Plant Pathology (2015) 64, 638–647
Doi: 10.1111/ppa.12301
Evaluation of Malaysian oil palm progenies for susceptibility, resistance or tolerance to Fusarium oxysporum f. sp. elaeidis and defence-related gene expression in roots M. H. Rusliab, A. S. Idrisb and R. M. Coopera* a
Department of Biology and Biochemistry, University of Bath, Bath, BA2 7AY, UK; and bMalaysian Palm Oil Board (MPOB), No. 6, Persiaran Institusi, Bandar Baru Bangi, Kajang, 43000 Selangor, Malaysia
Vascular wilt of oil palm caused by Fusarium oxysporum f. sp. elaeidis (Foe) is a devastating disease in West and Central Africa. As the oil palm industry in southeast Asia is still expanding, so is the oil palm germplasm collection through the importation of seed and pollen from Africa, the centre of diversity for Elaeis guineensis. There is a risk of inadvertent spread of the disease on contaminated seed or pollen. Regular re-evaluation of the reaction of currently grown palm genotypes towards Foe is clearly required for biosecurity. This study has demonstrated that four Malaysian oil palm progenies, three in current or recent commercial use, are highly susceptible to infection by at least one of two African isolates of Foe, representing different countries, aggressiveness and vegetative compatibility groups. Symptoms and reduction of palm growth generally reflected the extent and intensity of systemic colonization by Foe. Progeny PK 5463 expressed partial resistance to Foe isolate F3, but not to isolate 16F, displaying significantly milder symptoms and supporting less widespread vascular colonization. This relatively incompatible interaction was used to study expression of potential defence-related genes during root infection when compared to a susceptible palm–isolate combination. The only significant response was an early up-regulation of chitinase in resistant palms. The research revealed at least one progeny–isolate differential interaction, and the associated resistance expression suggests a component of tolerance, because colonization by Foe was systemic in both compatible and incompatible combinations. Keywords: biosecurity, chitinase, defence-related genes, Fusarium oxysporum, oil palm, tolerance
Introduction Currently the only practical method to prevent Fusarium oxysporum f. sp. elaeidis (Foe) in regions where it is does not exist, such as South and Central America, is to avoid accidental introduction from areas where it is endemic. Importation of breeding materials from West and Central Africa is essential to expand genetic diversity in the major oil palm-producing regions of southeast Asia (Soh, 2011). However, this carries a risk because seed and pollen can be infested with Foe (Flood et al., 1990; Cooper, 2011). Localized disease outbreaks have occurred in Brazil and Ecuador following seed shipments from the Ivory Coast; the pathogen isolates were all the same genotype (Flood et al., 1992). Currently all material exported from Africa to Malaysia has to be subjected to quarantine, but the risk of intercontinental spread remains. Therefore, regular re-evaluation of the susceptibility to Foe of palm lines representing those currently grown in producing countries, such as Malaysia, is clearly required and that was one purpose of this study. The responses of four different progenies of oil palms obtained from *E-mail:
[email protected]
Published online 12 October 2014
638
Malaysia towards Foe infection were evaluated. Three decades ago oil palm progenies from Malaysian parents were found to be highly susceptible to the disease when grown in West Africa (Ho et al., 1985). The progenies used in this study were chosen based primarily on genotypes used currently or recently in plantations in Malaysia. In addition, the choice was made to include both susceptible and resistant lines to Foe, based on an earlier evaluation of related crosses made under nursery conditions in West Africa (Durand-Gasselin et al., 2000). The Foe isolates chosen were from two geographically separated countries where the isolates have been used for screening seedling progenies from crosses for disease resistance. The two isolates also differed in aggressiveness and in vegetative compatibility groups (VCG) (Flood et al., 1992; Mepsted et al., 1994a,b). In regions where fusarium wilt is endemic, the only sustainable method for control is by breeding for disease resistant oil palms (Cooper, 2011). Decades of breeding and selection for resistance took place in the Ivory Coast with selection from the 1960s and nursery testing from the 1970s (Renard et al., 1972; Durand-Gasselin et al., 2000). According to Cochard et al. (2005), it is now increasingly difficult to find symptoms in African plantations. Little is known about the nature of resistance of oil palm to Foe. This research attempts also to define the expression of susceptibility and resistance, as reflected by
ª 2014 British Society for Plant Pathology
Susceptibility of oil palms to Fusarium
the extent and intensity of systemic colonization by Foe. Most studies have relied on assessment of external and sometimes internal symptoms, but there have been few attempts to follow critically pathogen colonization, and effects on growth of palm progenies, other than by Flood et al. (1989, 1993). Likewise the genetics of resistance is unclear. Meunier et al. (1979) reported that wilt resistance in oil palm is based on many R genes, but de Franqueville & de Greef (1988) suggest that only two genes are involved and Renard et al. (1993) claimed their data revealed simple segregation of inheritance rather than additive inheritance. The resistance is likely to be polygenically controlled because it appears to be durable, not having been overcome by Foe in the 40 years or so of its development and use in Africa (Cochard et al., 2005). Mechanisms of resistance to any disease in oil palm are still being sought. Mepsted et al. (1995) demonstrated accumulation of unidentified antifungal compounds in xylem fluid in the petioles of a Foe-resistant clone compared to a susceptible clone and Cooper et al. (1996) reported that this coincided with occlusion of fungal infected vessels by gels and tyloses. However, evidence is emerging on expression of defence- and stressrelated genes in oil palm roots, largely in response to basal stem rot caused by Ganoderma boninense. Some of this information has been facilitated by the generation of an EST database (www.ncbi.nlm.nih.gov/genbank/dbest/) (e.g. Ho et al., 2007; Low et al., 2008), although this was created from studies using different tissue types and was largely linked to floral development and in vitro propagation, rather than to defence or stress responses. Tee et al. (2013) found pathogenesis-related protein PR1, isoflavone reductase (IFR) and vicilin-like antimicrobial peptide were differentially regulated following Ganoderma infection. Up-regulation of chitinase genes in roots was reported by Yeoh et al. (2013) and in leaves by Naher et al. (2011), in both cases also in response to Trichoderma harzianum root inoculation. Tan et al. (2013), profiling putative defence-related genes, identified dehydrin, metallothionein-like protein, IFR, BowmanBirk serine protease inhibitor and type 2 ribosome inactivating protein. Metallothioneins (type 3) were also revealed by Alizadeh et al. (2011); however, type 2 metallothioneins were the predominant genes(s) expressed in unchallenged oil palm roots (Ho et al., 2007). In this study, putative defence responses were investigated in two different oil palm progenies that were shown to exhibit susceptibility or partial resistance towards infection by two isolates of Foe. Five candidate defence-related genes, based on defence- or stress-induced genes from oil palm or other monocot species, were used to study the reaction of root cells to Foe: dehydrins, oxalate oxidase, chitinase, 14-3-3 proteins and PR-1. At the time of this study, many of the sequences described above from the Ganoderma research were not described or available. Overall it was aimed to investigate the reaction of Malaysian oil palm genotypes to two aggressive African isolates of Foe, and to examine the nature of resistance or tolerance expressed to Foe. Plant Pathology (2015) 64, 638–647
639
Materials and methods Pathogen isolates, growth and inoculum Two isolates of Foe (Foe 16F and Foe F3) from diseased palms were from Ivory Coast and Democratic Republic of Congo (DRC) respectively. Foe 16F was previously used by Institut de Recherches pour les Huiles et Oleagineux (IRHO) as their fusarium wilt screening isolate (Mepsted et al., 1994a,b). Isolate F3 was used in Zaire (now DRC) as their screening isolate (Mepsted et al., 1994b). In comparative studies, 16F was shown to be more aggressive than F3 (Mepsted et al., 1994a,b) and they belong to different VCGs, 0141 and 014 respectively (Flood et al., 1992). Isolates were stored at 80°C in 20% glycerol then cultured on Czapek–Dox (CD) agar and incubated at 25°C for 5 days. The isolates were subcultured into 100 mL CD liquid medium in 250 mL conical flasks for 3 days, agitated at 150 rpm and 25°C. The fungal suspension was then filtered through Miracloth (Calbiochem) to remove mycelial fragments and the filtrate centrifuged at 13 000 g for 10 min. The sedimented spores were resuspended in 50 mL sterile distilled water and adjusted to 32 9 106 or 6 9 106 spores mL1.
Plant materials The progenies chosen (Table 1) were based on those used currently or recently in some plantations in Malaysia (Dr Md Din Amirrudin, Head of Plant Breeding Group, Malaysian Palm Oil Board (MPOB), personal communication) or, in the case of progeny PK5525, to extend the range of susceptibility to resistance. Seed for each progeny came from individual fruit bunches which had developed following assisted pollination to achieve each specific cross. Oil palm germinated seeds were supplied by MPOB (Table 1). Germinated seeds were transplanted to seed trays (300 9 220 9 50 mm) filled with compost (Levingtons F2 + sand, Levingtons M2, perlite in ratio 1:1:1) and maintained in a controlled environment cabinet at 28°C, 80% RH and 12 h photoperiod, with lighting of 240 lmol m2 s1 photo flux density (PFD). Propagator lids were placed over the trays to maintain a RH of 100%. The RH was reduced after 2 months to c. 80% when the seedlings (2-leaf stage) were transplanted into black polyethylene bags (LBS Horticulture) (89 9 178 9 178 cm containing 12 L compost) and transferred to the glasshouse. Conditions in the glasshouse were maintained with shading and artificial lights (Camplex 500 W metal halide). Light levels were maintained between 800 and 500 lmol m2 s1 with a day length of 14–17 h; RH and temperature ranged from 60 to 90% and 23 to 35°C respectively. After 3 months, the palms were transferred into larger black polyethylene bags (152 9 1254 9 254 cm). The palms within each treatment were randomized between troughs. Palms were fed monthly with liquid fertilizer (BHGS; 1 in 45 dilution, containing N, P, K 8:3:3 and trace elements). Compost pH ranged from 50 at the beginning of the experiment to 64 after 6 months. Plants were watered from below on alternate days.
Plant inoculation with Foe to evaluate genotype susceptibility Ten millilitres of a suspension of 6 9 106 conidia mL1 was applied with a sterile syringe onto the soil surface around the
640
M. H. Rusli et al.
Table 1 Oil palm progenies obtained from Malaysia Progeny code
Parental background
PK5506 PK5463 PK5493 PK5525
Dura Dura Dura Dura
9 9 9 9
Fusarium wilt statusa
Genetic crosses
Pisifera Pisifera Pisifera Pisifera
Dumpy Elmina Dumpy Serdang Johor Labis
Avros Avros La Me Yangambi
Resistant Resistant Susceptible Resistant
a
Status of tolerance/resistance and susceptibility of the progeny backgrounds to Fusarium oxysporum f. sp. elaeidis as determined by DurandGasselin et al. (2000).
1
2
3
4 cm
4
5
0 Figure 1 Disease wilt index of Fusarium oxysporum f. sp. elaeidis infection of oil palm: 0, no symptoms; 1, slight necrosis/ chlorosis on 1–2 leaf tips, usually oldest leaves; 2, necrosis/chlorosis over one quarter of leaves and some shortening of the youngest leaves; 3, severe necrosis/chlorosis over one half of the leaves, extensive leaf desiccation and stunting; 4, severe necrosis/ chlorosis over three quarters of the leaves of the plant, extensive leaf desiccation and stunting; 5, plant dead.
base of each palm at age 3 months. The inoculum was then watered in with sterile distilled water for 2 weeks. Uninoculated plants served as controls. Each progeny was represented by 10 replicates. All studies with Foe and plant inoculations were conducted in the UK.
Disease assessment Disease severity index Symptoms and disease severity were measured at 5-week intervals using a wilt index from Flood et al. (1989, 1993) as detailed in Figure 1.
Plant height and dry weight At the end of experiments, the growth parameters, plant height and dry weight, were assessed as in Flood et al. (1993). Plant height (cm) was measured from soil level to the apical, fully expanded leaf. The palms were washed twice with tap water before constant dry weight (g) of the aerial parts was determined, following ≥72 h at 80°C in a drying oven.
Colonization of oil palm tissues For qualitative reisolation, 05 cm length samples of inoculated and uninoculated plant materials were taken from cross sections of roots, petioles and leaves (sampled from mid rib of the middle leaf) or from stem core samples (taken with an increment borer, internal diameter 515 cm) (Mepsted et al., 1991; Cooper, 2011). These samples were then surface sterilized in 2% (v/v) sodium hypochlorite for 10 min (5 min for stem tissue cores) before rinsing twice in sterile distilled water (SDW). The materials were then plated onto Fusarium-selective medium (FSM) (Flood et al., 1989, 1993) and incubated for 4 days at 28°C. For quantitative reisolation, 1 g fresh weight of root, bulb, stem and petiole (sampled adjacent to the leaf) tissue was surface sterilized and washed as described above. The tissue was ground using a sterile pestle and mortar with 1 cm3 of sterile sand and 9 mL SDW. A 10-fold dilution series was prepared and 05 mL of the suspension was spread onto each of triplicate plates of FSM. After incubation at 28°C for 4 days, colonies of F. oxysporum were counted and the number of colony-forming units (CFUs) per g fresh weight of palm tissue was calculated.
Plant Pathology (2015) 64, 638–647
Susceptibility of oil palms to Fusarium
Statistical analysis All data were computed and descriptive statistics analysis was performed in order to explore normal distribution for the dependent variables. Multivariate analysis using Tukey’s post hoc test (because of equal group sizes) was then performed for all disease and pathogen assessments, citing significant differences at P ≤ 001 or 005.
Inoculation of roots with Foe for gene expression Progeny PK5463 (shown in this study to be tolerant to one Foe isolate) from the Dumpy and Avros background and progeny PK5525 (shown in this study to be susceptible to both African isolates) from the Johor Labis and Yangambi background were used as 9-month-old seedlings to follow any expression of defencerelated genes, with two replicates from each oil palm line. For root inoculation, half of the oil palm roots were exposed and placed in a plastic container whereas the other half of the roots were kept in compost in order to maintain plant viability (Fig. 2). The exposed roots of the two palm lines PK5463 and PK5525 were then sprayed with 50 mL of 32 9 106 spores mL1 of Foe isolates F3 or 16F respectively. Damp tissue was used to maintain a humid environment in the container with water sprayed regularly to keep the root moist. The container was covered with aluminium foil in order to preserve the humidity and exclude light. The sampling of primary, secondary and tertiary roots was made at 48, 96 and 144 h post-inoculation (hpi). Three samples of roots were taken per plant to provide a representative sample of root tissues, then pooled and subjected immediately to RNA extraction. Two plants were sampled at each time point. As controls, roots of non-infected plants, grown under identical conditions to the infected plants and at the same developmental stage, but exposed to SDW instead of Foe suspension, were sampled.
RNA extraction An adaptation of QIAGEN’s Plant RNeasy Mini kit protocol was used. Changes included adding 1 g mixture of oil palm pri-
(a)
641
mary, secondary and tertiary roots ground with pestle and mortar to 5 mL buffer RLT containing b-mercaptoethanol (10 lL mL1). Samples were vortexed vigorously then left on ice for 30 min with occasional further vortexing. Samples were then centrifuged at 5000 g for 1 min. Supernatants from samples were added to Qiashredder columns and the lysate was collected. A 05 volume of 100% ethanol was added to the lysate samples. QIAGEN’s RNeasy Mini kit protocol was then followed, based on manufacturer’s instructions and this also removed DNA. Sample concentrations (300–1000 lg mL1) were measured with a spectrophotometer (NanoVue Plus; GE Healthcare) and then samples were kept at 80°C until required. RNA was intact, as shown by amplification using reverse transcription (RT)-PCR as well as qPCR.
cDNA libraries and template preparation RT-PCR was conducted in order to determine the presence or absence of targeted genes before proceeding with qPCR quantification. A SuperScript II RT-PCR kit (Invitrogen) was used with 5 lg of total RNA extracted from root samples as the template in order to synthesize cDNAs. Mix 1 (10 lL of 5 lg RNA + dH2O, 1 lL dT17 100 mM (final concentration 5 mM), 1 lL dNTP 100 mM) was prepared and placed in a thermal cycler for 5 min at 65°C and snap-cooled on ice. Mix 2 (4 lL 5 9 first strand buffer, 2 lL DTT (final concentration 10 mM)) was added to mix 1 and placed in a thermal cycler for 2 min at 42°C. While at the 1-h holding time, 1 lL SuperScript II RT enzyme (50 units) was added and followed by incubation at 65°C for 5 min and was left at 4°C overnight. The housekeeping gene used was actin and the cycle number was based on optimization during the study.
PCR amplification PCR was used to amplify sequences from cDNA templates using the appropriate primer pairs described in Table 2. Primers were used with each forward and reverse pair corresponding to a particular plant defence-related gene. PCR thermocycling was car-
(c)
(b) Figure 2 Oil palm root inoculation with Fusarium oxysporum f. sp. elaeidis. A proportion of the roots were separated into plastic containers ensuring incorporation of primary, secondary and tertiary roots (a). Roots were kept moist by the placement of a wet paper towel and spraying regularly with sterile distilled water (b) and then covering with aluminium foil (c). The bulk of the roots, which were not inoculated, were kept in growing medium to maintain vigour and growth of the palms.
Plant Pathology (2015) 64, 638–647
4 cm
642
M. H. Rusli et al.
Table 2 Primers used for defence-related genes and control gene actin, derived mainly from oil palm and other monocot plants Primer name
Primers sequence (50 –30 )
Design basis (GenBank accession)
Reference
P1 P2 Dehydrin F Dehydrin R PR-1F PR-1R OsOXO4 F OsOXO4 R Chitinase F Chitinase R Actin FWD Actin RVS
CCTGATCGTGCGTGCAGTCTTGCT ATCTATGCAGAGGTCACAAGATAG TGCTACGTTCTCCGGG GAATTCCATATGGAGGATGAGAGGAACACGG AGACGCCAGACAAGTCACCGCTAC TCCCTCGAAAGCTCAAGATAGCCC AGCTTGTCACTGCGCTTCTT GTGGCAATCTTGGAGGAGAA CAGACCGGGATTTTCGACTA TTAAGACTGAATTTGGCAAGCA TGTATGCCAGTGGTCGTACCA CCAGCAAGGTCGAGACGAA
14-3-3 (NA)
Yang et al. (2012)
Dehydrin (NA)
Zhai et al. (2011)
PR-1 (AY237110)
Delessert et al. (2005)
Oxalate oxidase (NA)
Carrillo et al. (2009)
Chitinase (NA)
Sathyapriya et al. (2011)
Housekeeping gene (U60480)
Aime et al. (2008)
Sequences for 14-3-3, dehydrin and oxalate oxidase are all from rice; chitinase (acidic Class III) is from oil palm; PR-1 is from Arabidopsis; actin is from tomato. NA, not available.
ried out using a Peltier thermal cycler (PTC-200; MJ Research). PCR products were then separated by ethidium bromide (EtBr)stained agarose gel electrophoresis. An optimum annealing temperature of 50°C was used for 14-3-3, dehydrin, chitinase, PR-1, oxalate oxidase and actin. The optimal cycle number for each gene amplified was 35 cycles and was used throughout. RT-PCR mixes were prepared in sterile 02 mL thin-walled PCR tubes and consisted of approximately 05 lL cDNA template, 25 lL DNA polymerase buffer, 05 lL 10 mM dNTPs, 05 lL 100 lM forward primer, 05 lL 100 lM reverse primer, 05 lL Taq DNA polymerase (Promega) and 20 lL sterile milliQ water. Reactions were cycled in a PTC-200 thermal cycler at 94°C (5 min) and then 35 cycles of 94°C (15 s), 55°C (45 s), 71°C for 1 min 50 s, and a final step of 71°C for 5 min.
Determination by qPCR of defence-related gene expression For quantitative PCR (qPCR) reactions, amplification mixtures (15 lL) contained 500 ng cDNA obtained after the reverse transcription, forward and reverse primers (15 mM each), and 2 9 Fast SYBR Green Master Mix (Applied Biosystem). Reactions were run in the MicroAmp fast well 96-well reaction plate (01 mL) by Applied Biosystems (AB) and covered by optical adhesive covers (AB). The cycling conditions comprised a three-step technique with 10 min polymerase activation at 94°C, 40 cycles at 95°C for 15 s, 55°C for 1 min and 71°C for 1 min, then 71°C for 5 min. Each reaction was performed in duplicate, and the amplification products were examined by ΔΔCt calculation, which analyses changes in gene expression relative to a reference sample using an automated calculation in STEPONE v. 2.1 software (Applied Biosystems). The housekeeping gene actin was used as an endogenous internal control and the cycle number was based on optimization during the study.
Results Determination of tolerance, resistance or susceptibility of four oil palm progenies to Foe infection Symptoms All progenies tested were susceptible to at least one of the African Foe isolates 16F and F3, with gradual dis-
ease progression leading to severe symptoms by 25 weeks (Fig. 3). However, there was evidence of palm genotype–Foe isolate differential interactions, as progeny PK5463 only showed slight necrosis on the oldest leaves after 25 weeks with Foe F3, but was fully susceptible to 16F. PK5493 also showed much-delayed symptoms with F3 compared with 16F. PK5506 and PK5525 were susceptible to both isolates with clear symptoms on older leaves after 10 and 15 weeks respectively. Effect of infection on palm height Fusarium infection caused a decrease in plant height with the more pathogenic isolate, 16F, resulting in a greater mean reduction of 17%. PK5463 inoculated with Foe F3 was the least affected but still showed a significant difference from the uninoculated controls (Fig. 4). No differences in plant height were observed between palm progenies infected with Foe isolate 16F. Effect of infection on palm dry weight Vascular infection also reduced the dry weight of infected plants by 12–60% compared to uninoculated controls (Fig. 5). PK5506 inoculated with Foe F3 was the most affected progeny, which reflected the severity of other disease symptoms. In contrast, PK5463 inoculated with Foe F3 showed the least reduction in dry weight of aerial parts, again echoing the symptom and height analyses. Pathogen colonization Based on qualitative reisolation, Foe isolates invaded systemically, colonizing roots, bulbs, 1st, 3rd and 7th petioles and leaves of progenies PK5525, PK5506, PK5493 and PK5463. However, in progeny PK5463 Foe isolate F3 was absent in petioles and leaves 3 and 7. Colonization of PK5493 leaves by F3 was sporadic and it was not detected in leaves 3 and 7 (Table 3). The occasional detection of Fusarium in non-inoculated palms is likely to come from endophytic Fusarium spp., which have been isolated before from control palms in most trials. These Fusarium isolates were not Foe, as
Plant Pathology (2015) 64, 638–647
Susceptibility of oil palms to Fusarium
4
(b)
5
a (F3)
PK5506
3 a (16F)
2 1
Mean wilt index
Mean wilt index
(a) 5
643
0
4
3 2 b (F3)
1
20 5 0 10 15 25 Time after inoculation (weeks) (d)
5
PK5463
a (16F)
Mean wilt index
Mean wilt index
(c) 5
a (16F)
0
0 5 10 15 20 25 Time after inoculation (weeks) Figure 3 Symptom development in four progenies inoculated with African isolates of Fusarium oxysporum f. sp. elaeidis (Foe). Values represent mean of 10 replicates with each different letter (a or b) denoting significant differences at P ≤ 005 between treatments after 25 weeks. Error bars represent standard error (SE) for each treatment. PK series are the four palm lines and 16F and F3 are the two Foe isolates.
PK5493
4
3 2 1
b (F3)
0 0
PK5525
4 a (16F)
3 2
a (F3)
1 0
5 10 15 20 25 Time after inoculation (weeks)
0 5 10 15 20 25 Time after inoculation (weeks)
200
a
180
Figure 4 The effect of Fusarium oxysporum f. sp. elaeidis (Foe) infection on plant height. Values represent mean of 10 replicates with each different letter denoting significant differences at P < 001 (Tukey) between treatments. Error bars represent standard error (SE) for each treatment. PK series are the four palm lines and 16F and F3 are the two Foe isolates.
Plant height (cm)
160 b
140 120 100
c d
d
80
d
d
60
c
d
40 20 0
PK5525 (16F)
PK5506 (16F)
PK5463 (16F)
PK5493 (16F)
PK5506 (F3)
PK5463 (F3)
PK5493 (F3)
PK5525 (F3)
Control
Figure 5 The effect of Fusarium oxysporum f. sp. elaeidis (Foe) on dry weight of aerial parts. Values represent mean of 10 replicates, with each different letter denoting significant differences at P ≤ 001 (Tukey) between treatments. Error bars represent standard error (SE) for each treatment. PK series are the four palm lines and 16F and F3 are the two Foe isolates.
Plant Pathology (2015) 64, 638–647
Aerial parts dry weight (g)
250 a
200
150 bc
b
bc
100
bc bc
bc
PK5506 (16F)
PK5463 PK5493 PK5506 (16F) (F3) (16F)
50
0
PK5525 (16F)
bc
bc
PK5463 (F3)
PK5493 PK5525 (F3) (F3)
Control
644
M. H. Rusli et al.
Table 3 Qualitative reisolation of Fusarium oxysporum f. sp. elaeidis from inoculated oil palm progenies
Progeny (isolate)
Root tissue
Bulb tissue
Leaf 1/petiole
Leaf 1/middle section
Leaf 3/petiole
Leaf 3/middle section
Leaf 7/petiole
Leaf 7/middle section
PK5525 (16F) PK5506 (16F) PK5463 (16F) PK5493 (16F) PK5506 (F3) PK5463 (F3) PK5493 (F3) PK5525 (F3) Non-inoc.
10 10 10 10 10 10 10 10 3
10 10 10 10 10 10 10 10 2
10 10 10 10 10 10 10 10 0
10 10 10 10 10 6 10 10 0
10 10 10 10 10 0 4 10 0
10 10 10 10 10 0 0 10 0
10 10 10 10 10 0 4 6 0
10 10 10 8 6 0 0 4 0
a a a a a a a a b
a a a a a a a a b
a a a a a a a a b
a a a a a b a a c
a a a a a c b a c
a a a a a b b a b
a a a a a d bc b d
a a a a b d d c d
Figures represent the number of positive reisolations from 10 palms. Treatments with different letters are significantly different (P ≤ 005; Tukey). Non-inoc.: non-inoculated control.
Table 4 Quantitative reisolation of Fusarium oxysporum f. sp. elaeidis from oil palm tissues 25 weeks after inoculation Progeny (isolate) PK5525 (16F) PK5506 (16F) PK5463 (16F) PK5493 (16F) PK5506 (F3) PK5463 (F3) PK5493 (F3) PK5525 (F3) Non-inoc.
Root tissue 15 7 2 2 35 4 15 1
9 9 9 9 9 9 9 9
3
10 c 104 a 103 c 103 c 104 b 101 d 103 c 103 c 04 e
Bulb tissue 4 9 10 b 12 9 103 a 17 9 102 c 8 9 101 d 6 9 102 b 25 9 101 d 65 9 102 b 2 9 102 bc 08 e 2
Leaf 1/petiole 15 2 1 16 2 05 15 1
9 9 9 9 9 9 9 9
2
10 b 102 b 101 c 103 a 102 b 101 c 101 c 102 b 0d
Leaf 3/petiole 3 29 1 1 29
9 9 9 9 9
2
10 b 103 a 102 b 102 b 103 a 0d 05 9 101 c 05 9 102 b 0d
Leaf 7/petiole 9 9 9 9 9
102 a 102 a 102 a 101 b 102 a 0c 05 9 101 b 15 9 102 a 0c
3 12 15 05 15
Numbers refer to colony-forming units g1 tissue fresh weight. n = 10. Each different letter denotes significantly different values at P ≤ 005 (Tukey) between treatments. Non-inoc.: non-inoculated control.
revealed by specific primers (authors’ unpublished data). Endophytic Fusarium species have been recovered from members of many plant families including Palmae (Rodrigues, 1994). Quantitative reisolation (Table 4) shows Foe-colonized palm tissues between 05 9 101 (Foe F3 in petiole 1 of PK5463) and 7 9 104 (16F in roots of PK5506) CFU g1 fresh weight. The colonization by Foe F3 on PK5463 differed significantly from all other treatments (except for PK5493-16F bulb colonization) being at least one order of magnitude less in the bulb (25 9 101 CFU mL1) and the first leaf petiole (05 9 101 CFU mL1). These results coincided with the least effects on plant growth (height and dry weight) of any palm–Foe isolate combination.
expressed at low levels throughout sampling in both progenies, while actin was expressed in both at relatively high levels at all times (data not shown). No transcripts were detectable after amplification of cDNA from defence-related genes 14-3-3 and PR-1 in either palm progeny throughout the sampling period. In order to study quantitatively the response of oil palm seedlings to infection with Foe, the differential responses of remaining target genes were investigated using qPCR. Dehydrin and oxalate oxidase were expressed at low levels (
