life there has been no one as loving, encouraging and humorous as him. ... all your endless love, blessings, prayers, financial and emotional support, and ...
GENE EXPRESSION STUDIES IN CANDIDA ALBICANS by PRIYA UPPULURI, M.S. A DISSERTATION IN MEDICAL MICROBIOLOGY Submitted to the Graduate Faculty of Texas Tech University Health Sciences Center in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY
Advisory Committee LaJean Chaffin (Chairperson) Abdul Hamood Daniel Hardy Michael San Francisco Brandt Schneider Accepted
Roderick Nairn, Ph.D. Dean of the Graduate School of Biomedical Sciences Texas Tech University Health Sciences Center December, 2006
Copyright 2006, Priya Uppuluri
ACKNOWLEDGEMENTS Having reached this significant milestone of completing my doctorate degree, there are many people I would like to thank. The help and support of these people helped make my 5 year journey uneventful and enjoyable. I begin by thanking my father Dr. Autar K. Miskeen, Ph.D (Microbiology). In my life there has been no one as loving, encouraging and humorous as him. I have learnt to appreciate the beauty, necessity, and application of medical microbiology from him. For all your endless love, blessings, prayers, financial and emotional support, and instilling the ‘I – know – I – can’ optimism in me dear papa, I dedicate this dissertation to you. My lonely existence in an alien land found a soul mate, and I changed my name. Nagesh Uppuluri, my husband – an epitome of an ideal man any woman could ask for. His involvement with every aspect of my life makes my every day so much easier. You had a hand (and a brain) in many steps during my PhD, and I thank you for being my rudder so my ship sailed to the shore. As an international student, what I always missed the most was my mothers cooking, cleaning and washing! – activities I took for granted all my life. I thank you mummy for your loving ways and instilling in me, an independent streak. I would next like to thank my brother Puneet who always lifted my spirits on the phone, and assured me that ‘they were not having too much fun without me’. Yes! That did make me feel better bro. I never knew parents-in-law could be an excellent asset to life, until I met mine. It makes me happy to no end, to know of their pride for me having achieved my goal. I am grateful for their kind words, total support, unconditional love and their enthusiasm for everything that I do. Then there is my extended family, my cousins, my aunts and uncles and my grand parents. I am what I am because of you all. You molded my personality, and my life is blessed because I have you.
ii
I consider myself extremely lucky to have had Dr. LaJean Chaffin as my mentor for my doctorate research. Four years of her guidance taught me commitment, good work ethics, and maintenance of high standards in my research work. Her hands off, nopressure approach helped my imagination fly and design my own experiments. Her lab has been bountiful for me both financially and career-wise, and I thank her for her thoughtful nature, patient disposure and her presence for whenever I needed her. I pray I get a boss just like her in whatever job I do in the future. Next, I would like to thank my excellent committee members, Dr Daniel Hardy, Dr. Brandt Schneider, Dr. Michael Sanfrancisco and Dr. Abdul Hamood. They never were any hassle to handle, always gave effective and intelligent suggestions for my research, let me use their labs for equipments and software, and let me graduate on time!! I would especially like to thank Dr. Abdul Hamood. A 10 month rotation in his lab taught me the basics of molecular biology techniques. His hardworking nature and passion for science was infectious, and I hope I never recover! My acknowledgements will not be complete if I do not mention my lab members, Dr. Bhaskarjyoti Sarmah, Dr. Palani Perumal, Satish Mekala and Dr. Gabriel Nkwanyuo. I thank you for letting me get involved in your projects, for effective discussions and for letting me borrow your tip boxes and eppendorf tubes! You guys certainly were a joy to work with. Finally, I thank the faculty members of my department, who made the decision to accept me as a graduate student; who were always warm, kind and helpful. I also thank my friends and fellow graduate students Ganesh Shankarling, Janet Dertein, Shyla Narasimhachar, Dr. Nancy Carty, Dr. Andy Schaber, Dr. Jennifer Gaines, Dr. Revathi Govind, Colby Layton, Matt Fogle, Uma Thippeswmy, Arkadi – all of whom had a large part to play in the smooth running of my projects. My life is under construction, and I thank my architect for being kind and generous.
iii
TABLE OF CONTENTS ACKNOWLEDGEMENTS
ii
ABSTRACT
viii
LIST OF TABLES
x
LIST OF FIGURES
xi
CHAPTER I. INTRODUCTION Candida albicans the pathogen
1
C. albicans polymorphism
2
C. albicans biofilm
3
C. albicans growth and stationary phase
4
C. albicans growth and quorum sensing
6
Conclusions
7
II. ANALYSIS OF RNAs OF VARIOUS SIZES FROM STATIONARY PHASE PLANKTONIC YEAST CELLS OF CANDIDA ALBICANS Abstract
9
Introduction
9
Methods
11
Results
14
Isolation of RNA
14
Bias in mRNA extraction
17
Discussion
20
iv
III. DEFINING CANDIDA ALBICANS STATIONARY PHASE BY CELLULAR AND DNA REPLICATION, GENE EXPRESSION AND REGULATION Abstract
25
Introduction
26
Methods
28
Results and Discussion
31
Growth profiles of C. albicans cells during exponential through 11 days
31
Monitoring diauxic shift in C. albicans
34
Measuring the ethanol content in the C. albicans growth medium
34
mRNA profile over the time course of growth
35
Defining C. albicans growth phases
36
Overview of changes in global gene expression at different phases in the growth curve
37
Validation of microarray gene expression by RT-RTPCR
38
Alteration of gene expression during growth and stationary phase
41
Cluster I: C. albicans growth and proliferation regulating genes Cluster III: DNA repair, stress resistance and aging Cluster III: Gluconeogenesis and antagonists of TOR pathway Clusters IV and V: RNAses and proteases Clusters IV and V: Mannoproteins and other cell wall proteins Clusters IV and V: Drug resistance and virulence genes Screening of C. albicans transcription factor and cell wall mutants
v
49
IV. CANDIDA ALBICANS SNO1 AND SNZ1 EXPRESSED IN STATIONARY PHASE PLANKTONIC YEAST CELLS AND BASE OF BIOFILM Abstract
54
Introduction
55
Methods
56
Results
61
Viability of stationary phase organisms
61
Expression of SNZ1 and SNO1 during planktonic growth
62
Biofilm formation and gene expression
62
Protein localization of Snz1p-YFP and Sno1p-YFP in planktonic cells
64
Protein expression in planktonic cells
66
Protein expression in biofilm organisms
67
Discussion
68
V. EFFECT OF FARNESOL AND CONDITIONED MEDIUM ON CANDIDA ALBICANS GENE EXPRESSION AND YEAST GROWTH Abstract
73
Introduction
73
Methods
75
Results and Discussion
78
Effect of farnesol and CM on germ tube induction
78
Alteration of gene expression in response to farnesol and CM
79
vi
Activities and pathways affected by farnesol and CM addition
81
Gene expression in the presence of CM
82
Gene expression in the presence of 40 µM farnesol
83
Effect of farnesol on C. albicans growth
86
Rescue from farnesol mediated delay in yeast growth resumption
90
VI. CONCLUDING REMARKS
94
REFERENCES
100
vii
ABSTRACT Candida albicans is part of the normal flora of the human oral, gastrointestinal, vaginal and cutaneous surfaces. However, in the compromised host the organism can cause infection of those surfaces as well as systemic disease. C. albicans can also form biofilms on host surfaces as well as abiotic device surfaces such as dentures and catheters. Phenotypic drug resistance of C. albicans biofilms poses a therapeutic dilemma. Stationary phase C. albicans cells are phenotypically more resistant to antifungals. Identifying if cells in a biofilm reach stationary phase could give some insight into the mechanism of biofilm resistance. To test this possibility we first characterized the C. albicans stationary phase and established criteria by which stationary phase could be defined. Planktonic stationary phase cells in vitro are known to survive for long periods of time in media composed of metabolites excreted by the cells during growth. This conditioned medium also contains quorum sensing molecules that confer various properties to the fungus. However, the global effect on gene expression of either the conditioned medium or any of its individual quorum sensing molecule is not well studied. We studied the mechanism by which the conditioned medium and a quorum sensing molecule affected C. albicans biology. To study C. albicans stationary phase, we used a variety of descriptive techniques and cDNA microarray technology. We have defined for the first time, the different growth phases of C. albicans and determined the genes and processes important for entry into stationary phase. We have also identified genes important for the survival of cells in stationary phase. Additionally, by establishing an improved extraction protocol that yields RNA of all classes and sizes we have overcome the difficulty associated with extracting RNA from stationary phase cells. Using stationary phase gene markers we demonstrated that even after prolonged incubation, only 40% of the founder cells of a C. albicans biofilm reached stationary phase. The results of this study will expand our
viii
existing knowledge of C. albicans stationary phase, and serve as a foundation for more systematic and unbiased studies in C. albicans research.
ix
LIST OF TABLES 2.1
Primers used for PCR
3.1
Primers used for PCR
3.2.
Correlation between microarray gene expression and reduction in viability of the mutant strains
4.1
Primers used for PCR
5.1
Primers used for PCR
5.2.
Genes differentially expressed in the presence of farnesol or CM compared to unsupplemented medium
5.3
Differences in cell sizes of farnesol treated and untreated cells
x
LIST OF FIGURES 1.1
Schematic representation of different morphologies of C. albicans
1.2
Scanning electron microscopy images of C. albicans biofilm
1.3
Schematic representation of growth phases in C. albicans
2.1
Analysis of RNA from different growth forms
2.2
Analysis of RNA from stationary phase planktonic yeast cells
2.3
Size dependant extraction of mRNA
3.1
Growth curve of cells from culture grown in YPD for extended periods
3.2
Analysis of budding, DNA profiling and cell sizing of cells grown in YPD for extended periods
3.3
Measurement of glucose and ethanol in the growth medium
3.4
Reduction in C. albicans mRNA abundance
3.5
Cluster analysis of genes differentially expressed in different growth phases of C. albicans
3.6
RT-RT PCR verification of microarray expressed genes
3.7
Metabolic reprogramming inferred from changes in gene expression during diauxic shift
3.8
Screening of C. albicans transcription factor and cell wall mutants by drop plate method
4.1
Schematic representation of construction of the fluorescent construct, recombination into C. albicans genomic DNA, and verification
4.2
Viability of cells from culture grown in YNB for extended periods.
4.3
Expression of SNZ1 and SNO1
4.4
Expression of Snz1p–YFP by yeast cells and pseudohyphae
4.5
Localization of Sno1p–YFP in yeast cells
4.6
Expression of Snz1p–YFP and Sno1p–YFP during progression into and exit from the stationary phase
4.7
Expression of Sno1p–YFP in different layers of a 6-day-old biofilm
xi
5.1
Venn diagram of the number of upregulated genes that are unique to, or common between the three conditions, Farnesol (F), CM (C) and control medium (M)
5.2
RT-RTPCR verification of genes differentially expressed in Farnesol (F) group and CM (C) group, obtained by microarray analysis
5.3
Effect of farnesol on growth retardation of C. albicans cells
5.4
Flow cytometry analysis of cells grown for 8 hours in untreated YNB medium (control), in YNB with 300 µM farnesol and in YNB with 300 µM farnesol and 50 µM OAG
5.5
Differential expression of genes involved in phosphatidylinositol type signaling pathway
xii
CHAPTER I INTRODUCTION “C. albicans has an identity crisis; it thinks it’s a part of the human body” - Carol Kumamoto, Professor, Tufts University Candida albicans the pathogen Classification Kingdom: Fungi Phylum: Ascomycota Class: Saccharomycetes Genus: Candida Species: C. albicans Candida albicans, a diploid asexual fungus is a part of the normal flora of the human oral, gastrointestinal, vaginal and cutaneous surfaces. In healthy individuals, C. albicans normally does not cause disease. However, when the balance of the normal flora is altered, during antibiotic or hormonal therapy, or in conditions when the skin is exposed to moisture for prolonged periods of time, C. albicans can cause painful cutaneous or subcutaneous infections such as, vaginitis, oral thrush, diaper rash, conjunctivitis, or infections of the nail and rectum. In immunocompromised individuals, such as immunosuppressed patients undergoing cancer chemotherapy, C. albicans can be responsible for life threatening diseases only when it enters the blood stream. It is then capable of affecting almost any part of the body and causing hepatosplenic abscesses, myocarditis, central nervous system or pulmonary infections. C. albicans infections are a major public health concern. In the USA, Candida is the fourth most common cause of nosocomial infections, with annual Medicare costs reported to exceed one billion dollars.
1
Also in the USA alone, there are approximately 10,000 deaths a year due to Candida infections (Sudbery, Gow et al. 2004). The advances of modern medicine have led to larger populations of compromised patients susceptible to candidiasis, increasing the importance of C. albicans as a pathogen and providing impetus for the detailed study of C. albicans biology. C. albicans polymorphism A striking feature of C. albicans biology is its ability to grow in a variety of morphological forms. Unicellular budding yeast can reversibly switch to form true hyphae with parallel-sided walls. In between these two extremes, the fungus can exhibit another growth form termed as pseudohyphae, in which the daughter bud elongates but fails to separate, and remains attached to the mother cell (Fig 1.1).
Figure 1.1. Schematic representation of different morphologies of C. albicans. The ability to switch between yeast, hyphal and pseudohyphal morphologies is often considered to be necessary for virulence. Both hyphae and pseudohyphae are invasive (i.e. they invade the agar substratum when they grow in the laboratory). It is speculated that this property could promote tissue penetration during the early stages of infection,
2
whereas the yeast form might be more suited for dissemination in the bloodstream. The filamentous forms may also be important for colonization of organs, such as the kidney (Gow, Brown et al. 2002).
Additionally, morphogenesis plays a pivotal role in C.
albicans biofilm development. C. albicans biofilms Biofilms: Structured microbial communities in which the cells bind tightly to a surface and become embedded in a matrix of extracellular polymeric substances produced by these cells. C. albicans biofilms are structurally well organized communities of yeast, pseudohyphal, and hyphal cells, enclosed in an extracellular matrix comprising polysaccharide and protein (Figure 1.2A, B). Dental plaque is a natural example of a biofilm formed by C. albicans along with other oral bacteria. Candida albicans can also populate, penetrate and form a biofilm on indwelling medical devices such as dental implants, catheters, heart valves, ocular lenses, artificial joints, and central nervous system shunts (Donlan 2001; Douglas 2003). A
B
Figure 1.2. Scanning electron microscopy images of C. albicans biofilm: Hyphae (A) and one yeast cell (B) covered with extracellular matrix. Approximately 10% of the infections linked vascular/urinary catheters and heart valves are due to Candida species and 40 % of patients with intravenous catheters develop acute
3
fungaemia (Kumamoto and Vinces 2005). Finally, a biofilm provides C. albicans protection against some of the major antifungal drugs such as fluconazole, nystatin, amphotericin B, and chlorhexidine (Kuhn and Ghannoum 2004). Recent data indicate that resistance is phase-specific and multifactorial, involving efflux pumps and sterol synthesis (at early and mature biofilm phases, respectively) (Kuhn and Ghannoum 2004). Another explanation for resistance to antifungals could be attributed to the structural complexity of the biofilm that may create a gradient of environmental conditions in which the C. albicans cells enter distinct physiological states. One such state may be equivalent to stationary phase. C. albicans cells in stationary phase adhere better to both biotic and abiotic surfaces; and proper adherence is the first step to biofilm formation. Stationary phase is also the prime reason for phenotypic drug resistance in planktonic C. albicans cells. Hence, investigating the C. albicans growth phase in a biofilm may help understand the properties of the cells in the biofilm. C. albicans growth and stationary phase On inoculation into fresh medium in vitro, C. albicans undergoes four major growth phases (Figure 1.3), 1. Lag phase, a phase where the yeast cells sense their environment, and take time to adapt to it before doubling, 2. Logarithmic phase, which immediately follows the lag phase, where cells start growing exponentially and actively metabolize nutrients, 3. Stationary phase, when the cells exhaust nutrients and stop multiplying. The cells in this phase can survive for long periods of time without additional nutrients, while completely retaining their capacity to bud if and when inoculated into fresh medium, 4. Death – Aging, as well as accumulation of toxic metabolites in the medium, finally pushes the cells into apoptosis, or death.
4
C
D B
A
Figure 1.3: Schematic representation of growth phases in C. albicans: lag phase (A), exponential phase (B), stationary phase (C) and death (D). Most C. albicans research has been carried out with exponentially growing cells, and stationary phase has been poorly studied in this yeast. In fact, not even the timing of entry into stationary phase has been clearly defined. In some studies, an overnight, 24h or 48h grown C. albicans culture is considered to be in stationary phase (Masuoka and Hazen 1999; Westwater, Balish et al. 2005; Zhao, Daniels et al. 2005) while other studies report stationary phase to start much later in culture, i.e. between 3d and 8d (Cassone, Kerridge et al. 1979; Dudani and Prasad 1985; Lyons and White 2000). Lack of study of the C. albicans stationary phase is surprising, given the fact that important properties are acquired by the yeast in this phase. First, only stationary phase cells can generate an extensive production of true hyphae in C. albicans, an important tool for invasion (Westwater, Balish et al. 2005). Secondly, stationary phase Candida albicans cells adhere better both in vitro (to polystyrene and acrylic) (McCourtie and Douglas 1981), and in vivo, to all major organs of mice compared to exponential phase cells (Cutler, Brawner et al. 1990; Granger, Flenniken et al. 2005). Also the cell walls of stationary phase C. albicans cells become 60% thicker and less porous than cells from any other phase – the main cause for phenotypic drug resistance. Proper phenotypic characterization of C. albicans stationary phase is extremely important to understand correctly, the basic biology of this pathogenic yeast. Also, studying this phase at the molecular level, e.g.
5
discovering the genes involved in the entry and maintenance of stationary phase, will subsequently help unravel the mechanism which gives C. albicans important properties (antifungal resistance, virulence, immunogenicity, stress resistance etc). Interference with any of these properties at the genetic level could help in the attenuation of C. albicans virulence. C. albicans growth and quorum sensing By the time C. albicans cells reach stationary phase, they have excreted in the medium metabolites, some of which may have signaling properties, also known as quorum sensing molecules. Such medium has been referred to as conditioned medium. Conditioned medium is known both to stimulate and inhibit germ tube formation (Chen, Fujita et al. 2004; Lopez-Ribot 2005). Farnesol and tyrosol, two quorum sensing molecules purified from conditioned medium are known to mediate such sometimes contradictory activities. While tyrosol induces hyphae in permissive conditions and reduces lag phase in C. albicans (Chen, Fujita et al. 2004), farnesol prevents yeast cell to hyphal transition in similar conditions and in turn inhibits biofilm formation (LopezRibot 2005; Nickerson, Atkin et al. 2006). Thus, the metabolites in the CM have various effects on cells depending upon the environmental conditions and suggesting a complex cell response. The intensity of the quorum sensing effect probably is the highest during the stationary phase, when concentration of metabolites in the medium is greatest. Indeed, conditioned medium recovered from stationary phase cells has been shown to protect C. albicans against oxidative stress. This resistance was mediated partially due to the presence of farnesol in the conditioned medium (Westwater, Balish et al. 2005). Not much is known about what other processes conditioned medium, or its component farnesol effect in C. albicans. Also, the effect of these treatments at the transcriptional level is not yet studied. Identification of the genes or processes affected by these molecules may help reveal the incomplete information behind their mode of action, specially relating to their effect on C. albicans morphology. A part of this thesis was to
6
study the global gene expression profiling of C. albicans cells treated with farnesol as well as the conditioned medium. Conclusions Most of the time C. albicans survives peacefully as a commensal in the healthy immunocompetent host, rarely, if ever, causing any infections. Only in conditions that perturb the normal flora or in immunocompromised hosts do these yeast cells cause morbidity and/or severe systemic diseases. So, as a commensal, what is the growth state of C. albicans in the human body? The answer to this question is not yet known. Perhaps, in organs such as the gut, due to anaerobic conditions and competition for nutrients with hundreds of different species of bacteria, C. albicans survives in stationary phase; while in the oral cavity, due to the constant influx of nutrients, it never reaches the stationary phase. It could be possible that in many parts of the body, C. albicans cells probably exist in conditions akin to those of long-term stationary-phase cultures, in which expression of a wide variety of stress-response genes and alternative metabolic pathways are essential for survival. Also, the growth state of C. albicans in a biofilm is not known. Early in our studies of biofilm, we posed the question “Are all the C. albicans cells in a biofilm in the same physiological state?” To answer this question we hypothesized that some cells within the biofilm reach a physiological state equivalent to stationary phase in planktonic organisms. To test this hypothesis we first had to obtain additional characterization of C. albicans stationary phase and establish a criterion by which stationary phase could be identified. The major findings of my Ph.D. study are as follows, Chapter 2. We found that large molecular weight RNA (both ribosomal and mRNA) could not be extracted by conventional methods of RNA extraction from stationary phase C. albicans cells. We optimized a new method of RNA extraction that can yield all classes and sizes of RNA, especially from late stationary phase cells. We stress that this method for RNA extraction will improve the quality of research pertaining to C. albicans stationary phase (Uppuluri, Perumal et al. 2006).
7
Chapter 3. Using a set of descriptive methodologies, such as monitoring growth and DNA profiles and measurement of carbohydrate and ethanol concentrations in medium, we delineated the different C. albicans growth phases, specially relating to post-diauxic and stationary phase. We hope that giving a definite structure to C. albicans stationary phase physiologically, will reduce the confusion that exists regarding the exact timing of entry into stationary phase. Using cDNA microarray technology we monitored the global gene expression profiles of C. albicans in exponential, diauxic and stationary phase. Notable differences in gene expression observed between the three growth phases emphasize that diauxic shift and stationary phase are two distinctly different stages of growth, and should not be interchangeably used, as done often when studying C. albicans stationary phase. By screening C. albicans transcription factor and cell wall deletion mutants, we identified genes important for entry (carbohydrate metabolism, cell wall maintenance) and maintenance (mitochondrion maintenance, unknown genes) of C. albicans stationary phase. Additionally, after comparing the microarray results and the mutant screening data we learned that steady state expression of many genes throughout the growth curve is important for survival in stationary phase. Chapter 4. Using fluorescent constructs of two stationary phase genes, we found that only 40% of the bottom-most layer of adhered cells in a C. albicans biofilm reached stationary phase (Uppuluri, Sarmah et al. 2006). We conclude that biofilm mediated drug resistance may not be a consequence of presence of stationary phase cells in the biofilm. Chapter 5. Using cDNA microarrays we studied the differential gene expression of C. albicans when treated with conditioned medium and a quorum sensing molecule, farnesol. From this study, we identified pathways that these compounds affect to mediate their inhibitory effect on C. albicans dimorphic switching. Additionally we found that farnesol could increase lag phase in C. albicans and force cells to enter a stationary phase-like unbudded phenotype, which could be relieved by adding a protein kinase C activator oleyl acetyl glycerol.
8
CHAPTER II ANALYSIS OF RNAs OF VARIOUS SIZES FROM STATIONARY PHASE PLANKTONIC YEAST CELLS OF CANDIDA ALBICANS Abstract We initiated a comparison of Candida albicans stationary phase gene expression with other growth states. The widely used hot acid phenol method (HAP) for RNA extraction did not extract rRNA from late stationary phase cells. The RNA from growing yeast cells, hyphae and biofilm, was biased towards small sized RNA. The 2:1 ratio between the two large rRNA bands was rarely obtained. Real time reverse transcriptase PCR (RT-RTPCR) was used to determine mRNA extraction by several methods for OXR1, IRA2, RAD50, PNC1, CHS2, having 300 bp to 8 kb coding regions and ACT1, EFB1, and TDH3, sometimes used as internal standards. Only smaller sized cDNAs were amplified from some extracts. Crushing cells with glass beads in liquid nitrogen before RNA extraction by hot phenol method (CGB) yielded an unbiased distribution for rRNA and mRNA as verified by RT-RTPCR.
With the CGB method the large mRNAs,
RAD50, IRA2 and OXR1, were present throughout stationary phase while the CSH2 transcript increased. The ACT1, EFB1 and TDH3 transcripts decreased in stationary phase, making them unsuitable for standardization. The CGB method yielded high quality RNA from the various growth conditions and permitted the comparison of stationary phase transcripts with those of other conditions. Introduction Study of the stationary phase in C. albicans is still in its nascent stages. It is, however, known that there are changes in the ultrastructure of the cell wall of C. albicans when it enters the stationary phase (Cassone, Kerridge et al. 1979). The yeast cell wall becomes significantly thicker and less porous than exponential phase cells (WernerWashburne, Braun et al. 1993; Mukherjee, Chandra et al. 2003) and confers the property of phenotypic drug resistance (Gale, Johnson et al. 1980; Suci and Tyler 2003). We are
9
interested in exploring the gene expression pattern in stationary phase C. albicans and how stationary gene expression relates to expression of the same gene(s) of organisms under different growth conditions. Isolation of high quality RNA reflecting in vivo transcriptional profiles of cells in each of the growth conditions is crucial for accurate and meaningful results. The thick stationary phase cell wall may also be a deterrent for the extraction of RNA that reflects in vivo profiles. In this study we used several methods to extract RNA from C. albicans cells in stationary phase and other physiologic and morphologic states. The hot acid phenol method (HAP) with or without glass bead vortexing did not yield larger rRNAs from late stationary phase cells. Further, in other conditions where RNA was extracted, the RNA was biased toward smaller RNAs (ribosomal and mRNA). In contrast, a method that has been used for Saccharomyces cerevisiae to extract RNA-protein complexes with intact RNA (Schultz 1999; Lopez de Heredia and Jansen 2004) involving grinding cells with glass beads in liquid nitrogen prior to RNA extraction was modified and successfully applied to C. albicans cells from all cultures. This method yielded an unbiased representation of RNA populations. This methodology was used to examine expression of 8 genes during stationary phase. We found that expression of several large genes could be detected for at least 11 days and in the case of one small gene we observed that expression increased at three days and then persisted. On the other hand, the three small genes that have sometimes been used as internal standards for mRNA comparisons were found to decrease during stationary phase making them unsuitable for standardization across growth conditions that include stationary phase.
Methods Organism and culture conditions. C. albicans strain SC5314 was maintained on YPD (yeast extract 1% w/v, peptone 2% w/v, dextrose 2% w/v) agar plates and transferred to YNB (yeast nitrogen base medium with amino acids, Difco Laboratories, Detroit, Michigan) with 50 mM glucose for suspension culture with shaking (180 rpm).
10
Planktonic C. albicans cells were grown at 250C for 1-11 days and collected by centrifugation. Filament formation was induced by resuspending early stationary phase (about 2x108 cells/ml) yeast cells at 1x107 cells/ml in the same fresh medium at 370C for 90-120 m with shaking at 180 rpm. Germ tube formation was greater than 90%. Biofilm was formed by resuspending 250C late exponentially grown cells at 5x107 cells/ml for incubation at 370C with 9x2x0.1 cm polymethylmethacrylate strips (prepared by Dr. Thomas McKinney, Baylor College of Dentistry, Dallas, Texas) for 2 h. The strips, placed in a 50 ml syringe barrel were washed with YNB to remove non-adhered cells and fresh YNB medium was flowed through the syringe at 50ml/h for 48 h at 370C. Sterile air was supplied into the medium at 1L/h. The yeast and hyphal cells of the biofilm were scraped from the support and collected by centrifugation. RNA extraction. RNA was extracted by the HAP method (Kohrer and Domdey 1991; Ausubel, Brent et al. 2002). For some experiments, stationary phase yeast cells were first resuspended in 400 µl SAB buffer (50 mM sodium acetate, 10 mM EDTA, pH 5.2), 400 µl phenol:chloroform:isoamyl alcohol (25:24:1) with 100 µl glass beads and vortexed vigorously three times for 30 seconds with intervals on ice (Fuge, Braun et al. 1994). Alternatively, cells were placed in a Mini-BeadBeater (Biospec Products, Bartlesville, OK) for three cycles of 45 seconds at 30 second intervals. Broken and intact cells were determined microscopically with a minimum of 1000 cells counted. Another method employing grinding frozen S. cerevisiae cells before extraction was modified (Schultz 1999; Lopez de Heredia and Jansen 2004). Cells were harvested by centrifugation and the pellet was flash frozen with liquid nitrogen and maintained at 800C. A mortar and pestle were chilled with liquid nitrogen and the cell pellet along with an equal volume of glass beads was added. Liquid nitrogen was added as needed to maintain the frozen state of the organism. The mixture was ground until the glass beads formed a fine powder and then grinding was continued for 5 minutes. For 50-100 µl cell pellet (approximately 50-100 mg wet weight cells), a mixture 600 l phenol (pH 4.2), 450 l SAB buffer, 150 l chloroform, and 45 l 20% sodium dodecyl sulfate (SDS) was
11
added to a 2 ml centrifuge tube. The ground cell mixture was transferred with a chilled spatula to the tube and vortexed vigorously for 30 seconds. The mixture was incubated at 65oC for 20 minutes with vortexing after every 5 minutes and centrifuged (12,000 x g) for 10 m at room temperature. The upper aqueous layer, approximately 500 l, was reextracted with an equal volume of phenol. The aqueous phase was extracted once with 24:1 mix of chlorofom:isoamyl alcohol. The aqueous phase RNA was mixed with 0.1 volume of 3 M sodium acetate, pH 5.2, and 2.5 volumes of 100% ethanol and incubated at -80°C for 15 minutes. The precipitate was collected by centrifugation (12,000 x g for 15 minutes at 4°C) and the pellet washed with 70% ethanol. The pellet was collected by centrifugation (12,000 x g for 5 minutes at 4°C), air dried and dissolved in diethyl pyrocarbonanate (DEPC)-treated water. Aqueous solutions were treated with DEPC and RNase-free plastic ware was used during isolation. RNA analysis
RNA (5-10 µg) was separated by electrophoresis on 1% agarose
containing 2% formaldehyde, stained with ethidium bromide by standard methods and visualized (Imgemaster; Amersham Pharmacia Biotech, Piscataway, NJ). Densitometric measurements were obtained. Peak area calculations were generated using ImageJ software (Version 1.32e). Real time reverse transcriptase PCR. Primers were designed for 8 genes ACT1, CHS2, EFB1, IRA2, OXR1, PNC1, RAD50 and TDH3 and are listed in Table 2.1.
12
Table 2.1 Primers used for PCR. Forward (F) and Reverse (R) primers were used to amplify a region of the orf from cDNA and the whole orf from DNA or to confirm absence of DNA from RNA preparation, EFB1 (DNA). Gene (systematic name) ACT1 (orf19.8001) CHS2 (orf19.737) EFB1 (orf19.3838) IRA2 (orf19.5219) OXR1 (orf19.243) PNC1 (orf19.6684) RAD50 (orf19.1648) TDH3 (orf19.6814) EFB1 (DNA) (orf19.3838)
Primer
Sequence (5’-3’)
ACT1F ACT1R ACT1fullF ACT1fullR CHS2F CHSR CHS2fullF CHS2fullR EFB1F EFB1R EFB1fullF EFB1fullR IRA2F IRA2R IRA2fullF IRA2fullR OXR1F OXR1R OXR1fullF OXR1fullR PNC1F PNC1R PNC1fullF PNC1fullR RAD50F RAD50R RAD50fullF RAD50fullR TDH3F TDH3R TDH3fullF TDH3fullR EF1-BF EF1-BR
TCATGATGGAGTTGAAAGTGGTTT AGAGCTCCAGAAGCTTTGTTC ATGGATGGACCAGATTCGT TCAAGTTATCACTATTGG TAATAAATTCCGCAATACGCCTAAC TAGTGGCACACATTCTCTTTCATTTT ATGTTTATATTTTCTTGTTTCA TCAATGATTATTATAAAAATGGCGGAT ACGAATTCTTGGCTGACAAATCA TCATCTTCTTCAACAGCAGCTTGT ATGAGTGACAAAGAAGATTTAAA TTACAATTTTTGCATAGCAGC CCTTGATACAAAGTCGAGCTTAGGA TAGGAGCTGTTGGCCAGGTATT AATGGAGCAGAAGAGTTATTGTCGGACATT TTAATCCTCCAATTTCGACCCACTGAT TCGTCACATTCTAGTGTTTCTAGTCTG TAGTAATCGATGATGAGTTGATTCTT ATGTCATTTCTTTTTAGAAGATCT TTACTCAAAAGTACCTATT AACTTGACCCGAAAACGAATCA AGCTCCCTTGGTGCCTTGTAC ATGAAGAAAACAGCATTAATAGT TCAATTCAGTATGATGTACCCCCA CAGGGACATTGCCTCCAAAT CAGTTACAGCAGTTCGAGAGCTTAAG ATGATCCATATTGAAAAACTATTTT TTAGCCTTGAATTCTACCAAT AGGACTGGAGAGGTGGTAGAACTG AATAACCTTACCAACGGCTTTAGC ATGGCTATTAAAATTGGTATTAA TCAAGCAGAAGCTTTAGCAACGT ACGAATTCTTGGCTGACAAATCA TCATCTTCTTCAACAGCAGCTTGT
Parameters for primer design are set according to the recommendations of Applied Biosystems (Foster City, CA). Briefly, the primer sizes were between 20-25b in length, with Tm of each primer at 58oC. The amplicons were between 90 – 110bp in size. Total RNA was DNase treated (Ambion, Austin, TX) and purified with the RNeasy kit (Qiagen Inc., Valencia, CA). The absence of DNA was confirmed with EFB1 (Maneu, Martinez et al. 2000). cDNA was made using the SuperScript III First Strand Synthesis System (Invitrogen, Carlsbad, CA) and 1 µg total RNA template. cDNA was diluted 1:4
13
with RNase-free water. Analysis of transcript was carried out in 25 µl using SYBR Green PCR Master Mix (Applied Biosystems) in ABI Prism 7700 Sequence Detection System (Applied Biosystems) for 40 cycles (thermal cycling conditions: Initial steps of 50o C, 2 min and 95o C, 10 min; and then, 40 cycles of 95o C,15 sec; 60o C, 1 min). The Ct values for each experiment were recorded. To quantify transcripts, a standard curve was constructed using DNA of each gene as standard. For this, genomic DNA was isolated from C. albicans SC5314 strain following standard protocol (Adams, Gottschling et al. 1997) and each ORF was PCR amplified using gene specific primers that amplify the complete ORF. PCR products were separated in a 1.0% agarose gel, DNA eluted from gel and quantitated spectrophotometrically. RT-RTPCR reaction for each gene was set up using serial 10 fold dilutions of the amplified ORF as the DNA template. Three independent biological and technical replicates were used for normalization. All replicates gave significantly similar amplification values as analyzed using ANOVA (p1kb) could not be recovered from late stationary phase cells (5-11 day old) by using the HAP method for RNA extraction (Fig 2.3A). As for 5S and tRNA, small message could be efficiently extracted by the HAP method. However, when the cell walls were disrupted by using the CGB method, the large molecular weight mRNAs (as large as 8 kb) were extracted. (Fig 2.3C). These observations suggest that quantitative analyses of yeast RNA populations particularly in stationary phase cells and even in growing cells may have under representation of large RNAs, if the RNA has been extracted by HAP (with or without glass bead vortexing). About 200 S. cerevisiae ORFs and 180 C. albicans ORFs have very large coding regions that would be most affected by biased extraction (Hong, Balakrishnan et al.; Arnaud, Costanzo et al. 2005). In C. albicans, of the 180 large ORFs, more than half are not annotated. Among the annotated genes are ALS2 (a member of an adhesin family implicated in biofilm formation), INT1 (a protein implicated in adherence and found in the septin ring), POL2 (DNA polymerase induced by interaction with macrophage), GSC1 (a subunit of Beta 1,3-glucan synthase), MEC1 (cell cycle checkpoint protein) and KEM1 (exoribonuclease required for hyphal growth and biofilm formation), that have ORF sizes greater than 4Kb. Without the CGB or similar effective method the determination of abundance of large and small mRNAs would not represent the cellular abundance and expression of genes with large mRNA would be missed in stationary phase. This analysis demonstrated that the extracted mRNA is suitable for analysis by RT-RTPCR and microarray analysis (unpublished observations). Previously Schultz (Schultz 1999) and Lopéz de Heredia and Jansen (Lopez de Heredia and Jansen 2004) reported that grinding liquid nitrogen frozen cells under liquid nitrogen yielded high quality extracts with large mRNAs and associated proteins.
Hauser, et al (Hauser,
Vingron et al. 1998) also found that liquid nitrogen frozen S. cerevisiae cells maintained frozen while beating with tungsten carbide beads gave the best quality RNA for microarray analysis compared to enzymatic lysis or beating with glass beads followed by
22
warmed phenol extraction. Although our results suggest that the preferred method would yield an unbiased RNA size distribution, Hauser et al (Hauser, Vingron et al. 1998) did not report size distribution of RNA extracted by the various methods. Further, we wanted to know if the bias in RNA extraction was the reason for the drastic reduction in the levels of housekeeping genes reported in stationary phase. C. albicans ACT1 mRNA is reported to decrease drastically in stationary phase as determined by Northern blot analysis (Delbruck and Ernst 1993; Swoboda, Bertram et al. 1994). A 100 fold reduction in the levels of ACT1 transcript in the S. cerevisiae stationary phase has been reported earlier using RT-RTPCR and Northern blot analysis (Wenzel, Teunissen et al. 1995; Monje-Casas, Michan et al. 2004). But we found that, regardless of the method of RNA extraction used, the commonly used housekeeping gene standard, ACT1, showed reduced levels of mRNA in the stationary phase. We also showed that the mRNA of two more genes which are frequently used as internal standards for relative quantitation of transcript levels, EFB1 and TDH3, were reduced significantly in the stationary phase and therefore none of these three is suitable for standardization of stationary phase analyses. In a microarray analysis of response to glucose starvation, as occurs in stationary phase, within one hour the abundance of EFB1 and TDH3 decreased (Lorenz, Bender et al. 2004). In contrast to the decrease in expression of these three genes, the expression of CHS2 increased between day 1 and day 3 and remained elevated through 11 days (Fig 2.3B). While Chs3p is responsible for most of the chitin synthesis in yeast and hyphal forms, the Chs2p contributes to increased synthesis in hyphal forms (Munro, Schofield et al. 1998). Insoluble glucan (residual glucan+chitin) is greatest in early stationary phase cells compared to other growth stages or forms (Sullivan, Yin et al. 1983). Chitin of stationary phase cells may contribute to reduced drug susceptibility since treatment of cells with chitinase partially reduced the phenotypic amphotericin B resistance of stationary phase cells (Gale, Ingram et al. 1980). These observations raise the possibility that increased expression of CHS2 may contribute to the cell wall changes that develop in stationary phase cells and that likely contribute to the failure to extract large RNAs from
23
stationary phase yeast cells. The CGB extraction method revealed that the three genes, IRA2, RAD50, OXR1, with large coding regions continued to be expressed through day 11. In summary, the extraction of RNA from C. albicans cells frozen and ground with glass beads reduced bias against large RNAs. In addition, RNAs were extracted from late stationary phase cells, suggesting that this or a similar method may be essential for analysis of RNAs from such cells. Analysis of the selected genes showed that genes continue to be expressed during stationary phase with patterns of unchanged, increased or decreased expression after active growth.
Decreased expression of several genes
frequently used for internal calibration showed that they were not suitable for stationary phase studies. Because the method of extraction affected the RNA profile, this method or a similar method should be considered for applications requiring proportional representation of RNA populations.
24
CHAPTER III DEFINING CANDIDA ALBICANS STATIONARY PHASE BY CELLULAR AND DNA REPLICATION, GENE EXPRESSION AND REGULATION Abstract Stationary phase Candida albicans yeast cells harbor properties of better adherence, virulence and elevated drug resistance. Ironically, C. albicans stationary phase is not well characterized in vitro either physiologically, or molecularly. Candida albicans yeast cells were grown in rich medium with 2% glucose. Based on growth and DNA profiles of cells, and by measurement of glucose and ethanol in the medium, we categorized C. albicans growth curve into three distinct phases – exponential/diauxic, post-diauxic and stationary phase. We found that, compared to exponential phase cells, mRNA content was less abundant in post-diauxic and even less in stationary phase C. albicans cells. Further analysis of the C. albicans transcriptome with oligonucleotide-based microarrays revealed that although the overall mRNA content had decreased, transcripts of many genes increased in post-diauxic as well as stationary phase. Genes involved in process such as, gluconeogenesis, stress resistance, adhesion, DNA repair and aging were upregulated at and beyond post-diauxic phase. Many C. albicans genes associated with virulence, drug resistance and cell wall biosynthesis were upregulated only at stationary phase. By screening 108 C. albicans transcription factor and cell wall mutants we could identified 17 genes essential for either entry or survival in stationary phase at 30oC.
25
Introduction C. albicans is a part of the normal flora of human oral, gastrointestinal, vaginal and cutaneous surfaces. In immunocompromised patients the organism can cause infection of the surfaces that it colonizes as well as causes systemic diseases. Additionally, C. albicans can develop a biofilm on a large range of implanted devices as well as on some host surfaces (Kumamoto and Vinces 2005; Mukherjee, Zhou et al. 2005). Biofilm cells are notorious for being resistant to antifungal agents, thus making biofilm related infections hard to treat.
Under in vitro conditions, when nutrients are abundant and
conditions are favorable for growth, organisms grow exponentially. However in their natural habitat, rarely do they encounter conditions that permit long periods of exponential growth. In fact, many pathogenic organisms including C. albicans regularly encounter environments of ‘feast and famine’, especially in the human host, e.g. within the oral cavity, with respect to dietary sugars (Finkel 2006; Thurnheer, van der Ploeg et al. 2006); or in the human gut, where C. albicans faces intense competition for nutrients with hundreds of co–commensal prokaryotic species, thus leading to potential compromise in functioning at the peak of its metabolic capacity. Nutrient starvation induces cessation of growth and entrance into stationary phase, that allows microorganisms, especially yeasts to maintain viability for several days (WernerWashburne, Braun et al. 1993; Finkel 2006; Uppuluri, Sarmah et al. 2006). Stationary phase is an advantageous growth state for many organisms. In pathogenic bacteria such as Mycobacterium tuberculosis, Escherichia coli, Streptococcus mutans, Salmonella typhimurium, planktonic stationary phase cells are more tolerant to various stresses, and are more resistant to antimicrobial drugs when compared to exponential phase cells (Herbert, Paramasivan et al. 1996; McLeod and Spector 1996; Svensater, Bjornsson et al. 2001; Finkel 2006). Additionally, stationary phase is partly responsible for resistance of Klebsiella pneumoniae and Pseudomonas aeruginosa biofilm cells to antibiotics (Spoering and Lewis 2001; Anderl, Zahller et al. 2003). Like bacteria, stationary phase C. albicans cells have many unique properties that have proven favorable for the organism. Pathogenesis of C. albicans largely depends on
26
adherence to the tissues they colonize; and hyphae are an important virulence tool to help C. albicans penetrate and invade the adhered tissue. C. albicans stationary phase cells show better adherence to tissues of almost all organs in mice, when compared to exponential phase cells (King, Lee et al. 1980; Cutler, Brawner et al. 1990). Also, only stationary phase cells can generate an extensive production of true hyphae in C. albicans (Westwater, Balish et al. 2005). Not only can stationary phase be an advantageous growth state for C. albicans virulence, it can also cause C. albicans to be many fold more resistant to almost all classes of antifungal drugs (Cassone, Kerridge et al. 1979; Gale, Johnson et al. 1980; Beggs 1984). C. albicans cells in a biofilm have a similar or even higher level of antifungal drug resistance (Nobile and Mitchell 2006). We have recently reported that ~ 40% of the founder cells of a C. albicans biofilm reach stationary phase (Uppuluri, Sarmah et al. 2006). However, unlike bacterial biofilms (Spoering and Lewis 2001; Anderl, Zahller et al. 2003), a direct relationship between C. albicans stationary phase and biofilm drug resistance has not yet been shown. Despite the fact that significant properties are acquired by C. albicans in stationary phase, it is surprising that not even the timing of entry into stationary phase is clearly defined. In some studies, an overnight, 24h or 48h grown C. albicans culture is considered to be in stationary phase (Cutler, Brawner et al. 1990; Masuoka and Hazen 1999; Westwater, Balish et al. 2005; Zhao, Daniels et al. 2005), while other studies report stationary phase to start much later in culture, i.e. between 3d and 8d (Cassone, Kerridge et al. 1979; Dudani and Prasad 1985; Cutler, Brawner et al. 1990; Lyons and White 2000; Song, Harry et al. 2004). Additionally, molecular research pertaining to C. albicans stationary phase is in its nascent stages. Only a handful of genes and processes playing a role in C. albicans stationary phase have been studied (Postlethwait and Sundstrom 1995; Bertram, Swoboda et al. 1996; Sarthy, McGonigal et al. 1997; Lamarre, LeMay et al. 2001; Zaragoza, de Virgilio et al. 2002; Moreno, Pedreno et al. 2003; Galan, Casanova et al. 2004; Bates, MacCallum et al. 2005; Granger, Flenniken et al. 2005; Roman, Nombela et al. 2005; Uppuluri, Sarmah et al. 2006). On the other hand, stationary phase has been extremely well characterized in the budding yeast S. cerevisiae (Werner-Washburne,
27
Braun et al. 1993; Gray, Petsko et al. 2004; Martinez, Roy et al. 2004). Studies in S. cerevisiae routinely report 7d old cells as stationary phase cells and molecular techniques such as microarrays have helped identify genes and biological processes necessary for entry and maintenance of S. cerevisiae stationary phase (Martinez et al., 2004; Aragon, Quinones et al. 2006; Swinnen, Wanke et al. 2006). In the present study, we have characterized C. albicans stationary phase by studying the pattern of growth and DNA profile of planktonic yeast cells in stationary phase compared to exponential phase. Further, using cDNA microarrays, we have explored the genomic expression patterns in the yeast cell as it progresses into the stationary phase. Finally, by screening deletion mutants, we have identified genes important for entry and maintenance of C. albicans stationary phase. Methods Cells harvesting and RNA preparation C. albicans strain SC5314 was maintained on YPD (yeast extract 1% w/v, peptone 2% w/v, dextrose 2% w/v) agar plates and transferred to YPD suspension culture with shaking (180 rpm) at room temperature (RT). Exponentially growing C. albicans cells were subcultured in fresh YPD medium and incubated at 30o C. Cells were recovered after various time points, exponential phase, 3d, 5d, 7d and 11d for RNA extraction. Total RNA was isolated using the standard hot acid phenol method following grinding frozen cells using a mortar and pestle in liquid nitrogen (Chapter II). The RNA preparation was DNAse treated and the absence of DNA contamination was confirmed with the housekeeping gene EFB1 (Maneu, Martinez et al. 2000). RNA quality and quantity were determined as described (Uppuluri, Sarmah et al. 2006). Cell viability was determined as colony forming units (cfu) by plating replicates of dilutions of planktonic cells prepared in sterile water on YPD plates and incubating at 37oC for 24 to 48 hours. Colonies were enumerated manually and the average determined. Particles in a suspension culture were determined by use of a hemacytomer and OD (optical density) measurement was determined at 600 nm. Cell size (for 1x106
28
cells/ml) and in some cases cell density were measured using a Z - series Coulter counter (Beckman Coulter, Fullerton, CA). Determining C. albicans diauxic shift C. albicans exponentially growing cells were inoculated at a concentration of 1x105cells/ml into YPD with 2% glucose, and incubated at 30oC. Aliquots of culture were recovered every hour beginning 13h to 27h, centrifuged and filtered to remove yeast cells. Glucose concentration in the cell free media was measured using the QuantiChrom Glucose assay kit (Bioassay systems, Hayward, CA). Determining levels of extracellular ethanol in C. albicans growth medium Aliquots of cultures were recovered at 0h (immediately after C. albicans inoculation), 2h, 6h, every hour from 16h to 29h, 45h, 48h and 55h after inoculation. The cultures were centrifuged and the supernatant retained. The levels of ethanol present in these cell-free supernatants were determined using commercially available kits (Boehringer Mannheim/R-Biopharm) according to manufacturer’s instructions. Analysis of cellular DNA by fluorescence flow cytometry Aliquots (500 µl) of cells (12x107 cells/ml) were sonicated for 5 seconds and fixed by incubating at 4oC, overnight in 1.5 ml of 95% ethanol. The cells were washed with 50 mM sodium citrate pH 7.0, and resuspended in the same buffer. The cells were sonicated for 2 s, treated with 25 µl 10 mg/ml RNase A, and then with 25 µl of 20 mg/ml Proteinase K and incubated for 1 h at 50oC for both treatments. Finally, 1 ml of propidium iodide (PI) was added at a final concentration of 16 µg/ml and the samples were stored at 4oC. A total of 1x105 PI stained cells were analyzed with a Beckman Coulter Epics XL flow cytometer (Beckman Coulter, Fullerton, CA). The results were analyzed with Expo V2 Analysis software (Beckman Coulter). Transcriptional analysis cDNA was synthesized with 10 µg total RNA using Oligo-(dT)20 primer, 10-mM dNTP (includes AA-dUTP) mix and SuperScript III RT (Invitrogen, Carlsbad, CA). The cDNA was labeled with Cy3 NHS ester (Amersham, Piscataway, NJ)
29
and purified using the cDNA labeling and purification module (Invitrogen). Labeled cDNA was estimated spectrophotometrically at 550 and 650nm. Corning Ultra gap II slides were printed with 70 mer oligonucleotides (QIAGEN Inc, Valencia, CA) by the Microarray Research Facility of the Oklahoma Medical Research Foundation. Labeled cDNA was hybridized on to the blocked (with 3.5 ml 0.2 M sodium borate of pH 8.0, 31.5 ml of 1-methyl-2-pyrrolidone and 0.5 gm succinic anhydride) microarray slides at 42oC for 6 hours. Slides were washed at high stringency at 56oC (twice for 10 minutes each, using 2X SSC, 0.1% SDS, twice for 10 minutes using 0.1X SSC, 0.1% SDS, and three times for 5 minutes each using 0.1X SSC). Intensity of the hybridized signal was determined by Axon Genepix scanner and Genepix Pro 5.0 microarray image analysis software (Axon Instruments, Inc., Aberdeenshire, Scotland). Standard quality control parameters applied to slides included median signal-to-background >3, Mean of median background 10 and features with saturated pixels 0.01) between all the time points. Of these genes, 395 were of unknown functions. K – Means clustering of the differentially expressed genes revealed 5 major patterns of gene expression (regulated > 2 fold) over
37
the different time points. Of the 5 clusters, Cluster I included 298 genes upregulated only in the exponential phase compared to the other time points. Cluster II comprised of 166 genes having similar expression patterns between exponential phase and 3 d time point, and were expressed higher than the other time points. Of the other three remaining clusters, the first cluster (cluster III) comprised of 229 genes that, when compared to the exponential phase were upregulated at day 3 and remained elevated until day 11. The second cluster (cluster IV) included 148 genes that showed earliest upregulation at day 5 and the final cluster, (cluster V) included 64 genes showing a major upregulation late in the time course, at day 11. The remaining genes showed random patterns of expression and could not be included as a part of any cluster. To identify the primary biological processes, molecular functions, and cellular components associated with the different clusters, we used MAPPFinder (GenMAPP version 2.0) to connect the gene expression data to the Gene Ontology (GO) hierarchy. This program computed a statistically weighed score (Z score) that ranked GO terms by their relative amounts of gene expression changes. The five clusters and the biological processes governing them are illustrated in Figure 3.5. Validation of microarray gene expression by RT-RTPCR We used RT-RTPCR to support the differential gene expression observed with global transcriptional analysis at all the time points. We picked eleven genes for this analysis. The RT-RTPCR expression of seven genes (PNC1, IRA2, RAD50, CHS2, TDH3, ACT1 and EFB1), at all time points has been recently reported by us (Uppuluri, Perumal et al. 2006). The results for these genes by RT-RTPCR were similar to the results obtained by microarray analysis. For example, microarray analysis revealed that compared to exponential phase, the transcript level of PNC1 had a transient decrease at 3 days, but increased at, and remained elevated beyond 5 days. On the other hand, the mRNA of CHS2 was first upregulated at 5 days and remained upregulated throughout the time course. Also, mRNA abundance of the house keeping genes, TDH3, ACT1, and EFB1 reduced many fold during the post-diauxic phase and stationary phase, when
38
compared to exponential phase cells. We saw an identical pattern of expression in our RT-RTPCR results (Chapter II). For the present study, we analyzed four more genes (MSH5, SNF5, PHO80 and NET1) for the verification of microarray gene expression, using the similar technique. We found that, for these genes too, the RT-RTPCR corroborated the differential expression observed by microarray analysis (Fig. 3.6). Due to the unsuitability of the housekeeping genes for normalization, we used the same mRNA quantity as starting material instead of the commonly used total RNA (for both studies), for performing RT-RTPCR and also calculated absolute transcript numbers for every gene.
39
Fig. 3.5 Cluster analysis of genes differentially expressed in different growth phases of C. albicans.
Based on the similarities between the patterns of expression, all the
differentially expressed genes were categorized into 5 different clusters. Cluster I contained genes upregulated only in exponential phase denoted as E (A), Cluster II included genes having highest expression at E and 3d (B), Genes in Cluster III were first upregulated at 3d, and remained elevated until 11d (C), Cluster IV and V contained genes upregulated late in the time course, at 5d and 11d respectively (D, E)
40
Fig. 3.6
RT-RT PCR verification of microarray expressed genes.
Four genes
differentially expressed in microarrays identified by different signal intensity (log2) (A), were verified by using RT-RTPCR (B). Absolute counts of the mRNA are represented as log10 values in the RT-RTPCR results. Alteration of gene expression during growth and stationary phase. Cluster I: C. albicans growth and proliferation regulating genes A total of 335 genes were upregulated at 12 hours, in exponentially growing cells (cluster I) when compared to any other time point. All the biological processes that these genes represented were effected significantly (p > 0.05), and showed a z – score of at least 2.6. As expected from exponentially growing cells (cluster I), one of the major upregulated processes (compared to all other time points) included the cyclin dependant kinases CDC28, CDC1 and the other protein kinases, CKA1 and KIN3, all of which are known to be important for progression of the cell cycle (Hartwell, Culotti et al. 1970; Sherlock, Bahman et al. 1994; Bachewich, Nantel et al. 2005; Bruno and Mitchell 2005) (Fig 3.5A). In yeasts, the G proteins, RAS1 and RAS2 are activated when nutrients are abundant and in turn activate the adenylate cyclase gene CYR1, leading to an increase in intracellular cAMP and in turn promoting bud growth and cell polarity (Gray, Petsko et al. 2004). These three genes, and some more genes involved in the Rho GTPase mediated signal transduction, e.g. BEM2, BNR1, RSR1 (Yaar, Mevarech et al. 1997; Weeks and Spiegelman 2003; Bassilana, Hopkins et al. 2005; Li, Wang et al. 2005) showed highest levels of expression in the exponential phase time point. At 12 hours, glucose is abundant in the medium and is the
41
primary source of carbon. As a result, most of the genes of the glycolysis pathway, and glucose transport were positively regulated during the exponential phase time point. Consistent with the budding and DNA profiling which revealed that 80% of the cells were still budding and replicating their DNA during exponential phase, we found genes involved in C. albicans DNA replication, mitosis and cell wall maintenance as primary processes upregulated in the exponential phase time point. Another large category of genes showing the highest expression at exponential phase were the ribosomal biogenesis or the rRNA processing genes. Interestingly, many mitochondrial ribosomal genes were found upregulated in this cluster, indicating that C. albicans indeed prefers aerobic respiration for growth when growing exponentially. Upregulation of three mitochondrial ribosomal genes during the active growth phase has also been previously reported (Ihmels, Bergmann et al. 2005). However, the mitochondrial genes were not all upregulated in exponential phase. Many genes either did not change throughout the time course of 11 days of growth, or were upregulated late in the time course. Few of these genes are discussed later in this study. Cluster II We found many more genes related to DNA replication and mitosis being upregulated at levels similar to exponential phase, even in the post diauxic phase (3d time point; cluster II) (Fig 3.5B). This gene expression result supported our growth and DNA profiling results that C. albicans cells were still growing in the post – diauxic shift phase, albeit slowly. However, further analysis of the microarray data revealed that the genes expressed during the post-diauxic phase also shared properties with the genes expressed in stationary phase. Many processes were upregulated first at this time point (3d), and remained elevated until 11 days (cluster III). Cluster III: DNA repair, stress resistance and aging Although the 3d time point shared many common highly expressed genes with the exponential phase time point, many genes were also upregulated greater than the exponential phase at this time point. Grouped under cluster III, these were 244 genes, the transcript levels of which were first
42
upregulated beginning 3 days and kept gradually increasing till 11d. While the 3d old cells were still replicating their DNA and growing slowly, these cells also transcribed genes coding for different mechanisms of DNA repair. C. albicans upregulates the repair genes in the post-diauxic phase (a point in time just before stationary phase), to combat the extensive DNA damage that is expected during stationary phase (Gray, Petsko et al. 2004). We found a few stress resistance genes being upregulated at 3d. One of these genes was SOD6, a superoxide dismutase known to provide resistance against oxidative stress in C. albicans (Martchenko et al., 2004). Many orthologs of S. cerevisiae stress resistance genes, having unknown functions in C. albicans were also included in Cluster III (Fig 3.5C). Between growth and stationary phase, C. albicans cells excrete metabolites into the medium that have quorum sensing functions; and the conditioned medium recovered from stationary phase cells is known to protect cells from oxidative stress (Westwater, Balish et al. 2005). In fact, stationary phase yeast cells are by themselves more resistant to various stresses compared to exponential phase cells (Aragon, Quinones et al. 2006). An interesting category of genes upregulated during the diauxic phase were those involved in yeast cell aging. As yeast cells age, they accumulate in their nucleus, extrachromosomal rDNA circles (ERC) that dilute the DNA replication machinery and lead to senescence and cell death. Silencing of the rDNA locus, thus preventing ERC formation is carried out by histone deacetylases thus promoting longevity in yeast cells (Vijg and Suh 2005). Overexpression of the C. albicans chromatin silencing genes first in diauxic phase and its gradual increase in stationary phase is in concert with the well known fact that stationary phase advances replicative aging in yeast cells (Ashrafi, Sinclair et al. 1999) Cluster III: Gluconeogenesis and antagonists of TOR pathway In Cluster III, we found upregulation of genes whose transcription levels are reported to be elevated when engulfed by macrophages. In glucose limiting conditions such as the post-diauxic shift, yeast cells utilize alternative sources of organic molecules for metabolism, and undergo
43
the process of gluconeogenesis (Gray, Petsko et al. 2004). Also, when phagocytosed, C. albicans cells elicit a
similar response, characterized by the upregulation of the
gluconeogenesis and beta-oxidation pathway (Lorenz, Bender et al. 2004). Consequently, we also saw increase in the transcript levels of most genes involved in gluconeogenesis, the beta-oxidation pathway and the glyoxylate pathway during C. albicans post-diauxic phase. Since beta oxidation occurs in the peroxisome (Gurvitz, Hiltunen et al. 2001), many genes having functions in peroxisome organization and biogenesis were also similarly upregulated (Fig 3.5C). Corresponding to this increase, a decrease in the glycolytic pathway genes was also observed (Fig 3.7).
44
Fig 3.7 Metabolic reprogramming inferred from changes in gene expression during diauxic shift. Only key metabolic intermediates are identified. The names of genes upregulated in diauxic shift are in shown in boxes, while those downregulated are circled. The magnitude of induction or repression is indicated for these genes. The direction of the arrows connecting reversible enzymatic steps indicate the direction of the flow of metabolic intermediates.
45
The gene encoding the kinase TOR1 was found downregulated while two transcription factors, GLN3 and GAT1 were upregulated at 3 days and was categorized into cluster III. The later two genes are normally induced by a shift from good to poor nitrogen or carbon nutrient sources (Cruz, Goldstein et al. 2001; Gray, Petsko et al. 2004). The two genes are also considered to act antagonistically to the TOR pathway – the global nutrient sensing pathway of most pathogenic fungi that promotes cell proliferation in nutrient rich condition. Upregulation of the two genes and the downregulation of TOR1 indicated that the TOR pathway was inhibited beyond diauxic shift. Inhibition of TOR function also activates the mitochondrial signaling pathway genes and genes involved in aerobic respiration (Gray, Petsko et al. 2004). One gene from each of the two processes, RTG3 and HAP1, were over expressed by the 3 day old cells, and remained upregulated throughout the next 7 days. Also upregulated beyond 3 days were genes involved in the repair and maintenance of the mitochondrial genome, mitochondrial ribosome biogenesis, and mitochondrial electron transport. This highlights the fact that mitochondrial function is essential for cells in post-diauxic and stationary phase. Earlier in this study we had shown that C. albicans transiently switched metabolism from respiration to fermentation. Upregulation of mitochondrial genes beyond 3 days probably means that aerobic respiration is the prominent way by which C. albicans survives in the stationary phase. Clusters IV and V: RNAses and proteases From cluster III, we found that many genes and processes important for stationary phase were first upregulated at post-diauxic phase. However, further analysis of the microarray results revealed that genes upregulated first in stationary phase (at and beyond 5 days), functioned in a few processes unique from that seen in exponential or post-diauxic phase cells (Fig 3.5D, E). In this study, we earlier found that, C. albicans diauxic shift led to a modest decrease in mRNA quantity that became greater in the stationary phase. Although we did find a couple of genes coding for ribonucleases (RNAse) at 3d, mRNA degradation was the major process upregulated beginning at 5d, and remaining elevated until 11d (cluster
46
IV). A few more genes involved in this process were also upregulated late into stationary phase, at 11d (cluster V). Not only were the RNAse genes upregulated, but so were some genes coding for proteases. Given the observation that the overall transcriptional as well as translational machinery is down regulated in S. cerevisiae stationary phase (Sogin and Saunders 1980; Werner-Washburne, Braun et al. 1993; Kuzj, Medberry et al. 1998; Aragon, Quinones et al. 2006), finding these genes was not surprising. Clusters IV and V: Mannoproteins and other cell wall proteins In our gene expression data we found the ATPase gene PMRI, upregulated greater than 2 fold at 5d. Also upregulated were genes involved in the secretory pathway (SEC21, SEC59, COD2, SLY1, GEA2 and RUD3). For the maintenance of viability in stationary phase, trafficking between ER to Golgi is known in both C. albicans and S. cerevisiae to be an essential process (Werner-Washburne, Braun et al. 1993; Bates, MacCallum et al. 2005). The Golgi P-type ATPase, PMR1 plays an important role in this process by transporting divalent cations to the Golgi, in turn activating mannosyltransferases and finally effecting glycosylation of mannoproteins (Bates et al., 2005). Corresponding to this function, we found genes belonging to the highly studied C. albicans PMT (PMT2, PMT4) and MNT (MNT4) family of mannosyltransferases (Bates, MacCallum et al. 2005), as well as genes coding for cell wall mannoprotein biosynthesis (MNN2, MNN4, ALG2, ALG5, MIT1), upregulated beyond 5d. The mannoproteins play important roles in C. albicans adhesion, antigenicity and modulation of the host immune responses (Bates, MacCallum et al. 2005). Besides genes involved in mannoprotein biosynthesis, our microarray results revealed that, C. albicans beta-1,6-glucan biosynthesis genes, KRE5, KRE9, as well as chitin biosynthesis and distribution genes, YEA4, GNT1, BNI4 and CHS2 had increased mRNA content in the stationary phase C. albicans cells (beyond 5d), compared to any other time points – exponential or post diauxic. These two components of C. albicans cell wall, beta-1,6-glucan and chitin are responsible for the unbalanced cell wall growth in stationary phase, leading to phenotypic drug resistance (Cassone, Kerridge et
47
al. 1979; Gale, Johnson et al. 1980; Beggs 1984; Cassone 1986). The increase in these two components is known to cause significant changes in the ultrastructure of the C. albicans cell wall. Cassone et al., 1979, reported that the C. albicans cell wall becomes ~ 65% thicker after 6 days of growth compared to the exponential phase cells. Also there is no difference in the thickness of the cell wall between exponential phase and 3 day old C. albicans cells (Cassone, Kerridge et al. 1979). This supports our defined framework of the different C. albicans growth phases which proposes that stationary phase begins at day 5, while 3d old cells are still in the post-diauxic phase. We have earlier indicated that such a thick cell wall may also prove to be a major barrier for extraction of large molecular weight RNA from stationary phase cells (Uppuluri, Perumal et al. 2006). Clusters IV and V: Drug resistance and virulence genes Change in phenotype is a major, but not the only mechanism by which C. albicans can protect itself from antifungal drugs. C. albicans can express many genes coding for different multidrug efflux pumps, thus conferring resistance to the very potent azole family of fungicides (White, Marr et al. 1998; Lyons and White 2000). Besides other genes involved in processes leading to a high basal resistance towards antifungal drugs such as PMT4 and orf19.6382 (Gaur et al., 2005; Prill et al., 2005), we found the C. albicans drug efflux pump gene CDR1 upregulated first at the post diauxic phase and remaining elevated throughout the stationary phase. Lyons and White, 2000, have also reported an identical expression pattern and suggested that this efflux pump perhaps helped in the riddance of toxins that accumulate during stationary phase (Lyons and White 2000; Gaur, Choudhury et al. 2005; Prill, Klinkert et al. 2005). If diauxic shift (3d) was the phase when C. albicans had improved adherence properties, the yeast expressed many virulence genes by stationary phase (5d). Secretory aspartyl proteases (SAP) are one of the major virulence factors of C. albicans (Tavanti, Pardini et al. 2004; Andes, Lepak et al. 2005). Our present gene expression studies showed that although most of the C. albicans SAP genes had similar levels of transcription throughout the time course, some of these had a small but significant
48
increase in the stationary phase (~ 1.5 fold). However, a few other putative C. albicans virulence genes such as those induced during infection in murine kidney, were upregulated more robustly at or beyond 5d. Just like post-diauxic phase, mitochondria associated genes were also upregulated in stationary phase. Screening mutants of known S. cerevisiae stationary phase genes suggested that mitochondrial function was critical for the entry into stationary phase in that organism (Martinez, Roy et al. 2004). Screening of C. albicans transcription factor and cell wall mutants Unlike S. cerevisiae, whole genome mutants for C. albicans are not yet available. However, strains bearing mutations in many (but not all) C. albicans transcription factors as well as cell wall associated genes are readily available. To determine whether any of these regulatory genes might be essential for stationary phase, we screened 83 putative C. albicans transcription factor and 22 cell wall genes. All 105 mutant strains grew as well as the wild type strain for the first 3 days. Between 4 and 11 days, 34 and 17 mutants showed moderate and severe growth defects respectively (Fig 3.8). Of the strains showing severe growth defects, 2 were cell wall mutants (WSC1 and SUN41) while 15 were transcription factor mutants. A total of 7 mutants (including one cell wall mutant, WSC1) showed a major growth defect at 4d compared to the wild type cells (Table 3.2). These strains bore defects in genes important for various functions such as gluconeogenesis (GAL4, RMD2), lysine biosynthesis (LYS142), biofilm formation (BCR1) and maintenance of cell wall integrity (WSC1) (Fig 3.8A). The remaining two genes (orf19.1694 and STP4) had unknown functions. Ten strains showed fatal growth defects later in the time course - 6d (3 mutants), 8d (5 mutants) and 11d (2 mutants). At 11d, even the control showed defects characterized by slow growth that manifested into pinpoint colonies (Fig 3.8C). However, the mutant strains exhibited more severe growth defects. The strains showing fatal growth defects in stationary phase (6d to 11d) carried deletions in genes coding for C. albicans cell wall proteins (SUN41), for proteins involved in C. albicans steroid biosynthesis (ZCF17) (Fig 3.8A,B) and proteolytic processing (STP1). Five mutants harbored defects in genes having unknown functions in C. albicans, but were orthologs to
49
S. cerevisiae genes that had various functions. These genes were, orf19.2315 (ScRTG3) (Fig 3.8B) - a gene involved in S. cerevisiae mitochondrial signaling pathway and conferring longevity, orf19.173 (ScAZF1) - a mitochondrial genome maintenance gene, CaZCF34 (ScHAP1) - a gene important for aerobic respiration, orf19.1589 (ScRRN7) - a gene involved in rDNA transcription by Pol I, and CaUME7 - a gene having unknown functions in C. albicans, but orthologous to ScUME6 that is important for meiosis and sporulation in S. cerevisiae (Fig 3.8C). Lastly, we identified 2 mutants that had mutations in genes having unknown functions in both C. albicans and their S. cerevisiae orthologs – SEF1 and ZCF28. To complement the drop plate mutant screening results, we performed viable counts for each of the 17 mutants showing severe growth defects. We found that the day of severe defect by drop plate screening, and the day at which the viable (colony) counts of the individual mutants reduced drastically, was essentially identical for 14 mutants. For the remaining 3 mutants (RRN7, AZF1 and SEF1) the reduction in viable counts showed a delay of 2 days. Since we screened the mutants every other day and not everyday, it could be possible that delay was shorter than 2 days. Ten out of the 17 stationary phase defective mutant genes were differentially expressed in our microarray analysis, while the remaining 7 genes showed a steady level of expression throughout (Table 3.2). Two genes falling into the later category were the S. cerevisiae orthologs of C. albicans transcription factors involved in gluconeogenesis and upregulated in S. cerevisiae post-diauxic phase - RMD5 and GAL4. GAL4 has a completely different function in C. albicans (regulation of glycolysis and TCA cycle genes) than S. cerevisiae (galactose metabolism) (Martchenko, Levitin et al. 2006). Also function of RMD5 in C. albicans is not yet known. It has been recently discovered that functions of many transcription factors, in C. albicans are rewired compared to S. cerevisiae (Ihmels, Bergmann et al. 2005). Hence, although the two C. albicans transcription factors may not be involved in gluconeogenesis, a steady expression state of these two genes is probably essential for C. albicans growth in the post diauxic phase.
50
Mutation in one other gene AZF1, having unknown function in C. albicans, but involved in mitochondrial genome maintenance in S. cerevisiae, lead to severe compromise in viability after 6 days of growth. A similar growth defect was observed in S. cerevisiae. Our microarray results revealed that the level of AZF1 expression was similar both in glucose abundant (exponential phase) and in glucose deficient postdiauxic and stationary phase. This was in accordance with the protein expression pattern of S. cerevisiae Azf1 protein (Slattery, Liko et al. 2006). This re-emphasizes the observation that steady state expression levels of some genes are essential for C. albicans survival in stationary phase. On the other hand, two more mitochondrial associated genes RTG3 and HAP1 showed microarray gene expression-specific growth defect at 6 days. The mutant screening results and differential gene expression patterns revealed that just like in S. cerevisiae, the mitochondrion played a critical role, both in the C. albicans post diauxic phase and stationary phase. However, for a majority of mutant strains (10/17), the day of severe growth defect in the individual mutant strains correlated well with the day when the gene showed the greatest change in microarray expression (Table 3.2).
51
Day 4
A
2x104
2x103
2x102
2x101
B
Day 8
Control
Control Severe defect ZCF17
Moderate defect ZCF17
Severe defect RTG3
Severe defect WSC1
C
Day 11
Control Severe defect UME7
Figure 3.8 Screening of C. albicans transcription factor and cell wall mutants by drop plate method. Mutant strains were examined for survival during various phases of growth at 30oC.
52
Table 3.2. Correlation between microarray gene expression and reduction in viability of the mutant strains. For ten genes, the day of severe growth defect in the individual mutant strains corresponded with the day when the gene showed the greatest change in microarray expression. For the remaining seven there was no significant change (NC) in the microarray Log2 values at any of the time points.
53
CHAPTER IV CANDIDA ALBICANS SNO1 AND SNZ1 EXPRESSED IN STATIONARY PHASE PLANKTONIC YEAST CELLS AND BASE OF BIOFILM Abstract The Candida albicans orthologs of the most studied Saccharomyces cerevisiae stationary-phase genes, SNO1 and SNZ1, were used to test the hypothesis that, within a biofilm, some cells reach stationary phase within continuously fed, as well as static, C. albicans biofilms grown on dental acrylic. The authors first studied the expression patterns of these two genes in planktonic growth conditions. Using real-time RT-PCR (RT-RTPCR), increased peak expression of both SNZ1 and SNO1 was observed at 5 and 6 days, respectively, in C. albicans grown in suspension culture. SNZ1–yellow fluorescent protein (YFP) and SNO1–YFP were constructed to study expression at the cellular level and protein localization in C. albicans. Snz1p–YFP and Sno1p–YFP localized to the cytoplasm with maximum expression (>90 %) at 5 and 6 days, respectively, in planktonic conditions. When yeast growth was reinitiated, loss of fluorescence began immediately. Germ tubes and hyphae were non-fluorescent. Pseudohyphae began appearing at 9 days in planktonic yeast culture and expressed each protein by 11 days; however, the cells budding from pseudohyphae were not fluorescent. Biofilm was formed in vitro under either static or continuously fed conditions. Increased expression of the two genes was shown by RT-RTPCR, beginning by day 3 and increasing through to day 15 (continuously fed biofilm). Only the bottommost layer of acrylic-adhered cells in the biofilm showed 25 and 40 % fluorescence at 6 and 15 days, respectively. These observations suggest that only a few cells in C. albicans biofilms express genes associated with the planktonic stationary phase and that these are found at the bottom of the biofilm adhered to the surface.
54
Introduction Candida albicans is capable of forming a biofilm on mucocutaneous surfaces, as well as on medical devices such as dentures and catheters (reviewed by Douglas, 2003; Kumamoto & Vinces, 2005; Mukherjee et al., 2005). Sixty-five percent of edentulous individuals suffer with denture stomatitis and 40 % of patients with intravenous catheters develop acute fungaemia due to the growth of C. albicans biofilms on the associated biomedical devices. Biofilms also show enhanced resistance to antifungal drugs. In vitro, biofilms have been shown to form on catheter, polymethylmethacrylate (denture acrylic) and polystyrene surfaces (Douglas, 2003; Kumamoto & Vinces, 2005; Mukherjee et al., 2005). C. albicans forms a biofilm in three distinct developmental stages. The bottommost layer of adhered yeast cells act as founder cells, anchoring the developing biofilm to the substrate. The middle layer is composed of hyphae and pseudohyphae, and the topmost part of the biofilm consists mostly of a thicker and open hyphal layer and more extracellular matrix (ECM) (Baillie & Douglas, 1999; Chandra et al., 2001; Ramage et al., 2001). After 48 h, these biofilms range in thickness from 25 to >450 µm and are metabolically active communities of cells interspersed with ramifying water channels. The structural complexity of the biofilm may create a gradient of environmental conditions in which the C. albicans cells enter distinct physiological states. One such state may be equivalent to that of stationary-phase planktonic yeast cells, and, in particular, the founding yeast cells at the surface of the substratum may cease growing. The stationary phase and the genes involved in its progress and maintenance have not yet been well characterized in C. albicans, although several genes have been reported to show increased expression as active growth slows (Lamarre et al., 2001; Moreno et al., 2003). In this study, we investigated the expression patterns of the C. albicans orthologs of the two most studied stationary-phase genes in Saccharomyces cerevisiae, SNO1 and SNZ1. We first determined whether the expression pattern of these genes, monitoring both RNA and protein, was associated with the stationary phase of planktonic yeast cells, hyphae and pseudohyphae. We then used these two genes as indicators of the stationary phase to study the physiological state of the cells in a biofilm.
55
Methods Organisms and growth conditions. C. albicans SC5314 or CAI4 (obtained from William Fonzi, Georgetown University Medical Center) was maintained on YPD medium (1 % yeast extract, 2 % peptone, 2 % glucose)-containing 2 % agar plates. Planktonic yeast cell cultures were grown in yeast nitrogen base (YNB) medium with amino acids (Difco Laboratories) containing 2 % glucose at room temperature on a gyratory shaker (180 r.p.m.). Hyphae were induced by inoculating 1x107 yeast cells ml–1 from 24 h culture into YNB medium at 37 °C and incubated with shaking for 2 h or 2 days. For stationaryphase studies, seven flasks (one for each time point) containing YNB broth (200 ml) were inoculated with 5x105 yeast cells ml–1 from an overnight culture in YNB. The cells were harvested by centrifugation at 4 °C and maintained at –80 °C before RNA isolation. Cell viability was determined as c.f.u. by plating replicate dilutions of planktonic cells prepared in sterile water on YPD plates and incubating at 37 °C for 24 h. Colonies were enumerated manually and the mean determined. Particles in suspension culture were determined by use of a haemocytometer and by OD595 measurement. Denture acrylic (polymethylmethacrylate) pieces (1.0 cm2 square or 90x20x1.5 mm) prepared by Dr Thomas McKinney (Baylor College of Dentistry, Dallas, TX) were used to support the biofilm formation in two model systems. Pieces of acrylic were placed in disposable polystyrene dishes (35x10 mm). A suspension of yeast cells (4 ml) grown to a density of 1x107 cells ml–1 in YNB was added to the dish and incubated for 2 h at 37 °C without shaking. The liquid was gently aspirated; 4.0 ml fresh medium was added and incubated for 6 days. Alternatively, the strips were placed in a 50 ml syringe barrel with a yeast suspension and then washed with YNB to remove non-adhered cells, before starting YNB medium flow through the syringe at 50 ml h–1 at 37 °C. Sterile air was supplied into the medium at 1 l h–1. Acrylic pieces were removed, washed gently by dipping in PBS (10 mM phosphate buffer, 2.7 mM KCl and 137 mM NaCl, pH 7.4). For microscopy, the top matrix layer, mostly consisting of hyphae, was collected by very gently dipping and shaking the washed biofilm in PBS. The middle layer, composed of yeast, pseudohyphae and some hyphae, was collected using sterile forceps, while the bottommost acrylic-
56
adhered layer, composed exclusively of yeast cells and germ tubes, was collected by scraping the thoroughly washed acrylic using a scalpel and ice-cold water. Similar distribution of the three forms of C. albicans was observed from at least four independent biofilms. Differences in expression were determined by
ANOVA
(P 0.05). The viability of
the recovered cells from three biofilms was determined at 20 days, as described above. RNA extraction Total RNA was isolated using the standard hot acid phenol method following grinding frozen cells using a mortar and pestle in liquid nitrogen (Uppuluri et al., 2006a; Chapter II). The RNA preparation was DNAse treated and the absence of DNA contamination was confirmed with the housekeeping gene EFB1 (Maneu, Martinez et al. 2000). RNA quality and quantity were determined as described (Uppuluri, Sarmah et al. 2006). Real time RT-PCR (RT-RTPCR) The amount of mRNA in the total RNA was quantified with the Poly (A) mRNA Detection System kit. (Promega, Madison, WI). cDNA was synthesized from known amounts of mRNA, and equal amounts of cDNA were used as starting template for RT-RTPCR. The detailed protocol for RT-RTPCR analysis is described by us elsewhere (Chapter II). Construction of strains expressing fluorescent fusion protein C. albicans transformations were carried out using the Alkali-Cation Yeast kit (Qbiogene). Genomic DNA from C. albicans CAI4 strain was obtained by standard methods (Adams et al., 1997). For construction of the yellow fluorescent protein (YFP) fusion protein, the method of Gerami-Nejad et al. (2001) was used (Schematic Fig 4.1). Briefly, PCR was performed using primers with 5'ends corresponding to the SNZ1 or SNO1 target gene sequences and 3'ends that directed amplification of the YFP gene along with the selectable marker URA3. The primers used are listed in Table 4.1.
57
Table 4.1 Primers used in this study. Primers were used for obtaining full-length ORFs (full) and short sequences, and for verification (v) of the gene–YFP constructs. The direction of primers is indicated as forward (F) or reverse (R). Primer
Sequence (5’-3’)
SNO1 F SNO1 R SNZ1 F SNZ1 R SNO full F SNO full R SNZ full F SNZ full R
TCAAACCCGGACGAATATGC TCTCCGCCAGGAATAACCAA CAATTGGGATGTGATGGTGTTT TTGTAGTGAGTGGTAGCGTTGACA GTCTGATGAAAGTTCAACTTC CTGTCTGTATTTCTTTTGTG CAACAACCTTTGTAAATAACCAAC CATAGATATATATACAAGGTTTC
FOR RT-RTPCR
FOR SNO1-YFP AND SNZ1-YFP CONSTRUCTION SNO1-YFP F SNO1-YFP R SNZ1-YFP F SNZ1-YFP R
CTTGATGAGTTTGTGATAAAGAAACTGCAACAATATATTGATAGAATAATAGGTGG TGGTTCTAAAGGTGAAGAATTATT CAACTGTGATTTAGTACTCTCTCTCTACTACTTACTTACTTCCTATACACACAAGATC TAGAAGGACCACCTTTGATTG ATTGCCATTGATTCAATTAAAGAAGAAGAGAAATTGGAAAAAAGAGGCTGGGGTGG TGGTTCTAAAGGTGAAGAATTATT TTATGTCCACAAAATCATTGTTTACTCCTCCATACAACAGAAATCAACTATCCATATC TAGAAGGACCACCTTTGATTG
FOR VERIFICATION SNOYFP Fv SNZYFP Fv ADH1 Rv
CCAGAGCTAGCTGAGGATTA TATTCAACTGATTTGGGTGAATTGAT CACAGTGGATCCAGACAATG
PCR was performed with 100 ng pYFP-URA3 (cassettes obtained from Cheryl Gale, University of Minnesota) as the template, 0.6 µM each primer, 3.5 mM MgCl2, 5 µl 10xPCR buffer, 0.4 mM each dNTP, and 2 U Expand High Fidelity Polymerase (Roche Applied Science). The 50 µl reactions were run for 94 °C for 4 min, then for 25 cycles at 94 °C for 1 min, 60 °C for 1 min and 72 °C for 3 min, followed by 72 °C for 10 min. The products from 10 reactions were pooled, precipitated with ethanol, resuspended in 50 µl water, and used to transform C. albicans CAI4 and URA3 recombinants selected in YNB without uridine. Identification of transformants carrying the integrated cassette was performed by PCR on genomic DNA with a primer that annealed within the
58
transformation module and a second primer annealing to the 3’ region located outside the module.
Plasmid name pYFP – URA3
PCR Forward Primer (FP): 80bp ( 20bp GFP + 60bp SNO1/SNZ1 structural gene overhang) Reverse Primer (RP): 79bp ( 23bp URA3 + 56bp SNO1/SNZ1 structural gene overhang)
SNO1/SNZ1
FP RP
SNO1/SNZ1
PCR Product (used for transformation)
SNO1/SNZ1
YFP
ADH1 ter
URA3
SNO1/SNZ1
Continued…..
59
Transformation SNO1/SNZ1
YFP
ADH1 ter
URA3
SNO1/SNZ1
Homologus recombination
Genomic DNA; SNO1/SNZ1 ORF
PCR product integrated into the C. albicans genomic DNA
SNO1/SNZ1
YFP
ADH1 ter
URA3
SNO1/SNZ1
P Verification
SNO1/SNZ1
YFP
ADH1 ter
FP URA3
SNO1/SNZ1
P RP
verification
Marker
900bp
Fig 4.1 Schematic representation of construction of the fluorescent construct, recombination into C. albicans genomic DNA, and verification. P = Promoter
60
Fluorescence microscopy.
For fluorescence microscopy, cells were used without
fixation. YFP-tagged proteins were visualized in live cells with an Olympus IX71 microscope with appropriate filters. Images were captured and documented using a Photometrics Cool Snap HQ digital camera and analyzed with Meta Morph software. For localization, a bright-field image and a fluorescent image were first pseudo-coloured green and red, respectively. The resultant images were then merged. Results Viability of stationary phase organisms. In S. cerevisiae, the stationary phase has been associated with cultures that are at least 5 days old (Braun et al., 1996; Radonjic et al., 2005). Since most studies with C. albicans terminate experiments after 24–48 h of growth, we wanted to determine whether cells remain viable in culture for an extended period. We examined the ability of organisms cultured in YNB for 2 weeks to carry out cell division by determining the c.f.u. in the culture during the stationary phase (Fig. 4.2). Cells did not lose viability for 10 days. At 2 weeks, >60 % of the cells were viable, after which there was a progressive decline in the number of cells forming colonies. On day 9, there was appearance of pseudohyphae in an appreciable fraction of cells ( 30 %).
FIG.4.2. Viability of cells from culture grown in YNB for extended periods. Viability was analysed at different times of growth by cell counts (open circles) using a haemocytometer and colony formation (solid circles) on YPD plates.
61
Expression of SNZ1 and SNO1 during planktonic growth
To initiate our study of the
stationary phase of C. albicans, we used RT-RTPCR to examine the expression of the two genes, SNZ1 and SNO1, predicted to be indicative of the stationary phase. In S. cerevisiae there are three pairs of SNZ and SNO genes. The two genes of each pair are adjacent and divergently transcribed (Balakrishnan et al., 2002). A single SNZ and SNO gene pair was found in the annotated C. albicans genome (Arnaud et al., 2005) and a (Altschul et al., 1997) BLAST search did not reveal other unannotated pairs. SNZ1 (Orf19.2947) and SNO1 (Orf19.2948) were adjacent and divergently transcribed, with a sequence of 1.5 kb separating the translation initiation sites. Transcripts of the two genes were quantified at intervals during progression into the stationary phase (Fig. 4.3A). Although a small peak in expression was noted on day 2, the greatest expression for SNZ1 was reached on day 5, after which the transcription declined. There was a 67-fold increase in expression between day 1 and day 5. For SNO1, there was decreased expression up to day 4, followed by increased expression that peaked on day 6, after which expression declined. The increased expression at day 6 was 10.5-fold higher compared to that on day 1. In addition to a 1 day difference in peak expression, SNZ1 transcript (5.6x106–3.8x108) was more abundant than SNO1 transcript (4.2x105–4.2x106) at all intervals measured, and the increase between day 1 and the peak of expression was greater for SNZ1 (67-fold) compared to SNO1 (10.5-fold). The expression of these genes began to increase after the cell numbers stopped increasing and the pattern was consistent with that of genes with preferential expression in the stationary phase. Biofilm formation and gene expression. C. albicans has been studied most frequently as planktonic cells in suspension culture. However, the organism can grow in both in vivoand in vitro-produced biofilms. In biofilms, both yeast cells and hyphae are observed in an ECM-covered community (Baillie & Douglas, 1999, 2000; Chandra et al., 2001). To determine if some organisms in a biofilm reach a physiologic state in which the SNZ1 and SNO1 markers for stationary phase are expressed, we examined biofilms formed under two conditions. Biofilms were formed on pieces of acrylic in YNB from a yeast-cell
62
inoculum under static conditions, i.e. maintained without shaking for the duration of the experiment. There was an 1.5- and fourfold increase in SNZ1 and SNO1 expression, respectively, between day 1 and day 6 (Fig. 4.3B). However, overall expression of both genes in biofilm conditions at day 6 was at least 25 times less than the maximum that was recorded under planktonic conditions. The reduced expression in the biofilm compared to planktonic cells could be attributable to the heterogeneous nature of the biofilm, which contains hyphal, pseudohyphal and yeast organisms, or to the presence of growing organisms responsible for the release of primarily yeast cells from the biofilm. To address these possibilities, we used a different system for biofilm formation. Biofilms were formed under flow conditions that replenished medium and permitted the biofilm to be maintained for 15 days. To answer the question of whether the bottommost layer of the biofilm formed from founder yeast cells reaches the stationary phase earlier than the rest of the biofilm, we separated two layers of the biofilm. We collected the bottommost adhered layer and the upper layers of the biofilm separately to monitor gene expression of the two stationary-phase genes, again, at various time points (Fig. 4.3C, D). We found that, in flow conditions, the level of expression of both the genes in the upper layers of the biofilm decreased over 15 days. When gene expression changes were monitored in the bottommost adhered cells of the biofilm, a different pattern of expression was revealed. Expression of both the genes was observed on day 1 and increased over the 15 days.
63
FIG. 4.3. Expression of SNZ1 and SNO1. RT-RTPCR analysis of SNZ1 and SNO1 transcripts was determined and is shown as copy number. Expression patterns of SNZ1 (open triangles) and SNO1 (solid triangles) in planktonic conditions (A), in static biofilm conditions (B), in upper layers (C) and in bottommost adhered cells (D) of the biofilm formed under flow conditions, are shown. Protein localization of Snz1p–YFP and Sno1p–YFP in planktonic cells. We used YFP cassettes to tag SNZ1 and SNO1 in C. albicans, and observed the localization and expression of the two encoded proteins under different growth conditions and morphologies. Fluorescence was observed for both proteins in yeast cells (Fig. 4.4A, B). The proteins were then localized within the cells. When bright-field and fluorescent images were compared visually, fluorescence could be easily localized within the cytoplasm (Fig. 4.4A, B). The two images were pseudocoloured green and red using the Meta Morph software and then merged (Fig. 4.5C). This method confirmed that the two proteins localized to the cytoplasm.
64
Fig. 4.4. Expression of Snz1p–YFP by yeast cells and pseudohyphae. Yeast cells from a 5-day culture (A, B) and pseudohyphae from an 11-day culture (C, D) were examined for organisms exhibiting fluorescence using bright-field (A, C) and fluorescence (B, D) imaging. Arrows indicate non-fluorescent buds being formed from fluorescent pseudohyphae. Sno1p–YFP showed a similar expression pattern and is not included in the figure. Bar, 5 µm.
65
Fig. 4.5. Localization of Sno1p–YFP in yeast cells. Sno1p–YFP yeast cells were examined using bright-field (A) and fluorescence imaging (B). The two images were pseudocoloured green and red, respectively, and merged using the Meta Morph software for localization (C). Thin arrows indicate non-fluorescent vacuoles and block arrows indicate non-fluorescent cell wall. Snz1p–YFP showed a similar localization pattern and is not included in the figure. Bar, 30 µm. Protein expression in planktonic cells
Planktonic yeast cells began expressing both
proteins after 3 days in culture (Fig. 4.6A). About 25 % of cells expressed Snz1p–YFP on day 4 and >90 % expressed the protein on day 5. On day 6, there was a greater than threefold decrease in the fluorescent cells. Expression of Sno1p–YFP began a day later than Snz1p–YFP. About 40 % of cells expressed Sno1p–YFP on day 5, while >90 % expressed it on day 6. The expression of Sno1p–YFP did not decrease in the subsequent 7 days (data not shown). We next examined the fate of fluorescence when yeast cells resumed growth. Fluorescent cells, expressing either gene when inoculated into fresh medium, lost fluorescence within 24 h (Fig. 4.6B).
66
Fluorescent cells (%)
100
A
80 60 40 20 0 1
3
4 Days
5
6
7
B
120 Fluorescent cells (%)
2
100 80 60 40 20 0 0
3
7
11
15
18
21
24
Hours
Fig. 4.6. Expression of Snz1p–YFP (solid squares) and Sno1p–YFP (solid diamonds) during progression into and exit from the stationary phase. Cultures of each strain were grown in YNB and the proportion of fluorescent cells was determined daily for 7 days (A). Five-day-old cultures of strains expressing either Snz1p–YFP or Sno1p–YFP were diluted and resuspended in fresh medium and the proportion of fluorescent cells was determined at various intervals (B). Protein expression in biofilm organisms. We first examined expression of both Snz1p– YFP and Sno1p–YFP in a static model of biofilm formed on acrylic placed in the well of a polystyrene plate. On day 6, there were more fluorescent cells (P 0.01) in the bottommost layer of adhered cells (25 %) than in the upper biofilm layer (11 %). Biofilms were formed in the second model system under flow conditions in which medium was continuously replenished (Fig. 4.7A–C). No fluorescence was observed in the uppermost
67
layer which mainly contained hyphae, even though hyphae had been present in the biofilm from the first day. A few fluorescent organisms were observed in the middle layer, which had mixed morphologies. As in the static biofilm formation, 25 % of the bottommost adhered cells were fluorescent at day 6; the additional days of growth in the flow system showed that the number of fluorescent cells increased to 40 % on day 15. The bottommost layer of adhered yeast cells recovered from the biofilm retained 88 % viability (1x107 out of 1.2x107 cells), even up to 20 days.
Fig. 4.7. Expression of Sno1p–YFP in different layers of a 6-day-old biofilm.
Three
layers, bottommost adhered (A), middle (B) and top (C) were separated from a continuously fed biofilm and examined by bright-field (top row) and fluorescent (bottom row) microscopy. Snz1p–YFP showed similar expression patterns and is not included in the figure. Bar, 5 µm. Approximately 40% of the bottom-most adhered layer of yeast cells, 11% of the middle layer and 1% of the top-most hyphal layer showed fluorescence.
68
Discussion C. albicans forms a structurally complex biofilm. A mature 36–48 h-old biofilm formed in YNB medium contains the three major morphological forms of C. albicans: yeast, hyphae and pseudohyphae (Baillie & Douglas, 1999; Chandra et al., 2001; Ramage et al., 2001). This 450 nm-thick mature biofilm is also interspersed with water channels and is sheltered by an ECM. Thus, such a varied, closely packed community of cells may lead to a gradient of environmental conditions within the biofilm, in which the C. albicans cells may enter distinct physiological states. The goal of this study was to determine if C. albicans cells in a biofilm reach a physiologically similar state to that of planktonic stationary-phase C. albicans cells. However, the stationary phase in C. albicans has not been characterized, and our first steps were to confirm that cells remained viable in planktonic culture after the increase in cell number ceased (Fig. 4.2), and to identify a marker for the planktonic C. albicans stationary phase. Drawing on some paradigms represented by S. cerevisiae, we initiated a study to verify the expression patterns of the C. albicans orthologs of the two most studied stationary-phase genes in S. cerevisiae, SNO1 and SNZ1. In S. cerevisiae, there are three pairs of SNO and SNZ genes. The genes of each pair are adjacent and divergently transcribed (Balakrishnan et al., 2002). The pairs are coordinately regulated with both the SNO2–SNZ2 and SNO3–SNZ3 pairs which are expressed prior to diauxic shift and the stationary phase (Arnaud et al., 2005). Only a single pair of SNO–SNZ genes was found in C. albicans, and they were adjacent and divergently transcribed. We found that, in planktonic-grown C. albicans, the expression of SNZ1 and SNO1 appeared during entry into the stationary phase, peaking several days later (Fig. 4.3A). Expression of SNZ1 peaked on day 5, 1 day before SNO1 peak expression, and the level of SNZ1 expression and the magnitude of increase were greater than those of SNO1. This paralleled the observations in S. cerevisiae for SNZ1 and SNO1 (Braun et al., 1996). However, in a mutant strain of S. cerevisiae, in which SNO1–SNZ1 is the only pair of genes present, the genes are expressed prior to diauxic shift (Braun et al., 1996). Based on this analogy, we might have expected the C. albicans SNO1 and SNZ1 expression to
69
parallel that of the S. cerevisiae mutant strain. This was not observed. Thus, it would seem that the function of SNZ and SNO genes prior to the stationary phase is dispensable in C. albicans. Snz1p–YFP expression was detected at 3 days (Fig. 4.6), perhaps reflecting the transient increase in transcript level seen on day 2 (Fig. 4.3A). The peak protein expression was observed on day 5, coincident with peak transcript level (Fig. 4.4A, B). This suggests that the increase in transcript level is derived from an increase in most cells of the population rather than in only a few cells. Sno1p–YFP expression began increasing on day 2 (Fig. 4.6A), at the same time that transcription level showed a small decrease. Maximum expression was reached on day 6, coincident with the peak transcription level. Unlike Snz1–YFP, Sno1p–YFP continued to be observed in cells, even though the transcription level began to decrease on day 7. The greater stability of Sno1p–YFP compared to that of Snz1p–YFP may explain the increase in the number of fluorescent cells at low transcript levels, as the protein accumulates and the fluorescent cells persist even when the peak transcript level declines. However, when stationaryphase planktonic yeast cells resumed growth, the number of fluorescent cells began decreasing immediately, such that only a few fluorescent cells were detected in the growing culture (Fig. 4.6B). The fluorescent cells decreased at a similar rate for both proteins, suggesting that, when the cell resumed growth, the proteins expressed for the stationary phase were lost. When protein expression was examined in hyphae, no fluorescence was observed (data not shown). Subapical compartments are arrested in G1 phase, are extensively vacuolated, and have very little cytoplasm (Barelle et al., 2003). Two possibilities for the lack of fluorescence in hyphae are that the G1-arrested, nongrowing state of subapical hyphal cells is different from that of the G1 stationary-phase yeast cells, or that the expression in the small amount of cytoplasm of these subapical cells is below the level of detection. When pseudohyphae were observed in planktonic yeast cultures, they were fluorescent, but daughter buds were not. Since the buds were growing, this is consistent with the loss of fluorescence when cells resume growth, and also suggests that the partition of cytoplasm between parent and daughter cells did include the same level of stationary-phase protein found in the mother cell.
70
As expression of these two genes is a marker for stationary-phase planktonic yeast cells, we used the two genes to determine if cells within a biofilm reach a physiological state in which these genes are expressed. Biofilms were formed on denture acrylic under static conditions and under conditions of continuous medium flow. When formed under static conditions, expression increased over the 6 days of observation. As in planktonic yeast cells, SNO1 was expressed at a higher level than SNZ1 (Fig. 4.3B). However, both genes were expressed at 4 % of the maximum expression of planktonic yeast cells. Under conditions of medium replenishment, in which the biofilm could be observed for >2 weeks, expression was determined in the upper layers of the biofilm and in the cells adhered to the substrate (Fig. 4.3C, D). Expression from the upper-level biofilm organisms decreased by day 6 and remained at lower levels. In contrast, expression in the adhered cells increased and was about 100-fold higher than that in the upper layers and 5– 11-fold higher than that in the static biofilm. At 15 days, levels of SNZ1 and SNO1 in the adhered cells were only five and 2.4 fold less than their peak expression levels in 5 and 6 day old planktonic cells, respectively. These adhered cells are likely to be founder cells of the biofilm and therefore older, and may show less proliferation than cells at the periphery of the biofilm. When protein expression was examined in cells from different portions of the biofilm, the organisms at the top were almost exclusively hyphal and non-fluorescent, as seen in planktonic cultures (Fig. 4.7). Most of the fluorescent cells were found adhered to the substrate. The number of fluorescent cells increased between days 3 and 6, as did gene expression (Fig.4. 3). The 15 day continuously fed biofilm, with 40 % of the adhered yeast cells showing fluorescence and a 2.5–5-fold reduction in gene expression level for the cell population, suggests that the level of expression in the fluorescent cells may be similar to that of planktonic, 5–6-day stationary-phase yeast cells. Although hyphae were present in the biofilm from day 1, no fluorescence was observed and, as with planktonic hyphae, this may have arisen from a difference in the G1 state of subapical compartments, or an inability to detect fluorescence in the reduced cytoplasm of these cells.
71
The proteins were localized in the cytoplasm (Fig. 4.5). In a genome-wide S. cerevisiae study, Snz1p could not be localized by green fluorescent protein (GFP) fusion, due to low GFP expression signals or to other technical difficulties, while a low-level cytoplasmic fluorescence was noted for Sno1p (Huh et al., 2003). The greater level of fluorescence in this study may reflect a higher level of expression of these proteins in C. albicans, or the successful tagging of the protein. In summary, C. albicans has a single pair of SNZ and SNO genes that was expressed in the stationary phase of planktonic yeast cells but not in hyphae. Proteins were localized in the cytoplasm and >90 % of 5 and 6 day stationary-phase yeast cells expressed the proteins. Expression of these genes was less in biofilms, whether formed under static or medium-flow conditions. Expression of the genes increased during biofilm formation and was primarily associated with founder yeast cells adhered to the substrate. This finding suggests that some cells at the base of a biofilm either were in the stationary phase or had reached a physiological state in which genes associated with the stationaryphase planktonic yeast cells were expressed.
72
CHAPTER V EFFECT OF FARNESOL AND CONDITIONED MEDIUM ON CANDIDA ALBICANS GENE EXPRESSION AND YEAST GROWTH Abstract During C. albicans yeast cell growth to early stationary phase, metabolites accumulate in the medium, including the quorum sensing molecule farnesol.
Both
farnesol and 75% conditioned medium (CM) inhibited germ tube formation while >100 M farnesol delayed resumption of yeast cell growth. Transcriptional analysis of yeast cells resuspended in fresh medium with or without 40 M farnesol or in 75% CM under germ tube induction conditions revealed differential expression of 406 genes. Farnesol upregulated genes were involved in lipid metabolism, mitochondria and peroxisome maintenance and nucleic acid transport. Besides hyphal genes, the downregulated genes encoded GTPase activators, proteins involved in mitosis, DNA replication and adherence. Genes involved in nuclear division and microtubule organization were upregulated, while those coding for ribosomal proteins were downregulated in presence of 75% CM. Farnesol mediated delay in resumption of yeast growth was relieved by addition of a diacylglycerol analogue, implicating phosphatidylinositol signaling in the delay. Diacylglycerol is an activator of protein kinase C (PKC) in mammalian cells; however, fungal PKCs are not responsive and this was confirmed with a C. albicans PCK1 mutant. Introduction C. albicans is a commensal of the human oral, gastrointestinal, vaginal and cutaneous surfaces. However, when the balance of the normal flora is altered, during antibiotic or hormonal therapy, or in conditions when the skin is exposed to moisture for prolonged periods of time, C. albicans can cause painful cutaneous or subcutaneous infections such as, vaginitis, oral thrush, diaper rash, conjunctivitis, or infections of the nail and rectum. In immunocompromised individuals, such as immunosuppressed patients undergoing cancer chemotherapy, C. albicans can be responsible for life
73
threatening diseases only when it enters the blood stream. It is then capable of affecting almost any part of the body and causing hepatosplenic abscesses, myocarditis, central nervous system or pulmonary infections. Additionally, C. albicans can form biofilms on host surfaces as well as abiotic device surfaces such as dentures and catheters (Kumamoto and Vinces 2005; Mukherjee, Zhou et al. 2005). Catheter-related infections due to Candida albicans biofilms are a leading cause of fungal nosocomial bloodstream infection. Biofilm cells are resistant to most antifungal agents making biofilm related infections hard to treat. In vitro, planktonic C. albicans yeast cells in suspension culture, after having reached a certain concentration, stop growing and enter stationary phase. During growth to stationary phase, cells release metabolites into the medium, including molecules that may have a quorum sensing function (Hornby, Jensen et al. 2001; Chen, Fujita et al. 2004). In an in vitro C. albicans biofilm, some yeast cells in the bottom-most adhered layers of the mature biofilm reach stationary phase (Uppuluri, Sarmah et al. 2006). Mature biofilms also produce quorum sensing molecules (Ramage, Saville et al. 2002). The culture supernatant or CM may be recovered by filter sterilization (Hornby, Jensen et al. 2001; Ramage, Saville et al. 2002; Chen, Fujita et al. 2004; Westwater, Balish et al. 2005). CM has been shown to abolish lag phase, stimulate germ tube formation, inhibit germ tube formation, and protect against oxidative stress (Hornby, Jensen et al. 2001; Chen, Fujita et al. 2004; Westwater, Balish et al. 2005). Farnesol and tyrosol have been purified from conditioned medium and shown to mediate such sometimes contradictory activities. Tyrosol accelerates the appearance of germ tubes in germ tube permissive conditions and reduces lag phase in C. albicans (Chen, Fujita et al. 2004). The effects of farnesol, another component has recently been reviewed (Nickerson, Atkin et al. 2006). Farnesol prevents yeast cell to germ tube transition and in turn inhibits biofilm formation (Hornby, Jensen et al. 2001; Ramage, Saville et al. 2002; Hornby, Kebaara et al. 2003). Microarray analysis (complete genome) comparing farnesol treated and untreated planktonic C. albicans cells in germ tube permissive conditions, reported a number of genes involved in processes such as hyphal formation, mitosis, fatty acid metabolism,
74
stress resistance and DNA damage (Enjalbert and Whiteway 2005). Microarray analysis (3102 Orfs) for the effect of farnesol on C. albicans biofilms revealed that many similar biological processes were affected (Cao, Cao et al. 2005). Farnesol contributes to the protection from oxidative stress (Westwater, Balish et al. 2005).
While a higher
concentration of farnesol (100 M) is reported to have a delaying effect on C. albicans resumption of yeast growth in glucose salts medium (Kim, Kim et al. 2002). At even higher concentrations, no effect was observed when cultures were observed after many hours of growth (Hornby, Jensen et al. 2001; Ramage, Saville et al. 2002).
Thus, the
metabolites in the CM have various effects on cells depending upon the environmental conditions and suggesting a complex cell response. Using Yeast Nitrogen Base (YNB) medium we confirmed that 75% CM and farnesol (40
M) prevented C. albicans germ tube formation.
However, since CM
contains a metabolite mixture, the cellular response may differ in some aspects from that of farnesol alone. To determine if there was a difference in gene expression when germ tubes were induced in the presence of CM or farnesol or medium alone, we used oligonucleotide microarrays. A number of genes were found to be differentially expressed between the three conditions, including genes involved in hyphal formation, DNA replication and mitosis, ribosome biogenesis and phosphatidylinositol type signaling. As phosphatidylinositol signaling has been implicated in control of cell wall integrity through protein kinase C (PKC), we examined the effect of farnesol and PKC activators on yeast cell growth and on a PKC1 deletion mutant. Methods Organism and growth conditions. C. albicans strain SC5314 was maintained on YPD (yeast extract 1% w/v, peptone 2% w/v, dextrose 2% w/v) agar plates and transferred to YNB (Yeast Nitrogen Base medium with amino acids, Difco Laboratories, Detroit, MI) with 50 mM glucose for suspension culture with shaking (180 rpm) at room temperature (RT).
The cells were recovered after 24 hours; subcultured in YNB medium and
incubated overnight at RT. CM was prepared by centrifugation followed by sterile
75
filtration to remove cells. Different dilutions of CM were prepared by mixing appropriate quantities of conditioned medium with fresh YNB medium. E,E-farnesol obtained as a 3.7 M solution (Sigma Chemical Co. St. Louis, MO) was diluted in 100% (vol/vol) methanol to obtain a 40 mM stock solution. Germ tubes were induced by inoculating yeast cells (1x106 cells/ml) from the 24 h culture into YNB medium, 75% CM and into YNB medium containing 40µM farnesol. The cultures were incubated at 370C with shaking for 2 h. To study the effect of farnesol on yeast cell growth, cells were grown for 24 hours at RT in YNB medium containing 10 µM, 25 µM, 40 µM, 100 µM and 300 µM farnesol. In agreement with other reports (Romandini, Bonotto et al. 1994; Yazdanyar, Essmann et al. 2001; Ramage, Saville et al. 2002), methanol alone at 0.75% (concentration at 300 µM farnesol) had no effect on growth (data not shown). The pH of some cultures was determined by measurement of cell free culture medium. In some experiments, farnesol was added after the cells had grown to a concentration of 1x107 cells/ml. C. albicans strains bearing a mutation in the protein kinase C gene, PKC1, was obtained from Dr. Aaron Mitchell, Columbia University. The parent C. albicans strain DAY185 and the PKC1 mutant strain were grown in YPD containing 1M sorbitol and subjected to different concentrations of farnesol and incubated as above. Diacylglycerol cell permeable analog, 1-oleoyl-2-acetyl-sn-glycerol (OAG) (Sigma Chemical Co.) was dissolved in DMSO to obtain a stock concentration of 2.5 mM. OAG (25 µM) was added to 12 h old and 48 h old cultures containing different concentrations of farnesol. The proportion of germ tubes was determined microscopically by counting at least 200 organisms using a haemocytometer. Cell size (for at least 1x106 cells/ml) and in some cases cell density were measured using a Z series Coulter counter (Beckman Coulter, Fullerton, CA). Protein kinase C activator phorbol 12-myristate 13-acetate (PMA) was obtained as a 10mM stock solution from Dr. Thomas Pressley, Texas Tech University Health Sciences Center. PMA (0.5 nM to 50 µM) were added to cultures containing 100 µM and 300 µM farnesol and the cell number counted using a haemocytometer.
76
Analysis of cellular DNA by fluorescence flow cytometry. Cells for flow cytometry were prepared as described elsewhere (Chapter III). RNA extraction Total RNA was isolated using the standard hot acid phenol method following grinding frozen cells using a mortar and pestle in liquid nitrogen (Uppuluri et al., 2006a; Chapter II). The RNA preparation was DNAse treated and the absence of DNA contamination was confirmed with the housekeeping gene EFB1 (Maneu, Martinez et al. 2000). RNA quality and quantity were determined as described (Uppuluri, Sarmah et al. 2006). Transcriptional analysis: The protocol for transcriptional analysis is described in detail in Chapter III. Real time RT-PCR (RT-RTPCR). The amount of mRNA in the total RNA was quantitated with the Poly(A) mRNA Detection System kit. (Promega, Madison, WI). cDNA was synthesized from known amounts of mRNA, and equal amounts of cDNA were used as starting template for RT-RTPCR. Analysis of transcript was carried out using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) in ABI Prism 7700 Sequence Detection System (Applied Biosystems). Each reaction was set up in triplicate in 25.0 µl volume with 1.0 µl of cDNA for 40 cycles (thermal cycling conditions: initial steps of 50o C, 2 min and 95o C, 10 min; and then, 40 cycles of 95o C,15 sec; 60o C, 1 min). The primers are given in Table 5.1. Relative gene expression was quantified using the
CT method (Zhao et al., 2005). The target genes were normalized
to total mRNA. The fold change was calculated for each sample using the equation, . Each RNA replication was treated separately and the results were averaged after the
calculation of each PCR run.
77
Table 5.1. Primers for analysis of selected genes by RT-RTPCR. The direction of primers is indicated as forward (F) or reverse (R). Gene (systematic name)
BEM3 (orf19.2771) HST2 (orf19.2580) RDS1 (orf19.4767) ADR1 (orf19.2752) SSA2 (orf19.1065) HST7 (orf19.469) MCA1 (orf19.5995) COX11 (orf19.1416) EFB1 (test for DNA contamination) (orf19.3838)
Primer
Sequence (5’-3’)
BEM3F BEM3R CHS2F CHSR EFB1F EFB1R IRA2F IRA2R OXR1F OXR1R PNC1F PNC1R RAD50F RAD50R TDH3F TDH3R EFB1F EFB1R
GTATGCAGTTATCACCAACTA AGAGCTCCAGAAGCTTTGTTC TAATAAATTCCGCAATACGCCTAAC TAGTGGCACACATTCTCTTTCATTTT ACGAATTCTTGGCTGACAAATCA TCATCTTCTTCAACAGCAGCTTGT CCTTGATACAAAGTCGAGCTTAGGA TAGGAGCTGTTGGCCAGGTATT TCGTCACATTCTAGTGTTTCTAGTCTG TAGTAATCGATGATGAGTTGATTCTT AACTTGACCCGAAAACGAATCA AGCTCCCTTGGTGCCTTGTAC CAGGGACATTGCCTCCAAAT CAGTTACAGCAGTTCGAGAGCTTAAG AGGACTGGAGAGGTGGTAGAACTG AATAACCTTACCAACGGCTTTAGC ACGAATTCTTGGCTGACAAATCA TCATCTTCTTCAACAGCAGCTTGT
Results and Discussion Effect of farnesol and CM on germ tube induction. Farnesol and CM have previously been reported to inhibit germ tube formation in growth supporting and non-supporting conditions (Hornby, Jensen et al. 2001; Ramage, Saville et al. 2002; Hornby, Kebaara et al. 2003). We confirmed that this effect extended to C. albicans planktonic yeast cells grown in YNB medium. When germ tubes were induced in YNB at 37oC, >90% of the cells formed germ tubes in 2 h. The addition of 40 µM farnesol inhibited >90% germ tube formation. The effect of 25%, 50% and 75% CM was examined and 75% CM completely suppressed germ tube formation. Farnesol is produced in YNB during growth of yeast cells in suspension culture (Hornby, Jensen et al. 2001) and is presumably the major effector compound among the CM metabolites suppressing germ tube formation. However, as noted previously other metabolites may also effect yeast cell responses under different conditions (Chen, Fujita et al. 2004), and metabolites in addition to farnesol may have some effect on the response in normally germ tube inducing conditions. Hornby et al (Hornby, Jensen et al. 2001) reported with a different medium that about 71% conditioned or spent medium completely inhibited germ tube induction
78
under non-growing conditions while about 75% inhibition was attained with 75% CM under conditions supporting growth. Whether the differences between the effect of CM on germ tube induction in this study and that previously reported (Hornby, Jensen et al. 2001) is significant and reflects the medium used is unknown. Alteration of gene expression in response to farnesol and CM.
Since hyphal formation
involves a change in gene expression as shown in numerous studies including global transcription approaches (Murad, d' Enfert et al. 2001; Murad, Leng et al. 2001; Nantel, Dignard et al. 2002; Garcia-Sanchez, Mavor et al. 2005; Kadosh and Johnson 2005; Singh, Sinha et al. 2005), we considered that repression of hyphal formation would also alter the global transcript profile. Microarray analysis was used to analyze difference in expression when C. albicans was grown in fresh medium with or without 40 m farnesol or 75% CM under germ tube permissible conditions for 2 h. There were 406 genes differentially regulated between the three groups (ANOVA, p70% of cells in the budding 4n state and most of the remainder in the 2n state (Fig. 5.4). When cells were treated with 300 µM farnesol, only about 10% of the cells were seen in the 4n state, the rest being in the 2n state (Fig. 5.4). Microscopic examination confirmed that most cells were in the unbudded state (Fig. 5.4). In support of this notion, our study as noted above revealed many genes involved in mitosis and DNA replication being downregulated by farnesol under germ tube permissive conditions. (Table 5.2).
86
Farnesol is an amphiphilic molecule and has been shown to solubilize in model membranes (Funari, Prades et al. 2005; Rowat, Keller et al. 2005). In mammalian cells it can effect membrane ion channels (Roullet, Luft et al. 1997; Bringmann, Skatchkov et al. 2000) and in Staphylococcus aureus it inhibits biofilm formation and compromises cell membrane integrity (Jabra-Rizk, Meiller et al. 2006). It is known that -mannosides exposed on mannoproteins and/or phospholipomannan are increased in cells that are approaching stationary phase rather than exponential phase cells (Martinez-Esparza, Sarazin et al. 2006). Also, older cells have a thicker, more non-porous cell wall than exponential phase cells that is known to be a major factor for phenotypic drug resistance in the C. albicans cells (Beggs 1984; Beggs 1989). We speculate that this difference in the cell wall could be a reason why 48 h old cells are more resistant to farnesol compared to the exponential phase cells.
87
Figure 5.3. Effect of farnesol and OAG on C. albicans growth. Exponentially growing (A) and 48 h old (B) C. albicans yeast cells were grown in the presence of different concentrations of farnesol (F) in YNB medium. Farnesol retarded the growth rate of the C. albicans cells. The farnesol treated exponential (C) and 48 h old cells (D) were treated with 25 µM OAG. This treatment rescued the farnesol mediated growth defect. The average values of three independent experiments are plotted for each time point.
88
Figure 5.4. Flow cytometry analysis of cells grown for 8 hours in untreated YNB medium (control), in YNB with 300 µM farnesol and in YNB with 300 µM farnesol and 50 µM OAG. Left X-axis represents cell number counts and Y- axis is the fluorescence intensity. Right axis indicates budding. We have previously shown that slower growing cells are smaller in size than more rapidly growing cells (Chaffin 1984). To ascertain if farnesol mediated reduction in cell division had any effect on cell size, we determined cell size using a Coulter counter. Cell sizing results revealed that the cells that were treated with 300 µM farnesol were significantly smaller in size when compared to the control cells at both 8 h and 18 h in culture (Table 5.3.). Table 5.3. Differences in sizes of cells grown in YNB with 300 µM farnesol and in YNB with 300 µM farnesol and 50 µM OAG at 8 and 18 hours. All the values were significantly different from each other (ANOVA p< 0.05). Control is fresh untreated YNB. Cell size ( fL) Time (hours)
Control
8
52.08 + 3
18
57.30 + 1.5
300 µM Farnesol
43.27 + 1.5 47.98 + 1.7
89
300 µM Farnesol + 25 µM OAG 54.52 + 1.5 53.19 + 2.3
Rescue from farnesol mediated delay in yeast growth resumption.
Farnesol is known to
retard growth in S. cerevisiae as well as in the leukemia cell line CEM-C1, albeit at low concentrations, 25 µM and 22 µM respectively (Voziyan, Haug et al. 1995; Machida, Tanaka et al. 1999). This growth retardation was found due to farnesol interference with either the phosphatidylinositol–type signaling or the biosynthesis of phosphatidylcholine. The microarray results from our present study also revealed that, with the exception of phospholipase C, PLC1, many of the genes involved in the phosphatidylinositol pathway (PI pathway) were downregulated greater than two fold in cells treated with farnesol (Table 5.2; Fig 5.5). This was not observed in a similar study by Enjalbert et. al. (Enjalbert and Whiteway 2005). In their conditions, barring the phosphatidylinositol synthase gene PIS1, the rest of the PI pathway was unchanged. Interference in the pathway reduces the intracellular concentration of inositol–1,4,5-triphosphate (IP3), phosphatidyl–3,4,5–triphosphate (PIP3) and diacylglycerol (DAG) that mediate signal transduction (Flanagan, Schnieders et al. 1993; Carman and Kersting 2004). DAG is a physiological activator of protein kinase C (PKC) in mammalian cells (Voziyan, Haug et al. 1995) and
PKC is important for normal budding and viability in C. albicans
(Paravicini, Mendoza et al. 1996). In S. cerevisiae and mammalian cells, addition of a membrane permeable DAG analogue rescued the farnesol mediated growth arrest (Voziyan, Haug et al. 1995; Machida, Tanaka et al. 1999). Since the concentration of farnesol that inhibited growth of C. albicans was at least four times greater than required to inhibit S. cerevisiae, we questioned if adding DAG to the growth medium would rescue the farnesol mediated growth arrest in the C. albicans cells. Indeed, when 25 µM of the membrane permeable DAG analogue OAG was added to exponential and 48 h old cultures treated with different concentrations of farnesol, there was resumption of growth (Fig. 5.3b). OAG by itself did not have any effect on C. albicans cell growth. By 24 h, there was a 12 and 3 fold increase in number of exponential cells treated with 100 and 300 µM farnesol respectively. However, this increase only became evident after 12 - 15 h of growth (Fig 5.3). We speculate that OAG protected some cells from farnesol mediated killing, eventually leading to increase in cell number. In the case of 48 h old cells
90
however, there was no lag in growth as seen when the cells were treated with farnesol. The cells treated with even the highest concentration of farnesol grew at the same rate as the control cells. There was also a 2-6 fold increase in cell number when these farnesol treated cells were grown in the presence of OAG. In S. cerevisiae OAG at 10 µM and 20 µM partially and completely reversed the farnesol effect respectively (Voziyan, Haug et al. 1995; Machida, Tanaka et al. 1999). Since, OAG was found to reverse the farnesol mediated growth delay, we questioned if it could also reverse the farnesol mediated inhibition of germ tube formation. However that was not observed (Data not shown). OAG could not induce germ tubes from farnesol arrested cells. This suggests that the farnesol may act on a different pathway to mediate C. albicans hyphal suppression. The observation that farnesol arrested the C. albicans cell growth, and DAG, a mammalian PKC activator could reverse this growth defect, suggested that farnesol may mediate its effect through PKC in C. albicans. If this is true then C. albicans lacking PKC should be inert to the effect of farnesol. However this was not observed. C. albicans devoid of the gene encoding PKC (PKC1), showed similar growth defects as the wild type C. albicans when treated with farnesol. This indicated that the farnesol mediated growth defect may not be via PKC in C. albicans. To confirm that farnesol does not affect C. albicans PKC, we added different concentrations of another known mammalian PKC activator, PMA to farnesol treated C. albicans cells. We found that unlike DAG, PMA did not reverse the farnesol mediated growth defect. Mammalian as well as S. cerevisiae Pkc1p contain two cystine – rich domains C1A and C1B. In mammalian cells, these C1s are analogues of DAG and have the ability to bind phorbol esters (Schmitz and Heinisch 2003). However sequence alignments of the yeast C1 repeats showed that Pkc1p does not bind DAG and belongs to a class of atypical C1 domains. The same is true for C. albicans Pkc1p. Both germ tube formation and yeast cell growth require replication capacity. We found a striking difference between the farnesol concentration needed to inhibit germ tube formation and that required to inhibit resumption of yeast cell proliferation. Farnesol was recently reported to inhibit germ tube formation at 1 µM (Mosel, Dumitru
91
et al. 2005) while inhibition of yeast proliferation is observed at 100-fold or higher concentrations of farnesol (this study, (Kim, Kim et al. 2002). In S. cerevisiae yeast cell proliferation is inhibited at 22 µM farnesol (Machida, Tanaka et al. 1999) which is the same range for inhibition of C. albicans germ tube formation. On the other hand the concentration of OAG that relieves farnesol imposed delay in yeast cell growth resumption is similar in both yeasts ((Voziyan, Haug et al. 1995; Machida, Tanaka et al. 1999) This suggests that the key step in C. albicans growth delay is resistant to farnesol compared S. cerevisiae while the downstream process mediated by phosphatidyl inositol type signaling is similar. In addition, to signaling DAG or OAG is lipid soluble and may locate to membranes where any associated membrane change may counter that of lipid soluble farnesol. In C. albicans the differences in concentration to arrest germ tube formation and yeast cell proliferation may be a survival advantage to allow yeast growth to continue even if germ tube formation is inhibited.
92
Figure 5.5. Differential expression of genes involved in phosphatidylinositol type signaling pathway. Expression values (log2 scale) are shown in bold next to the genes.
93
CHAPTER VI CONCLUDING REMARKS Candida species are ubiquitous commensal yeasts that usually reside as part of an individual' s normal mucosal (oral cavity, gastrointestinal tract and the vagina) microflora and can be detected in up to 71% of the healthy population (Naglik, Albrecht et al. 2004). However, if the balance of the normal flora is disrupted or the immune defenses are compromised, Candida species can invade mucosal surfaces and cause disease manifestations. Immunocompromised individuals such as AIDS patients or intensive care patients, experience some forms of superficial mucosal candidosis, most commonly thrush. Also, severely compromised individuals develop systemic infections where mortality rates are high. In addition, nearly three quarters of all healthy women experience at least one vaginal yeast infection, and about 5% endure recurrent bouts of disease (Naglik, Albrecht et al. 2004). C. albicans can cause invasive infections by producing hyphae or pseudohyphae. Candida albicans is capable of forming a biofilm on mucocutaneous surfaces, as well as on medical devices such as dentures and catheters (reviewed by Douglas, 2003; Kumamoto & Vinces, 2005; Mukherjee et al., 2005). Sixtyfive percent of edentulous individuals suffer with denture stomatitis and 40 % of patients with intravenous catheters develop acute fungaemia due to the growth of C. albicans biofilms on the associated biomedical devices. The growth phase of C. albicans cells in a biofilm is not known. We hypothesized that some cells within the biofilm reach a physiological state equivalent to stationary phase in planktonic organisms. To test this hypothesis we first had to obtain additional characterization of C. albicans stationary phase and establish a criterion by which stationary phase could be identified. Based on growth profiles and carbohydrate measurements, we defined the timing of entry of C. albicans into stationary phase. The growth profile studies revealed some interesting information about the biology of C. albicans. We found that in glucose rich conditions, C. albicans, unlike S. cerevisiae did not ferment glucose but metabolized it by oxidative fermentation. At approximately 20h (two hours before complete glucose exhaustion), C. albicans switches metabolism and utilizes the last of the glucose by
94
fermentation, thus producing ethanol in the medium. Fermentation takes place up to at least eight hours after glucose exhaustion, indicating that during this time C. albicans probably ferments an alternative carbon source. This was the diauxic shift. About 10 hours after glucose exhaustion, C. albicans switches metabolism to respiration. These observations indicate that oxidative phosphorylation is the default mode of metabolism in C. albicans. It is not known why under certain conditions C. albicans switches metabolism from respiration to fermentation, such as during glucose exhaustion. Another example where C. albicans does so during growth is at the lag phase. It has been reported that when C. albicans is inoculated in fresh medium, it ferments glucose for at least the first 5 hours, but switches metabolism to oxidative phosphorylation as it enters the exponential phase. It appears as though C. albicans prefers fermentation either during sudden availability of glucose as in the lag phase, or during exhaustion of glucose at 22 h. One reason why C. albicans behaves differently from S. cerevisiae could be because C. albicans genome is rewired. Although the genome of both organisms is significantly homologus, many individual genes have completely different functions in C. albicans. For example, both the yeasts have the transcription factor GAL4. However, while Sc.GAL4 codes for regulation of galactose utilization, Ca.GAL4 is involved in glycolysis and TCA cycle. Another example is the gene ROX1, a suppressor of hypoxic genes in S. cerevisiae. The homolog of the same gene in C. albicans is a negative regulator of hyphal genes, and plays no role in anaerobic growth of C. albicans. Thus C. albicans and S. cerevisiae regulate the same processes by different regulatory circuits. Also because C. albicans is a commensal of the human body, and has evolved differently from S. cerevisiae, it could grow differently and respond to environment in a manner biochemically different from S. cerevisiae. Using global gene expression analysis and mutant screening studies, we identified processes important for stationary phase and genes essential for survival in this phase. We found that the post-diauxic phase cells acquire many but not all characteristics of stationary phase cells. Stationary phase cells over expressed genes involved in the thickening of cell wall, production of ribonucleases and proteases and genes involved in
95
protein trafficking. By screening transcription factor mutants, we found that mitochondrial function and cell wall organization were two processes essential for viability of cells in stationary phase. Thus we could draw a distinction between cells found in the post-diauxic shift phase of a culture (often mistaken to be stationary phase cells) and the cells that are actually in the stationary phase. One of the important parts of the C. albicans stationary phase study was standardizing a new protocol for extraction of good quality RNA from all phases of growth, called the crushed glass beads method. We found that by the traditional methods of RNA extraction, large molecular weight RNA could not be extracted. To extract RNA of all classes from stationary phase cells it was essential to grind frozen cells using a mortar and pestle with glass beads in liquid nitrogen. This assured complete disruption of the thick stationary phase cell walls of the C. albicans cells and yielded all sizes of RNA. We speculate that the stationary phase cell wall acts as a sieve to large molecular weight RNA while the small RNA can move out easily. By using the crushed glass beads method, we also showed that the commonly used house keeping genes such as ACT1, TDH3 or EFB1 could not be used for normalizing gene expression data relating to stationary phase. This was because in stationary phase the transcript levels of these genes reduced drastically. The results obtained by techniques that measure transcript levels such as Real time PCR, Northern blots, reverse transcriptase PCR, need to be normalized with standard housekeeping genes - genes whose transcript levels do not change in all conditions tested. Finding such reliable genes for the purpose of normalization is the need of the hour. Earlier studies in C. albicans may have used a less efficient method for RNA extraction, that may have affected interpretation of the observations. Crushed glass beads method should be considered for applications requiring proportional representation of RNA populations. Studying C. albicans stationary phase will aid in understanding many other aspects of C. albicans biology. For example, these results could give us an insight to how C. albicans cells survive along with other bacteria in mixed species biofilm setting. In one of our ongoing studies, microarray analyses revealed that C. albicans growth genes such as
96
CDC28 and RAS1 were downregulated several fold when C. albicans formed a biofilm along with the bacteria Rothia dentocariosa on a substrate used for manufacturing voice prosthesis. These genes are also known to be downregulated in stationary phase conditions. In this mixed species biofilm, C. albicans could persist in stationary phase, given the fact that R. dentocariosa multiply faster than the yeast and hence potentially use up most of the nutrients in the medium. This in vitro mixed species biofilm could be considered as a miniature model of the real picture in the human body e.g. the gut, where C. albicans has to compete with hundreds of co-commensal bacteria for space and nutrients. It is tempting to hypothesize that at least in this organ; a subpopulation of C. albicans may prefer to persist in stationary phase – a phase which helps long term survival of organisms in nutrient limiting conditions. Some species of bacteria too are hypothesized to exist in stationary phase in the gut (Finkel 2006). It would be interesting to peruse this hypothesis by inoculating C. albicans into the long-term GI tract colonization mouse model and monitoring both phenotypic as well as gene expression changes suggestive of stationary phase in C. albicans recovered from the gut. Consistent with the same idea, we tagged two C. albicans stationary phase genes – SNO1 and SNZ1 with YFP and monitored fluorescence in C. albicans cells both in planktonic as well as biofilm condition. We found that even after prolonged incubation, only 40% of the founder cells of the biofilm (bottom-most substrate adhered cells) fluoresced, indicating stationary phase, while the rest of the biofilm did not. Hence, we concluded that major part of the in vitro biofilm is made up of non-stationary phase C. albicans cells. The presence of stationary phase cells in the bottom-most layer of the biofilm also indicates that these cells sustained for long periods of time on the substrate and could serve as a firm base for attaching the body of the biofilm to the surface. It would be interesting to know the growth phase of the biofilm cells in vivo. To answer this question we are collaborating with Dr. Dave Andes, University of Wisconsin, who has established an in vivo (rat) central venous catheter biofilm model. We intend to inoculate the SNZ1-YFP strain of C. albicans into this model to know if the C. albicans cells in an in vivo biofilm reach stationary phase.
97
From our studies with the fluorescent strains we found two interesting observations. In the biofilm, most of the fluorescent cells in the bottom-most layer were found as separate clusters adhered to different parts of the substrate. This probably means that there are gradients of environmental conditions in the structurally complex biofilm; one such caused by nutrient limitation in some parts of biofilms. It is known that biofilms are structurally complex and are interspersed by ramifying water channels. It could be possible that cells close to those channels never reach stationary phase, while cells in certain parts within the biofilm away from the channels reach stationary phase. It would be interesting to investigate further, what other environments are created in the biofilm, e.g. differences in pH, oxygen content, etc, in the different layers or niches in the biofilm. This could be done by using microprobes or monitoring environmentally sensitive gene transcripts. This knowledge could help us better understand the biofilm entity and may give us clues for getting rid of the biofilm. We localized fluorescence in the cell to the cytoplasm. On monitoring fluorescence, we also found that though both C. albicans yeast and pseudohyphae fluoresced having reached stationary phase, no fluorescence could ever be observed in C. albicans true hyphae. The absence of fluorescence from hyphae could be explained by the fact that hyphae contain very little cytoplasmic material. Alternatively, it could also be possible that hyphae do not reach stationary phase like the other forms of C. albicans. During growth to stationary phase, cells release metabolites into the medium, including molecules that may have a quorum sensing function (Hornby, Jensen et al. 2001; Chen, Fujita et al. 2004). In an in vitro C. albicans biofilm, some yeast cells in the bottom-most adhered layers of the mature biofilm reach stationary phase (Uppuluri, Sarmah et al. 2006). Mature biofilms also produce quorum sensing molecules (Ramage, Saville et al. 2002). One such molecule – farnesol, has been extensively studied in C. albicans, since it is known to inhibit yeast to hyphae transition and in turn prevent biofilm formation. Having found the same effect in our studies, we wanted to know what C. albicans genes and processes were affected by farnesol in planktonic conditions. Using microarray analysis we found that many hyphal genes were down regulated.
98
Strikingly, the genes necessary for promoting growth and proliferation were the largest class of downregulated genes. Having found these results we questioned if farnesol might have a negative effect on growth of C. albicans cells. Indeed we found that there was a growth retardation when cells were treated >40 µM farnesol. Interestingly, the exponential phase cells (12 h old) were more susceptible to the effects of farnesol than cells grown for a longer time (48 h, 3 d old); and high concentrations of farnesol (100 µM and 300 µM) proved fatal to the exponential phase cells. On the other hand, the older cells were resistant to killing by farnesol and also had a lesser impact of farnesol on growth. By 48 h or 3 d, the cells in culture would be in contact with a much higher concentration of farnesol in the growth medium, than the 12 h old cells. Hence, it could be possible that such older cells are more immune to high concentrations of farnesol than exponential phase cells, hence resistant to its effect. Our microarray results showed that the phosphatidylinositol pathway that produces DAG, was one of the major pathways downregulated in cells treated with farnesol. When an analog of diacylglycerol (DAG) – Oleyl acetyl glycerol (OAG) was added into the medium, the farnesol mediated growth defect was reversed. However, we found that this effect was not due to activation of protein kinase C, the regular target of DAG in mammalian cells (activation of which promotes growth). The target of DAG in C. albicans is not known. It would be interesting to discover what DAG targets in the cell to reverse the farnesol mediated growth defect. By identifying the target of DAG, we can in effect identify a potential target of farnesol in the cell. Our identification of genes and processes regulated during diauxic phase, entry and maintenance of stationary phase could have significant implications in understanding the biology of C. albicans. In the long term, the insights gained by this study could lead to the development of treatment strategies based on the growth state of the cells. In the short term, the results of this study will expand our existing knowledge of C. albicans stationary phase, and serve as a foundation for more systematic and un-biased studies in this area of C. albicans research.
99
REFERENCES Aboushadi, N., W. H. Engfelt, et al. (1999). "Role of peroxisomes in isoprenoid biosynthesis." J Histochem Cytochem 47(9): 1127-32. Adams, A., D. E. Gottschling, et al. (1997). Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press. Anderl, J. N., J. Zahller, et al. (2003). "Role of nutrient limitation and stationary-phase existence in Klebsiella pneumoniae biofilm resistance to ampicillin and ciprofloxacin." Antimicrob Agents Chemother 47(4): 1251-6. Andes, D., A. Lepak, et al. (2005). "A simple approach for estimating gene expression in Candida albicans directly from a systemic infection site." J Infect Dis 192(5): 893-900. Aragon, A. D., G. A. Quinones, et al. (2006). "Release of extraction-resistant mRNA in stationary phase Saccharomyces cerevisiae produces a massive increase in transcript abundance in response to stress." Genome Biol 7(2): R9. Arnaud, M. B., M. C. Costanzo, et al. (2005). "The Candida Genome Database (CGD), a community resource for Candida albicans gene and protein information." Nucleic Acids Res 33(Database issue): D358-63. Ashrafi, K., D. Sinclair, et al. (1999). "Passage through stationary phase advances replicative aging in Saccharomyces cerevisiae." Proc Natl Acad Sci U S A 96(16): 91005. Ausubel, F. M., B. Brent, et al. (2002). Short Protocols in Molecular Biology. New York City, New York, John Wiley & Sons, Inc. Bachewich, C., A. Nantel, et al. (2005). "Cell cycle arrest during S or M phase generates polarized growth via distinct signals in Candida albicans." Mol Microbiol 57(4): 942-59. Baldi, P. and G. W. Hatfield (2002). DNA Microarrays and Gene Expression: From Experiments to Data Analysis and Modeling. Cambridge, United Kingdom, Cambridge University Press. Bassilana, M., J. Hopkins, et al. (2005). "Regulation of the Cdc42/Cdc24 GTPase module during Candida albicans hyphal growth." Eukaryot Cell 4(3): 588-603.
100
Bates, S., D. M. MacCallum, et al. (2005). "Candida albicans Pmr1p, a secretory pathway P-type Ca2+/Mn2+-ATPase, is required for glycosylation and virulence." J Biol Chem 280(24): 23408-15. Beggs, W. H. (1984). "Growth phase in relation to ketoconazole and miconazole susceptibilities of Candida albicans." Antimicrob Agents Chemother 25(3): 316-8. Bertram, G., R. K. Swoboda, et al. (1996). "Structure and regulation of the Candida albicans ADH1 gene encoding an immunogenic alcohol dehydrogenase." Yeast 12(2): 115-27. Bringmann, A., S. N. Skatchkov, et al. (2000). "Farnesol modulates membrane currents in human retinal glial cells." J Neurosci Res 62(3): 396-402. Bruno, V. M. and A. P. Mitchell (2005). "Regulation of azole drug susceptibility by Candida albicans protein kinase CK2." Mol Microbiol 56(2): 559-73. Burk, D., D. Dawson, et al. (2000). Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory Press. Cao, Y. Y., Y. B. Cao, et al. (2005). "cDNA microarray analysis of differential gene expression in Candida albicans biofilm exposed to farnesol." Antimicrob Agents Chemother 49(2): 584-9. Carman, G. M. and M. C. Kersting (2004). "Phospholipid synthesis in yeast: regulation by phosphorylation." Biochem Cell Biol 82(1): 62-70. Cassone, A. (1986). "Cell wall of pathogenic yeasts and implications for antimycotic therapy." Drugs Exp Clin Res 12(6-7): 635-43. Cassone, A., D. Kerridge, et al. (1979). "Ultrastructural changes in the cell wall of Candida albicans following cessation of growth and their possible relationship to the development of polyene resistance." J Gen Microbiol 110(2): 339-49. Cassone, A., D. Kerridge, et al. (1979). "Ultrastructural changes in the cell wall of Candida albicans following cessation of growth and their possible relationship to the development of polyene resistance." J Gen Microbiol 110: 339-349. Chaffin, W. L. (1984). "The relationship between yeast cell size and cell division in Candida albicans." Can J Microbiol 30(2): 192-203. Chen, H., M. Fujita, et al. (2004). "Tyrosol is a quorum-sensing molecule in Candida albicans." Proc Natl Acad Sci U S A 101(14): 5048-52.
101
Collart, M. S. and S. Oliviero (1995). Preparation of Yeast RNA. Short Protocols in Molecular Biology. New York City, New York, John Wiley & Son, Inc.: 13-26. Cruz, M. C., A. L. Goldstein, et al. (2001). "Rapamycin and less immunosuppressive analogs are toxic to Candida albicans and Cryptococcus neoformans via FKBP12dependent inhibition of TOR." Antimicrob Agents Chemother 45(11): 3162-70. Cutler, J. E., D. L. Brawner, et al. (1990). "Characteristics of Candida albicans adherence to mouse tissues." Infect Immun 58(6): 1902-8. Delbruck, S. and J. F. Ernst (1993). "Morphogenesis-independent regulation of actin transcript levels in the pathogenic yeast Candida albicans." Mol Microbiol 10(4): 859-66. DeRisi, J. L., V. R. Iyer, et al. (1997). "Exploring the metabolic and genetic control of gene expression on a genomic scale." Science 278(5338): 680-6. Donlan, R. M. (2001). "Biofilms and device-associated infections." Emerg Infect Dis 7(2): 277-81. Douglas, L. J. (2003). "Candida biofilms and their role in infection." Trends Microbiol 11(1): 30-6. Dudani, A. K. and R. Prasad (1985). "Differences in amino acid transport and phospholipid contents during the cell cycle of Candida albicans." Folia Microbiol (Praha) 30(6): 493-500. Enjalbert, B., A. Nantel, et al. (2003). "Stress-induced gene expression in Candida albicans: absence of a general stress response." Mol Biol Cell 14(4): 1460-7. Finkel, S. E. (2006). "Long-term survival during stationary phase: evolution and the GASP phenotype." Nat Rev Microbiol 4(2): 113-20. Flanagan, C. A., E. A. Schnieders, et al. (1993). "Phosphatidylinositol 4-kinase: gene structure and requirement for yeast cell viability." Science 262(5138): 1444-8. Fuge, E. K., E. L. Braun, et al. (1994). "Protein synthesis in long-term stationary-phase cultures of Saccharomyces cerevisiae." J Bacteriol 176(18): 5802-13. Funari, S. S., J. Prades, et al. (2005). "Farnesol and geranylgeraniol modulate the structural properties of phosphatidylethanolamine model membranes." Mol Membr Biol 22(4): 303-11.
102
Galan, A., M. Casanova, et al. (2004). "The Candida albicans pH-regulated KER1 gene encodes a lysine/glutamic-acid-rich plasma-membrane protein that is involved in cell aggregation." Microbiology 150(Pt 8): 2641-51. Gale, E. F., J. Ingram, et al. (1980). "Reduction of amphotericin resistance in stationary phase cultures of Candida albicans by treatment with enzymes." J Gen Microbiol 117(2): 383-91. Gale, E. F., A. M. Johnson, et al. (1980). "Phenotypic resistance to miconazle and amphotericin B in Candida albicans." J Gen Microbiol 117: 535-538. Gale, E. F., A. M. Johnson, et al. (1980). "Phenotypic resistance to miconazole and amphotericin B in Candida albicans." J Gen Microbiol 117(2): 535-8. Garcia-Sanchez, S., A. L. Mavor, et al. (2005). "Global roles of Ssn6 in Tup1- and Nrg1dependent gene regulation in the fungal pathogen, Candida albicans." Mol Biol Cell 16(6): 2913-25. Gaur, M., D. Choudhury, et al. (2005). "Complete inventory of ABC proteins in human pathogenic yeast, Candida albicans." J Mol Microbiol Biotechnol 9(1): 3-15. Gow, N. A., A. J. Brown, et al. (2002). "Fungal morphogenesis and host invasion." Curr Opin Microbiol 5(4): 366-71. Granger, B. L., M. L. Flenniken, et al. (2005). "Yeast wall protein 1 of Candida albicans." Microbiology 151(Pt 5): 1631-44. Gray, J. V., G. A. Petsko, et al. (2004). ""Sleeping beauty": quiescence in Saccharomyces cerevisiae." Microbiol Mol Biol Rev 68(2): 187-206. Gurvitz, A., J. K. Hiltunen, et al. (2001). "Saccharomyces cerevisiae Adr1p governs fatty acid beta-oxidation and peroxisome proliferation by regulating POX1 and PEX11." J Biol Chem 276(34): 31825-30. Hartwell, L. H., J. Culotti, et al. (1970). "Genetic control of the cell-division cycle in yeast. I. Detection of mutants." Proc Natl Acad Sci U S A 66(2): 352-9. Hauser, N. C., M. Vingron, et al. (1998). "Transcriptional profiling on all open reading frames of Saccharomyces cerevisiae." Yeast 14(13): 1209-21. Herbert, D., C. N. Paramasivan, et al. (1996). "Bactericidal action of ofloxacin, sulbactam-ampicillin, rifampin, and isoniazid on logarithmic- and stationary-phase cultures of Mycobacterium tuberculosis." Antimicrob Agents Chemother 40(10): 2296-9.
103
Hirooka, K., Y. Yamamoto, et al. (2005). "Improved production of isoamyl acetate by a sake yeast mutant resistant to an isoprenoid analog and its dependence on alcohol acetyltransferase activity, but not on isoamyl alcohol production." J Biosci Bioeng 99(2): 125-9. Hong, E. L., R. Balakrishnan, et al. Saccharomyces Genome Database. Hornby, J. M., E. C. Jensen, et al. (2001). "Quorum sensing in the dimorphic fungus Candida albicans is mediated by farnesol." Appl Environ Microbiol 67(7): 2982-92. Hornby, J. M., B. W. Kebaara, et al. (2003). "Farnesol biosynthesis in Candida albicans: cellular response to sterol inhibition by zaragozic acid B." Antimicrob Agents Chemother 47(7): 2366-9. Hudspeth, M. E., D. S. Shumard, et al. (1980). "Rapid purification of yeast mitochondrial DNA in high yield." Biochim Biophys Acta 610(2): 221-8. Ihmels, J., S. Bergmann, et al. (2005). "Rewiring of the yeast transcriptional network through the evolution of motif usage." Science 309(5736): 938-40. Jabra-Rizk, M. A., T. F. Meiller, et al. (2006). "Effect of farnesol on Staphylococcus aureus biofilm formation and antimicrobial susceptibility." Antimicrob Agents Chemother 50(4): 1463-9. Kadosh, D. and A. D. Johnson (2005). "Induction of the Candida albicans filamentous growth program by relief of transcriptional repression: a genome-wide analysis." Mol Biol Cell 16(6): 2903-12. Kim, S., E. Kim, et al. (2002). "Evaluation of morphogenic regulatory activity of farnesoic acid and its derivatives against Candida albicans dimorphism." Bioorg Med Chem Lett 12(6): 895-8. King, R. D., J. C. Lee, et al. (1980). "Adherence of Candida albicans and other Candida species to mucosal epithelial cells." Infect Immun 27(2): 667-74. Kohrer, K. and H. Domdey (1991). "Preparation of high molecular weight RNA." Methods Enzymol 194: 398-405. Kuhn, D. M. and M. A. Ghannoum (2004). "Candida biofilms: antifungal resistance and emerging therapeutic options." Curr Opin Investig Drugs 5(2): 186-97. Kumamoto, C. A. and M. D. Vinces (2005). "Alternative Candida albicans Lifestyles: Growth on Surfaces." Annu Rev Microbiol.
104
Kumamoto, C. A. and M. D. Vinces (2005). "Alternative Candida albicans lifestyles: growth on surfaces." Annu Rev Microbiol 59: 113-33. Kuzj, A. E., P. S. Medberry, et al. (1998). "Stationary phase, amino acid limitation and recovery from stationary phase modulate the stability and translation of chloramphenicol acetyltransferase mRNA and total mRNA in Escherichia coli." Microbiology 144 (Pt 3): 739-50. Lamarre, C., J. D. LeMay, et al. (2001). "Candida albicans expresses an unusual cytoplasmic manganese-containing superoxide dismutase (SOD3 gene product) upon the entry and during the stationary phase." J Biol Chem 276(47): 43784-91. Lamming, D. W., M. Latorre-Esteves, et al. (2005). "HST2 mediates SIR2-independent life-span extension by calorie restriction." Science 309(5742): 1861-4. Li, C. R., Y. M. Wang, et al. (2005). "The formin family protein CaBni1p has a role in cell polarity control during both yeast and hyphal growth in Candida albicans." J Cell Sci 118(Pt 12): 2637-48. Lopez-Ribot, J. L. (2005). "Candida albicans biofilms: more than filamentation." Curr Biol 15(12): R453-5. Lopez de Heredia, M. and R. P. Jansen (2004). "RNA integrity as a quality indicator during the first steps of RNP purifications: a comparison of yeast lysis methods." BMC Biochem 5: 14. Lorenz, M. C., J. A. Bender, et al. (2004). "Transcriptional response of Candida albicans upon internalization by macrophages." Eukaryot Cell 3(5): 1076-87. Lyons, C. N. and T. C. White (2000). "Transcriptional analyses of antifungal drug resistance in Candida albicans." Antimicrob Agents Chemother 44(9): 2296-303. Machida, K., T. Tanaka, et al. (1998). "Farnesol-induced generation of reactive oxygen species via indirect inhibition of the mitochondrial electron transport chain in the yeast Saccharomyces cerevisiae." J Bacteriol 180(17): 4460-5. Machida, K., T. Tanaka, et al. (1999). "Farnesol-induced growth inhibition in Saccharomyces cerevisiae by a cell cycle mechanism." Microbiology 145 (Pt 2): 293-9. Maneu, V., J. P. Martinez, et al. (2000). "Identification of Candida albicans clinical isolates by PCR amplification of an EFB1 gene fragment containing an intron-interrupted open reading frame." Med Mycol 38(2): 123-6.
105
Manna, F., D. R. Massardo, et al. (1996). "A simple and inexpensive method for RNA extraction from yeasts." Trends Genet 12(9): 337-8. Martchenko, M., A. Levitin, et al. (2006). "Analysis of the Candida albicans galactose regulon, and the role of the Gal4 protein." 8th ASM Conference on Candida and Candidiasis Abstract B26: 41-42. Martinez, M. J., S. Roy, et al. (2004). "Genomic analysis of stationary-phase and exit in Saccharomyces cerevisiae: gene expression and identification of novel essential genes." Mol Biol Cell 15(12): 5295-305. Masuoka, J. and K. C. Hazen (1999). "Differences in the acid-labile component of Candida albicans mannan from hydrophobic and hydrophilic yeast cells." Glycobiology 9(11): 1281-6. McCourtie, J. and L. J. Douglas (1981). "Relationship between cell surface composition of Candida albicans and adherence to acrylic after growth on different carbon sources." Infect Immun 32(3): 1234-41. McEntee, C. M. and A. P. Hudson (1989). "Preparation of RNA from unspheroplasted yeast cells (Saccharomyces cerevisiae)." Anal Biochem 176(2): 303-6. McLeod, G. I. and M. P. Spector (1996). "Starvation- and Stationary-phase-induced resistance to the antimicrobial peptide polymyxin B in Salmonella typhimurium is RpoS (sigma(S)) independent and occurs through both phoP-dependent and -independent pathways." J Bacteriol 178(13): 3683-8. Monje-Casas, F., C. Michan, et al. (2004). "Absolute transcript levels of thioredoxin- and glutathione-dependent redox systems in Saccharomyces cerevisiae: response to stress and modulation with growth." Biochem J 383(Pt 1): 139-47. Moreno, I., Y. Pedreno, et al. (2003). "Characterization of a Candida albicans gene encoding a putative transcriptional factor required for cell wall integrity." FEMS Microbiol Lett 226(1): 159-67. Mosel, D. D., R. Dumitru, et al. (2005). "Farnesol concentrations required to block germ tube formation in Candida albicans in the presence and absence of serum." Appl Environ Microbiol 71(8): 4938-40. Motizuki, M. and K. Tsurugi (1992). "The effect of aging on protein synthesis in the yeast Saccharomyces cerevisiae." Mech Ageing Dev 64(3): 235-45. Mukherjee, P. K., J. Chandra, et al. (2003). "Mechanism of fluconazole resistance in Candida albicans biofilms: phase-specific role of efflux pumps and membrane sterols." Infect Immun 71(8): 4333-40.
106
Mukherjee, P. K., G. Zhou, et al. (2005). "Candida biofilm: a well-designed protected environment." Med Mycol 43(3): 191-208. Munro, C. A., D. A. Schofield, et al. (1998). "Regulation of chitin synthesis during dimorphic growth of Candida albicans." Microbiology 144 (Pt 2): 391-401. Murad, A. M., C. d' Enfert, et al. (2001). "Transcript profiling in Candida albicans reveals new cellular functions for the transcriptional repressors CaTup1, CaMig1 and CaNrg1." Mol Microbiol 42(4): 981-93. Murad, A. M., P. Leng, et al. (2001). "NRG1 represses yeast-hypha morphogenesis and hypha-specific gene expression in Candida albicans." Embo J 20(17): 4742-52. Naglik, J., A. Albrecht, et al. (2004). "Candida albicans proteinases and host/pathogen interactions." Cell Microbiol 6(10): 915-26. Nantel, A., D. Dignard, et al. (2002). "Transcription profiling of Candida albicans cells undergoing the yeast-to-hyphal transition." Mol Biol Cell 13(10): 3452-65. Newcomb, L. L., J. A. Diderich, et al. (2003). "Glucose regulation of Saccharomyces cerevisiae cell cycle genes." Eukaryot Cell 2(1): 143-9. Nickerson, K. W., A. L. Atkin, et al. (2006). "Quorum sensing in dimorphic fungi: farnesol and beyond." Appl Environ Microbiol 72(6): 3805-13. Nobile, C. J. and A. P. Mitchell (2006). "Genetics and genomics of Candida albicans biofilm formation." Cell Microbiol. Paravicini, G., A. Mendoza, et al. (1996). "The Candida albicans PKC1 gene encodes a protein kinase C homolog necessary for cellular integrity but not dimorphism." Yeast 12(8): 741-56. Perrod, S., M. M. Cockell, et al. (2001). "A cytosolic NAD-dependent deacetylase, Hst2p, can modulate nucleolar and telomeric silencing in yeast." Embo J 20(1-2): 197209. Postlethwait, P. and P. Sundstrom (1995). "Genetic organization and mRNA expression of enolase genes of Candida albicans." J Bacteriol 177(7): 1772-9. Prill, S. K., B. Klinkert, et al. (2005). "PMT family of Candida albicans: five protein mannosyltransferase isoforms affect growth, morphogenesis and antifungal resistance." Mol Microbiol 55(2): 546-60.
107
Ramage, G., S. P. Saville, et al. (2002). "Inhibition of Candida albicans biofilm formation by farnesol, a quorum-sensing molecule." Appl Environ Microbiol 68(11): 5459-63. Rivas, R., N. Vizcaino, et al. (2001). "An effective, rapid and simple method for total RNA extraction from bacteria and yeast." J Microbiol Methods 47(1): 59-63. Roman, E., C. Nombela, et al. (2005). "The Sho1 adaptor protein links oxidative stress to morphogenesis and cell wall biosynthesis in the fungal pathogen Candida albicans." Mol Cell Biol 25(23): 10611-27. Romandini, P., C. Bonotto, et al. (1994). "Superoxide dismutase, catalase and cell dimorphism in Candida albicans cells exposed to methanol and different temperatures." Comp Biochem Physiol Pharmacol Toxicol Endocrinol 108(1): 53-7. Roullet, J. B., U. C. Luft, et al. (1997). "Farnesol inhibits L-type Ca2+ channels in vascular smooth muscle cells." J Biol Chem 272(51): 32240-6. Rowat, A. C., D. Keller, et al. (2005). "Effects of farnesol on the physical properties of DMPC membranes." Biochim Biophys Acta 1713(1): 29-39. Sarthy, A. V., T. McGonigal, et al. (1997). "Phenotype in Candida albicans of a disruption of the BGL2 gene encoding a 1,3-beta-glucosyltransferase." Microbiology 143 (Pt 2): 367-76. Sato, T., T. Watanabe, et al. (2004). "Farnesol, a morphogenetic autoregulatory substance in the dimorphic fungus Candida albicans, inhibits hyphae growth through suppression of a mitogen-activated protein kinase cascade." Biol Pharm Bull 27(5): 751-2. Schultz, M. C. (1999). "Chromatin assembly in yeast cell-free extracts." Methods 17(2): 161-72. Semighini, C. P., J. M. Hornby, et al. (2006). "Farnesol-induced apoptosis in Aspergillus nidulans reveals a possible mechanism for antagonistic interactions between fungi." Mol Microbiol 59(3): 753-64. Sherlock, G., A. M. Bahman, et al. (1994). "Molecular cloning and analysis of CDC28 and cyclin homologues from the human fungal pathogen Candida albicans." Mol Gen Genet 245(6): 716-23. Singh, V., I. Sinha, et al. (2005). "Global analysis of altered gene expression during morphogenesis of Candida albicans in vitro." Biochem Biophys Res Commun 334(4): 1149-58.
108
Slattery, M. G., D. Liko, et al. (2006). "The function and properties of the Azf1 transcriptional regulator change with growth conditions in Saccharomyces cerevisiae." Eukaryot Cell 5(2): 313-20. Sogin, S. J. and C. A. Saunders (1980). "Fluctuation in polyadenylate size and content in exponential- and stationary-phase cells of Saccharomyces cerevisiae." J Bacteriol 144(1): 74-81. Song, J. L., J. B. Harry, et al. (2004). "The Candida albicans lanosterol 14-alphademethylase (ERG11) gene promoter is maximally induced after prolonged growth with antifungal drugs." Antimicrob Agents Chemother 48(4): 1136-44. Spoering, A. L. and K. Lewis (2001). "Biofilms and planktonic cells of Pseudomonas aeruginosa have similar resistance to killing by antimicrobials." J Bacteriol 183(23): 6746-51. Suci, P. A. and B. J. Tyler (2003). "A method for discrimination of subpopulations of Candida albicans biofilm cells that exhibit relative levels of phenotypic resistance to chlorhexidine." J Microbiol Methods 53(3): 313-25. Sudbery, P., N. Gow, et al. (2004). "The distinct morphogenic states of Candida albicans." Trends Microbiol 12(7): 317-24. Sullivan, P. A., C. Y. Yin, et al. (1983). "An analysis of the metabolism and cell wall composition of Candida albicans during germ-tube formation." Can J Microbiol 29(11): 1514-25. Svensater, G., O. Bjornsson, et al. (2001). "Effect of carbon starvation and proteolytic activity on stationary-phase acid tolerance of Streptococcus mutans." Microbiology 147(Pt 11): 2971-9. Swinnen, E., V. Wanke, et al. (2006). "Rim15 and the crossroads of nutrient signalling pathways in Saccharomyces cerevisiae." Cell Div 1: 3. Swinnen, E., V. Wanke, et al. (2006). "Rim15 and the crossroads of nutrient signalling pathways in Saccharomyces cerevisiae." Cell Div 1(1): 3. Swoboda, R. K., G. Bertram, et al. (1994). "Fluctuations in glycolytic mRNA levels during morphogenesis in Candida albicans reflect underlying changes in growth and are not a response to cellular dimorphism." Mol Microbiol 13(4): 663-72. Tavanti, A., G. Pardini, et al. (2004). "Differential expression of secretory aspartyl proteinase genes (SAP1-10) in oral Candida albicans isolates with distinct karyotypes." J Clin Microbiol 42(10): 4726-34.
109
Thurnheer, T., J. R. van der Ploeg, et al. (2006). "Effects of Streptococcus mutans gtfC deficiency on mixed oral biofilms in vitro." Caries Res 40(2): 163-71. Tournu, H., G. Tripathi, et al. (2005). "Global role of the protein kinase Gcn2 in the human pathogen Candida albicans." Eukaryot Cell 4(10): 1687-96. Uppuluri, P., P. Perumal, et al. (2006). "Analysis of RNAs of various sizes from stationary phase planktonic yeast cells of Candida albicans." FEMS Yeast Research manuscript in press. Uppuluri, P., B. Sarmah, et al. (2006). "Candida albicans SNO1 and SNZ1 expressed in stationary-phase planktonic yeast cells and base of biofilm." Microbiology 152(Pt 7): 2031-8. Uppuluri, P., B. Sarmah, et al. (2006). "Candida albicans SNO1 and SNZ1 expressed in stationary phase planktonic yeast cells and base of biofilm." Microbiology in press. Vijg, J. and Y. Suh (2005). "Genetics of longevity and aging." Annu Rev Med 56: 193212. Vinces, M. D., C. Haas, et al. (2006). "Expression of the Candida albicans morphogenesis regulator gene CZF1 and its regulation by Efg1p and Czf1p." Eukaryot Cell 5(5): 825-35. Voziyan, P. A., J. S. Haug, et al. (1995). "Mechanism of farnesol cytotoxicity: further evidence for the role of PKC-dependent signal transduction in farnesol-induced apoptotic cell death." Biochem Biophys Res Commun 212(2): 479-86. Weeks, G. and G. B. Spiegelman (2003). "Roles played by Ras subfamily proteins in the cell and developmental biology of microorganisms." Cell Signal 15(10): 901-9. Wenzel, T. J., A. W. Teunissen, et al. (1995). "PDA1 mRNA: a standard for quantitation of mRNA in Saccharomyces cerevisiae superior to ACT1 mRNA." Nucleic Acids Res 23(5): 883-4. Werner-Washburne, M., E. Braun, et al. (1993). "Stationary phase in the yeast Saccharomyces cerevisiae." Microbiol Rev 57(2): 383-401. Werner-Washburne, M., E. L. Braun, et al. (1996). "Stationary phase in Saccharomyces cerevisiae." Mol Microbiol 19(6): 1159-66. Westfall, D., N. Aboushadi, et al. (1997). "Metabolism of farnesol: phosphorylation of farnesol by rat liver microsomal and peroxisomal fractions." Biochem Biophys Res Commun 230(3): 562-8.
110
Westwater, C., E. Balish, et al. (2005). "Candida albicans-conditioned medium protects yeast cells from oxidative stress: a possible link between quorum sensing and oxidative stress resistance." Eukaryot Cell 4(10): 1654-61. White, T. C., K. A. Marr, et al. (1998). "Clinical, cellular, and molecular factors that contribute to antifungal drug resistance." Clin Microbiol Rev 11(2): 382-402. Whiteway, M. (2000). "Transcriptional control of cell type and morphogenesis in Candida albicans." Curr Opin Microbiol 3(6): 582-8. Yaar, L., M. Mevarech, et al. (1997). "A Candida albicans RAS-related gene (CaRSR1) is involved in budding, cell morphogenesis and hypha development." Microbiology 143 (Pt 9): 3033-44. Yazdanyar, A., M. Essmann, et al. (2001). "Genistein effects on growth and cell cycle of Candida albicans." J Biomed Sci 8(2): 153-9. Zaragoza, O., C. de Virgilio, et al. (2002). "Disruption in Candida albicans of the TPS2 gene encoding trehalose-6-phosphate phosphatase affects cell integrity and decreases infectivity." Microbiology 148(Pt 5): 1281-90. Zhao, R., K. J. Daniels, et al. (2005). "Unique aspects of gene expression during Candida albicans mating and possible G(1) dependency." Eukaryot Cell 4(7): 1175-90.
111
