signaling in a daf-19c-independent manner. We conclude that in some sensory neurons, daf19c is sufficient for the development and functional specialization of a cilium, whereas in PKD and IL2 neurons, pan-ciliary daf-19c regulates generic ciliogenesis while the tissue-specific daf-19m isoform controls functional specialization. This model raises the question of how similar and coexpressed RFX isoforms target different gene batteries (ciliogenic vs. sensory genes). In mammalian genomes, genes with alternative promoters are common (Davuluri et al. 2008). Mammalian RFXs have alternative isoforms, with RFX3 encoding eight (Aftab et al. 2008) and RFX4 encoding six (Zhang et al. 2007). Similar to the case for daf-19, RFX3 regulates two categories of genes: those involved in ciliary assembly and in ciliary motility (El Zein et al. 2009). Rfx4_v3 is a novel brain-specific isoform, which was identified on the basis of mutant phenotype of transgene inserted into an intron (Zhang et al. 2007), which is reminiscent of daf-19m identification, based on n4132 mutant phenotypes. RFX TFs bind to the X-box motif,


which is common in the genome. In C. elegans, there are 700 predicted X-box genes (Efimenko et al. 2005; Chen et al. 2006). In human, the L1 regulatory motif that is similar to X box is most highly enriched regulatory motif in the genome (Xie et al. 2007). In addition to the canonical X-box promoter motif, genes expressed in ciliated cell types may have half an X box, a modified X box, or as of yet unidentified regulatory elements in their promoters (Piasecki et al. 2010). Given the multiplicity of X boxes, noncanonical X boxes, and RFX TFs, how is ciliary gene expression temporally and spatially regulated? DAF-19C target genes contain authentic X-box motif in the proximal promoter region (GTHNYY AT RRNAAC within 250 bp from the start codon) (Efimenko et al. 2005; Senti and Swoboda 2008). However, DAF-19M isoform target genes do not have a canonical, half, or modified X box in their promoters. In a similar scenario, FKH-2, the C. elegans homolog of Foxj1, the master regulator of motile cilia in mammals, is required for the specialization of AWB cilia, regulated by daf-19, but does not contain an X box in its promoter (Mukhopadhyay et al. 2007). Hence, the daf-19 locus might regulate target genes in different ways: generic cilia development genes may be directly regulated by DAF-19C via binding to X-box motif, whereas the cilia specialization genes may be directly regulated by DAF19 via unidentified promoter motifs or indirectly regulated by DAF-19 through TF cascades. In the HOB neuron, the EGL-46 zinc finger TF acts upstream of daf-19m to control PKD gene battery expression. In other PKD neurons (IL2s, CEMs, and RnBs), egl-46 plays no apparent role in daf-19m or PKD gene battery regulation. EGL-46 shares sequence similarity with mouse Insm1, a zinc finger TF essential or pancreatic islet cell development (Gierl et al. 2006). Intriguingly, Rfx6 is coexpressed with Insm1 in mouse embryonic E15.5 pancreas (Soyer et al. 2010). In the mouse pancreas, Rfx6 is not required for ciliogenesis or expression of cilia genes (Smith et al. 2010). Rather, authors propose that Rfx3 and Rfx6 heterodimer or Rfx6 homodimer may regulate genes involved in islet development, but not ciliogenesis (Smith et al. 2010). The epistatic relationship between Rfx6 and Insm1 in mouse is not known. Given the relative simplicity of C. elegans, the identification of daf-19m direct targets, PKD gene battery cis-regulatory elements, and PKD gene battery direct regulators will reveal how ciliated cells are molecularly programmed to generate a functionally specialized cilium. DAF-19M shares the conserved DBD and DIM domains with known DAF-19 isoforms. RFX homo- or heterodimer formation may transcriptionally activate or repress different sets of genes according to cell typespecific functional requirements. The RFX1 DIM domain may play a repressive function (Katan et al. 1997). For example, the Saccharomyces cerevisiae RFX CRT1

1305

functions as a transcriptional repressor in a DNA damage and replication block checkpoint pathway (Huang et al. 1998). The DIM domain is not required for daf-19c or daf-19m function in ciliogenesis or sensory gene expression in PKD neurons, respectively. However, pan-neural expression of DAF-19MDDIM ectopically activates PKD-2TGFP expression and localization in IL2 neurons, suggesting the DIM domain may have repressor function in this neuronal context. The four isoforms of daf-19 use distinct promoters for distinct spatial and temporal regulation, yet differ only slightly in amino-terminal sequence. DAF-19A and DAF-19B differ in only 25 amino acids, although the function of the two has not been separated. DAF-19C and DAF-19M have only 22 and 11 unique amino acids, respectively. At present, we do not know the role of these short, unique N-terminal sequences in DAF-19 regulation or function, nor do we know the function of the daf-19m 59-UTR on mRNA stability or translation. The IL2 and CEM neurons are born during embryogenesis, whereas the tail HOB and RnB neurons are born during the fourth larval (L4) stage before adulthood. daf-19m and the PKD gene battery are not expressed in CEM neurons until the late L4 stage. Expression of the daf-19m isoform is spatially regulated by two hierarchal cis-regulatory elements. An internal promoter activates daf-19m expression in RnB and HOB neurons after ray and hook sensilla development. Adding a remote enhancer element to the RnB/HOB promoter drives daf-19m expression in IL2 and CEM head neurons. The CEM/IL2 enhancer sequences are AT enriched. An ARID family TF CFI-1 (CEM neuron Fate Inhibition 1) binds to an AT rich region and is required for the CEM fate inhibition (Shaham and Bargmann 2002). However, cfi-1 is not required for pkd-2 expression in CEM neurons (Shaham and Bargmann 2002). Identifying the TFs that activate daf-19m, daf-19m direct targets, and PKD gene battery regulators will reveal how a cilium is specialized in form and function. We thank H. R. Horvitz, in whose lab the n4132 mutant was isolated; P. Swoboda and G. Senti for sharing unpublished data and stimulating discussions; P. Anderson, J. Kimble, Q. Mitrovich, and P. W. Sternberg for critical intellectual input in the early stages of this work; Barr and Swoboda lab members for constructive criticism of the manuscript; A. Hart, M. Leroux, D. Riddle, P. W. Sternberg, and the Caenorhabditis Genetics Center, which is funded by the National Institutes of Health (NIH) National Center for Research Resources (NCRR) for strains. We also thank the two anonymous reviewers for constructive criticism and valuable experimental suggestions. This research was supported by grants from the Polycystic Kidney Disease Foundation (to J.W.) and NIH/National Institute of Diabetes and Digestive and Kidney Diseases (to M.M.B.).

LITERATURE CITED Aftab, S., L. Semenec, J. S. Chu and N. Chen, 2008 Identification and characterization of novel human tissue-specific RFX transcription factors. BMC Evol. Biol. 8: 226.

1306


Ashique, A. M., Y. Choe, M. Karlen, S. R. May, K. Phamluong et al., 2009 The Rfx4 transcription factor modulates shh signaling by regional control of ciliogenesis. Sci. Signal. 2: ra70. Bae, Y. K., and M. M. Barr, 2008 Sensory roles of neuronal cilia: cilia development, morphogenesis, and function in C. elegans. Front. Biosci. 13: 5959–5974. Bae, Y. K., H. Qin, K. M. Knobel, J. Hu, J. L. Rosenbaum et al., 2006 General and cell-type specific mechanisms target TRPP2/PKD-2 to cilia. Development 133: 3859–3870. Barr, M. M., and P. W. Sternberg, 1999 A polycystic kidney-disease gene homologue required for male mating behaviour in C. elegans. Nature 401: 386–389. Barr, M. M., J. DeModena, D. Braun, C. Q. Nguyen, D. H. Hall et al., 2001 The Caenorhabditis elegans autosomal dominant polycystic kidney disease gene homologs lov-1 and pkd-2 act in the same pathway. Curr. Biol. 11: 1341–1346. Beckers, A., L. Alten, C. Viebahn, P. Andre and A. Gossler, 2007 The mouse homeobox gene noto regulates node morphogenesis, notochordal ciliogenesis, and left right patterning. Proc. Natl. Acad. Sci. USA 104: 15765–15770. Blacque, O. E., E. A. Perens, K. A. Boroevich, P. N. Inglis, C. Li et al., 2005 Functional genomics of the cilium, a sensory organelle. Curr. Biol. 15: 935–941. Bonnafe, E., M. Touka, A. AitLounis, D. Baas, E. Barras et al, 2004 The transcription factor RFX3 directs nodal cilium development and left-right asymmetry specification. Mol. Cell. Biol. 24: 4417–4427. Brenner, S., 1974 The genetics of Caenorhabditis elegans. Genetics 77: 71–94. Brown, C. T., Y. Xie, E. H. Davidson and R. A. Cameron, 2005 Paircomp, FamilyRelationsII and cartwheel: tools for interspecific sequence comparison. BMC Bioinformatics 6: 70. Burket, C. T., C. E. Higgins, L. C. Hull, P. M. Berninsone and E. F. Ryder, 2006 The C. elegans gene dig-1 encodes a giant member of the immunoglobulin superfamily that promotes fasciculation of neuronal processes. Dev. Biol. 299: 193–205. Cavalier-Smith, T., 1978 The evolutionary origin and phylogeny of microtubules, mitotic spindles and eukaryote flagella. BioSystems 10: 93–114. Chasnov, J. R., W. K. So, C. M. Chan and K. L. Chow, 2007 The species, sex, and stage specificity of a Caenorhabditis sex pheromone. Proc. Natl. Acad. Sci. USA 104: 6730–6735. Chen, N., A. Mah, O. E. Blacque, J. Chu, K. Phgora et al., 2006 Identification of ciliary and ciliopathy genes in Caenorhabditis elegans through comparative genomics. Genome Biol. 7: R126. Choi, J., and A. P. Newman, 2006 A two-promoter system of gene expression in C. elegans. Dev. Biol. 296: 537–544. Chu, J. S., D. L. Baillie and N. Chen, 2010 Convergent evolution of RFX transcription factors and ciliary genes predated the origin of metazoans. BMC Evol. Biol. 10: 130. Colbert, H. A., T. L. Smith and C. I. Bargmann, 1997 OSM-9, a novel protein with structural similarity to channels, is required for olfaction, mechanosensation, and olfactory adaptation in Caenorhabditis elegans. J. Neurosci. 17: 8259–8269. Collet, J., C. A. Spike, E. A. Lundquist, J. E. Shaw and R. K. Herman, 1998 Analysis of osm-6, a gene that affects sensory cilium structure and sensory neuron function in Caenorhabditis elegans. Genetics 148: 187–200. Davuluri, R. V., Y. Suzuki, S. Sugano, C. Plass and T. H. Huang, 2008 The functional consequences of alternative promoter use in mammalian genomes. Trends Genet. 24: 167–177. Dubruille, R., A. Laurencon, C. Vandaele, E. Shishido, M. Coulon-Bublex et al., 2002 Drosophila regulatory factor X is necessary for ciliated sensory neuron differentiation. Development 129: 5487–5498. Efimenko, E., K. Bubb, H. Y. Mak, T. Holzman, M. R. Leroux et al., 2005 Analysis of xbx genes in C. elegans. Development 132: 1923–1934. El Zein, L., A. Ait-Lounis, L. Morle, J. Thomas, B. Chhin et al., 2009 RFX3 governs growth and beating efficiency of motile cilia in mouse and controls the expression of genes involved in human ciliopathies. J. Cell Sci. 122: 3180–3189. Emery, P., B. Durand, B. Mach and W. Reith, 1996 RFX proteins, a novel family of DNA binding proteins conserved in the eukaryotic kingdom. Nucleic Acids Res. 24: 803–807.

Gajiwala, K. S., H. Chen, F. Cornille, B. P. Roques, W. Reith et al., 2000 Structure of the winged-helix protein hRFX1 reveals a new mode of DNA binding. Nature 403: 916–921. Gierl, M. S., N. Karoulias, H. Wende, M. Strehle and C. Birchmeier, 2006 The zinc-finger factor Insm1 (IA-1) is essential for the development of pancreatic beta cells and intestinal endocrine cells. Genes Dev. 20: 2465–2478. Gresh, L., E. Fischer, A. Reimann, M. Tanguy, S. Garbay et al., 2004 A transcriptional network in polycystic kidney disease. EMBO J. 23: 1657–1668. Hobert, O., 2002 PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic C. elegans. BioTechniques 32: 728–730. Hodgkin, J., 1983 Male phenotypes and mating efficiency in Caenorhabditis elegans. Genetics 103: 43–64. Huang, M., Z. Zhou and S. J. Elledge, 1998 The DNA replication and damage checkpoint pathways induce transcription by inhibition of the Crt1 repressor. Cell 94: 595–605. Jauregui, A. R., K. C. Nguyen, D. H. Hall and M. M. Barr, 2008 The Caenorhabditis elegans nephrocystins act as global modifiers of cilium structure. J. Cell Biol. 180: 973–988. Jekely, G., and D. Arendt, 2006 Evolution of intraflagellar transport from coated vesicles and autogenous origin of the eukaryotic cilium. Bioessays 28: 191–198. Katan, Y., R. Agami and Y. Shaul, 1997 The transcriptional activation and repression domains of RFX1, a context-dependent regulator, can mutually neutralize their activities. Nucleic Acids Res. 25: 3621–3628. Knobel, K. M., E. M. Peden and M. M. Barr, 2008 Distinct protein domains regulate ciliary targeting and function of C. elegans PKD2. Exp. Cell Res. 314: 825–833. Kozminski, K. G., P. L. Beech and J. L. Rosenbaum, 1995 The Chlamydomonas kinesin-like protein FLA10 is involved in motility associated with the flagellar membrane. J. Cell Biol. 131: 1517–1527. Lints, R., and S. W. Emmons, 1999 Patterning of dopaminergic neurotransmitter identity among Caenorhabditis elegans ray sensory neurons by a TGFbeta family signaling pathway and a hox gene. Development 126: 5819–5831. Lints, R., L. Jia, K. Kim, C. Li and S. W. Emmons, 2004 Axial patterning of C. elegans male sensilla identities by selector genes. Dev. Biol. 269: 137–151. Liu, K. S., and P. W. Sternberg, 1995 Sensory regulation of male mating behavior in Caenorhabditis elegans. Neuron 14: 79–89. Liu, Y., N. Pathak, A. Kramer-Zucker and I. A. Drummond, 2007 Notch signaling controls the differentiation of transporting epithelia and multiciliated cells in the zebrafish pronephros. Development 134: 1111–1122. Malone, E. A., and J. H. Thomas, 1994 A screen for nonconditional dauer-constitutive mutations in Caenorhabditis elegans. Genetics 136: 879–886. Marshall, W. F., and S. Nonaka, 2006 Cilia: tuning in to the cell’s antenna. Curr. Biol. 16: R604–R614. Miller, R. M., and D. S. Portman, 2010 A latent capacity of the C. elegans polycystins to disrupt sensory transduction is repressed by the single-pass ciliary membrane protein CWP-5. Dis. Model. Mech. 3: 441–450. Mukhopadhyay, S., Y. Lu, H. Qin, A. Lanjuin, S. Shaham et al., 2007 Distinct IFT mechanisms contribute to the generation of ciliary structural diversity in C. elegans. EMBO J. 26: 2966– 2980. Nathoo, A. N., R. A. Moeller, B. A. Westlund and A. C. Hart, 2001 Identification of neuropeptide-like protein gene families in Caenorhabditis elegans and other species. Proc. Natl. Acad. Sci. USA 98: 14000–14005. Peden, E., E. Kimberly, K. Gengyo-Ando, S. Mitani and D. Xue, 2007 Control of sex-specific apoptosis in C. elegans by the BarH homeodomain protein CEH-30 and the transcriptional repressor UNC-37/Groucho. Genes Dev. 21: 3195–3207. Peden, E. M., and M. M. Barr, 2005 The KLP-6 kinesin is required for male mating behaviors and polycystin localization in Caenorhabditis elegans. Curr. Biol. 15: 394–404. Perkins, L. A., E. M. Hedgecock, J. N. Thomson and J. G. Culotti, 1986 Mutant sensory cilia in the nematode Caenorhabditis elegans. Dev. Biol. 117: 456–487.

Ciliary Specialization in C. elegans Piasecki, B. P., J. Burghoorn and P. Swoboda, 2010 Regulatory factor X (RFX)-mediated transcriptional rewiring of ciliary genes in animals. Proc. Natl. Acad. Sci. USA 107: 12969–12974. Portman, D. S., and S. W. Emmons, 2004 Identification of C. elegans sensory ray genes using whole-genome expression profiling. Dev. Biol. 270: 499–512. Reith, W., C. Herrero-Sanchez, M. Kobr, P. Silacci, C. Berte et al., 1990 MHC class II regulatory factor RFX has a novel DNA-binding domain and a functionally independent dimerization domain. Genes Dev. 4: 1528–1540. Reith, W., C. Ucla, E. Barras, A. Gaud, B. Durand et al., 1994 RFX1, a transactivator of hepatitis B virus enhancer I, belongs to a novel family of homodimeric and heterodimeric DNAbinding proteins. Mol. Cell. Biol. 14: 1230–1244. Satir, P., and S. T. Christensen, 2007 Overview of structure and function of mammalian cilia. Annu. Rev. Physiol. 69: 377–400. Scholey, J. M., 2008 Intraflagellar transport motors in cilia: moving along the cell’s antenna. J. Cell Biol. 180: 23–29. Scholey, J. M., and K. V. Anderson, 2006 Intraflagellar transport and cilium-based signaling. Cell 125: 439–442. Schwartz, H. T., and H. R. Horvitz, 2007 The C. elegans protein CEH-30 protects male-specific neurons from apoptosis independently of the bcl-2 homolog CED-9. Genes Dev. 21: 3181–3194. Senti, G., and P. Swoboda, 2008 Distinct isoforms of the RFX transcription factor DAF-19 regulate ciliogenesis and maintenance of synaptic activity. Mol. Biol. Cell 19: 5517–5528. Senti, G., M. Ezcurra, J. Lobner, W. R. Schafer and P. Swoboda, 2009 Worms with a single functional sensory cilium generate proper neuron-specific behavioral output. Genetics 183: 595– 605, 1SI-3SI. Shaham, S., and C. I. Bargmann, 2002 Control of neuronal subtype identity by the C. elegans ARID protein CFI-1. Genes Dev. 16: 972–983. Silverman, M. A., and M. R. Leroux, 2009 Intraflagellar transport and the generation of dynamic, structurally and functionally diverse cilia. Trends Cell Biol. 19: 306–316. Simon, J. M., and P. W. Sternberg, 2002 Evidence of a mate-finding cue in the hermaphrodite nematode Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 99: 1598–1603. Sloboda, R. D., and J. L. Rosenbaum, 2007 Making sense of cilia and flagella. J. Cell Biol. 179: 575–582. Smith, S. B., H. Q. Qu, N. Taleb, N. Y. Kishimoto, D. W. Scheel et al., 2010 Rfx6 directs islet formation and insulin production in mice and humans. Nature 463: 775–780.

1307

Soyer, J., L. Flasse, W. Raffelsberger, A. Beucher, C. Orvain et al., 2010 Rfx6 is an Ngn3-dependent winged helix transcription factor required for pancreatic islet cell development. Development 137: 203–212. Sulston, J. E., D. G. Albertson and J. N. Thomson, 1980 The Caenorhabditis elegans male: postembryonic development of nongonadal structures. Dev. Biol. 78: 542–576. Swoboda, P., H. T. Adler and J. H. Thomas, 2000 The RFX-type transcription factor DAF-19 regulates sensory neuron cilium formation in C. elegans. Mol. Cell 5: 411–421. Thomas, J., L. Morle, F. Soulavie, A. Laurencon, S. Sagnol et al., 2010 Transcriptional control of genes involved in ciliogenesis: a first step in making cilia. Biol. Cell 102: 499–513. Ward, S., N. Thomson, J. G. White and S. Brenner, 1975 Electron microscopical reconstruction of the anterior sensory anatomy of the nematode Caenorhabditis elegans. J. Comp. Neurol. 160: 313– 337. Ware, R. W., D. Clark, K. Crossland and R. L. Russell, 1975 The nerve ring of the nematode Caenorhabditis elegans: sensory input and motor output. J. Comp. Neurol. 162: 71–110. White, J. Q., T. J. Nicholas, J. Gritton, L. Truong, E. R. Davidson et al., 2007 The sensory circuitry for sexual attraction in C. elegans males. Curr. Biol. 17: 1847–1857. Xie, X., T. S. Mikkelsen, A. Gnirke, K. Lindblad-Toh, M. Kellis et al., 2007 Systematic discovery of regulatory motifs in conserved regions of the human genome, including thousands of CTCF insulator sites. Proc. Natl. Acad. Sci. USA 104: 7145–7150. Yu, H., R. F. Pretot, T. R. Burglin and P. W. Sternberg, 2003 Distinct roles of transcription factors EGL-46 and DAF19 in specifying the functionality of a polycystin-expressing sensory neuron necessary for C. elegans male vulva location behavior. Development 130: 5217–5227. Yu, X., C. P. Ng, H. Habacher and S. Roy, 2008 Foxj1 transcription factors are master regulators of the motile ciliogenic program. Nat. Genet. 40: 1445–1453. Zhang, D., D. C. Zeldin and P. J. Blackshear, 2007 Regulatory factor X4 variant 3: a transcription factor involved in brain development and disease. J. Neurosci. Res. 85: 3515–3522.

Communicating editor: J. Engebrecht

GENETICS Supporting Information http://www.genetics.org/cgi/content/full/genetics.110.122879/DC1

Functional Specialization of Sensory Cilia by an RFX Transcription Factor Isoform

Juan Wang, Hillel T. Schwartz and Maureen M. Barr

Copyright Ó 2010 by the Genetics Society of America DOI: 10.1534/genetics.110.122879

2 SI

J. Wang et al.

FIGURE S1.—Both wild type (+) and n4132 animals are able to uptake lipophilic fluorescent dye DiI through IL2 and amphid cilia. Arrowheads point to IL2 cell bodies and brackets indicated amphid cell bodies.

J. Wang et al.

3 SI

FIGURE S2.—Three-way analysis of interspecific daf-19 sequences using FamilyRelationshipII. C. elegans daf-19 (Cedaf-19) sequence from GCGTTTCGTAGA to TAAATAAAAATT (F33H1 15735 to 17838 nt) is used, whose function was tested first by attaching to P1daf-19m::GFP reporter to make Pdaf-19m::GFP reporter (also see Figure 6). 23.6 Kb Cbdaf-19 and 19.7 Kb Crdaf-19 sequences were downloaded from Wormbase (www.wormbase.org) . Boxes in Cedaf-19 indicate positions of the conserved elements. The four DNA elements were then attached to P1daf-19m::GFP to test function, with the fourth element TTCTTAATTTTTTTATAATT being the only functional requirement.

4 SI

J. Wang et al.

FIGURE S3.— Distinct cellular localization of DAF-19m::GFP and PKD-2::GFP. A. DAF-19m::GFP resides in exclusively in the nucleus. B. PKD-2::GFP localizes to cell bodies and cilia, arrows point to cilia. Note nuclear exclusion of PKD-2::GFP in cell bodies (arrowheads). C. DAF-19m::GFP + PKD-2::GFP. Arrowheads point to the nuclear area, which is clear in panel B, filled with DAF-19M in panel C.

J. Wang et al.

5 SI

TABLE S1 Transgenic and mutant strain list used in this study Strain

Description

Ref

MT13057

nIs133 I; him-5(e1467ts) V; n4132

Hillel Schwartz and H.R. Horvitz

PT1727

daf-19 (n4132)II; him-5(e1490)V

This study

PT1725

daf-19 (n4132)II; pha-1(e2123ts)III; him-5(e1490)V

This study

PT1726

daf-19 (n4132)II; pha-1(e2123ts)III; myIs4[PKD-2::GFP +ccGFP] him-5(e1490)V

This study

PT1770

daf-19 (n4132)II; pha-1(e2123ts)III; him-5(e1490)V; syEx301[lov-1::GFP1+ pBX1]

This study

PT1771

daf-19 (n4132)II; pha-1(e2123) III; him-5(e1490) V; myEx256[Posm-5::gfp+ pBX1]

This study

PT1772

daf-19 (n4132)II; pha-1(e2123) III; him-5(e1490) V; myEx4[DAF-10::GFP+ pBX1]

This study

PT1773

daf-19 (n4132)II; him-5(e1490) V; nxEx1[Pbbs-1::GFP + dpy-5(+)]

This study

PT1774

daf-19 (n4132)II; him-5(e1490) V; nxEx2[Pbbs-2::GFP + dpy-5(+)]

This study

PT1734

daf-19 (n4132)II; him-5(e1490), mnIs17[OSM-6::gfp; unc-36(+)] V

This study

PT1731

daf-19 (m86)II; him-5(e1490)V

This study

PT1777

daf-19 (n4132)II;him5(e1490)V; rtEx277 [Pnlp-8::GFP +lin-15(+)]

This study

PT1778

daf-19 (n4132)II; chIs1200 [ceh-26::GFP + dpy-20(+)]III; him-5(e1490)V; Is[ceh-26::GFP]

This study

PT1750

daf-19 (n4132)II; pha-1(e2123ts)III; myIs4[him-5(e1490)V; myEx633[PCR1+pBX1]

This study

PT1779

daf-19 (n4132)II; pha-1(e2123ts)III; myIs4 him-5(e1490)V; myEx634[PCR2+pBX1]

This study

PT1780

daf-19 (n4132)II; pha-1(e2123ts)III; him-5(e1490), myIs4V; myEx635[PCR3+pBX1]

This study

PT1781

daf-19 (n4132)II; pha-1(e2123ts)III; him-5(e1490), myIs4 V; myEx636[PCR4+pBX1]

This study

PT1783

pha-1(e2123) III; him-5(e1490) V; myEx637[P1daf-19m::GFP+pBX1]

This study

PT1784


This study

PT1785


This study

PT1786


This study

PT1787


This study

PT1764

him-5(e1490)V; myEx642[Posm-9::GFP+ccGFP]

This study

PT1766

daf-19 (n4132)II; him-5(e1490) V; myEx642[Posm-9::GFP+ ccGFP]

This study

PT1768

daf-19 (86)II; him-5(e1490)V; myEx642[Posm-9::GFP+ccGFP]

This study

PT1788

daf-19 (n4132)II; him-5(e1490)V; lin-15(n765) X; adEx1262[gcy-5::GFP+ lin-15(+)]

This study

PT1789

daf-19 (n4132)II; him-5(e1490)V; lin-15(n765) X; adEx1295[gcy-32::GFP+ lin-15(+)]

This study

PT2080

pha-1; myEx683[Punc-119::DAF-19m::GFP]

This study

PT2081

pha-1; myEx684[Pdaf-19m::GFP]

This study

PT2082

pha-1; egl-46; myEx684[Pdaf-19m::GFP]

This study

PT658

lov-1(sy582)II; pkd-2(sy606)IV; him-5(e1490) V

Barr 1999

PS622

dpy-17(e164) III; him-5(e1490) V

Brenner 1974

PS3149

pha-1(e2123ts) III; him-5(e1490) V; syEx301[lov-1::GFP1+pBX1]

Barr 1999

CB444

unc-52(e444) II

Brenner 1974

PT2

pha-1(e2123ts) III; him-5(e1490) V; myEx256(Posm-5::gfp)

Qin 2001

PT26

pha-1(e2123ts); him-5(e1490); myEx4[pBX1+ DAF-10::GFP]

Qin 2001

General strains

6 SI

J. Wang et al.

MX1

dpy-5(e907) I; nxEx1 [Pbbs-1::GFP + dpy-5(+)]

Michel Leroux

MX2

dpy-5(e907) I; nxEx2[Pbbs-2::GFP + dpy-5(+)]

Michel Leroux

DR103

dpy-10(e128) unc-4(e120) II

Varkey 1993

CB4077

eDf21 / mnC1 dpy-10(e128) unc-52(e444) II

Shen 1988

SP354

unc-4(e120) mnDf71 / mnC1 dpy-10(e128) unc-52(e444) II

Sigurdson 1984

Sp429

mnDf25 / mnC1 dpy-10(e128) unc-52(e444) II

Sigurdson 1984

SP540


Sigurdson 1984

SP542


Sigurdson 1984

MB5

lin-15(ts); him5(e1490); rtEx277[Pnlp-8::GFP+lin-15(+)]

Yu 2003

JT190

daf-19(sa190ts) II

Swoboda 2000

JT6824

daf-19(sa232ts) II

Swoboda 2000

DR431

daf-19(m86) / mnC1 dpy-10(e128) unc-52(e444) II

Swoboda 2000

PS3380

him-5(e1490), mnIs17[OSM-6::gfp+unc-36(+)] V

Collet 1998

TB1225

chIs1200[ceh-26::GFP + dpy-20(+)]III; him-5(e1490)V

Yu 2003

DA1262

lin-15(n765) X; adEx1262[gcy-5::GFP+ lin-15(+)]

Yu 1997

DA1295

lin-15(n765) X; adEx1295[gcy-32::GFP+ lin-15(+)]

Yu 1997

J. Wang et al.

7 SI

TABLE S2 Primers, templates, vectors used for PCR fragments and plasmids in this study

CWP-1::GFP

5' primer

3' primer

template

5’-catgacgacaaagcggatca-3’

5’-ttctcctttactgaatttctta

him-5 genomic DNA

gaggcgagaaggc-3’ 5’-ctctaagaaattcagtaaag

5’-caaacccaaaccttcttccg-3’

pPD95.75

5’-gagtcgacctgcaggcatagag

B0229

gagaagaacttttcac-3’ Posm-9::GFP

5’-aaagtcgaggcttgctccc-3’

ccaagatatgggcgg-3’ 5’-ccgcccatatcttggctcta

5’-gccatcgccaattggagtat-3’

pPD95.75

tgcctgcaggtcgactct-3’ PCR1

5’-gattccgacgttggctttcg-3’

5’-caagatggaacgggagac-3’

F33H1 cosmid

PCR2

5’-gcgtttcgtagaacaactac-3’


F33H1 cosmid

PCR3

5’-cacctgacaccgttttgagc-3’


F33H1 cosmid

PCR4

5’-cacctgacaccgttttgagc-3’


n4132 genomic DNA

P1daf-19m::GFP

5’-gaatgcatgcggttcacaa

5’-gaagtcgacaagccac

F33H1 cloned to pPD95.75

ctaacctggatag-3’

ctgctctcgggtt-3’

5’-gaatgcatgcggttcacaa

5’-gaagtcgacaagccac

n4132 DNA cloned to

ctaacctggatag-3’

ctgctctcgggtt-3’

pPD95.75

5’-cagaattcttaatttttttataat


P1daf-19m::GFP

5’-gaatgcatgcggttcacaact

5’-cggtgatgagtcccgagcgcgc

P1daf-19m::GFP

aacctggatag-3’

ccatagtttcaacaag-3’

5’-cttgttgaaactatgggcgcgct


P1daf-19m::GFP


P4daf-19m::GFP

5’-gaatgcatgcgtttcgtagaac

5’-gttgcatgcgcaccccctgcaag

F33H1 cloned to P1daf-

aactac-3’

ccaatc-3’

19m::GFP

P2daf-19m::GFP P3daf-19m::GFP

tgcagccatcacaagccaca-3’ P4daf-19m::GFP

cgggactcatcaccg-3’ P5daf-19m::GFP

5’-cagaattcttaatttttttataattg cagccatcacaagccaca-3’

Pdaf-19m::GFP

To make the PCR-SOE reporter, primer 1 and 2 were paired with template 1, primer 3 and 4 were paired with template 2; in the second round, primer 1 and 4 were paired with template made by mixing same molar concentration of products of the two first round PCR.

8 SI

J. Wang et al.

SUPPORTING REFERENCES 1. Barr MM, Sternberg PW (1999) A polycystic kidney-disease gene homologue required for male mating behaviour in C. elegans. Nature 401: 386-389. 2. Brenner S (1974) The genetics of Caenorhabditis elegans. Genetics 77, 71-94. 3. Qin H, Rosenbaum JL, Barr MM (2001) An autosomal recessive polycystic kidney disease gene homolog is involved in intraflagellar transport in C. elegans ciliated sensory neurons. Curr Biol. 11: 457-61. 4. Yu S, Avery L, Baude E, Garbers DL (1997) Guanylyl cyclase expression in specific sensory neurons: a new family of chemosensory receptors. Proc Natl Acad Sci U S A. 94: 3384-7. 5. Varkey JP, Jansma PL, Minniti AN, Ward S (1993) The Caenorhabditis elegans spe-6 gene is required for major sperm protein assembly and shows 2nd site noncomplementation with an unlinked deficiency. Genetics 133: 79-86. 6. Shen MM, Hodgkin J (1988) mab-3, a gene required for sex-specific yolk protein expression and a male-specific lineage in C. elegans. Cell 54: 1019-31. 7. Sigurdson DC, Spanier GJ and Herman RK (1984) C. elegans deficiency mapping. Genetics 108: 331-345. 8. Yu H, Pretot RF, Burglin TR, Sternberg PW (2003) Distinct roles of transcription factors EGL-46 and DAF-19 in specifying the functionality of a polycystin-expressing sensory neuron necessary for C. elegans male vulva location behavior. Development. 130: 5217-27. 9. Swoboda P, Adler HT, Thomas JH (2000) The RFX-type transcription factor DAF-19 regulates sensory neuron cilium formation in C. elegans. Mol Cell 5: 411-421. 10. Collet J, Spike CA, Lundquist EA, Shaw JE, Herman RK (1998) Analysis of osm-6, a gene that affects sensory cilium structure and sensory neuron function in Caenorhabditis elegans. Genetics. 148: 187–200.