Gene expression values of pattern-recognition ...

Research in Veterinary Science 114 (2017) 31–35

Contents lists available at ScienceDirect

Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc

Gene expression values of pattern-recognition receptors in porcine leukocytes and their response to Salmonella enterica serovar Typhimurium infection Alena Osvaldova a,b, Hana Stepanova a, Martin Faldyna a, Jan Matiasovic a,⁎ a b

Veterinary Research Institute, Hudcova 70, 621 00 Brno, Czech Republic Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno, Palackého 1/3, 612 42 Brno, Czech Republic

a r t i c l e

i n f o

Article history: Received 1 July 2016 Received in revised form 1 February 2017 Accepted 28 February 2017 Available online xxxx Keywords: Pattern-recognition receptors Toll-like receptors Leukocyte Pig Salmonella

a b s t r a c t Pattern-recognition receptors (PRRs) recognize pathogen-associated molecular patterns and play an important role in triggering innate immune responses. PRRs distribution and function is well documented in mice and humans, but studies in pigs are scarce. Salmonella enterica serovar Typhimurium is common pathogen found in pigs and was used as a model for interaction with PRRs. This study investigated expression of PRRs in porcine leukocyte subpopulations at the mRNA level. Eight subpopulations of leukocytes comprising NK cells, Th, Tc, double positive T cells and γδ T cells, B cells, monocytes and neutrophils were sorted, and the expression of 12 PRRs was measured, including selected Toll-like receptors and their co-receptors, NOD-like receptor NOD2, RP-105, CD14, and dectin. The highest expression rates of most PRRs were observed in monocytes and neutrophils. The B cells expressed high levels of TLR1, TLR6, TLR9, TLR10, and RP-105. Only monocytes and γδ T cells were found to respond to Salmonella enterica serovar Typhimurium infection by intensification of PRRs expression. In Th and B cells, PRRs mRNA down-regulation was detected after infection. © 2017 Elsevier Ltd. All rights reserved.

1. Introduction Pattern recognition receptors (PRRs) recognize a number of pathogen-associated molecular patterns (PAMPs) and play an important role in triggering innate immune responses. The most important are the Toll-like receptors (TLR), which are located on cell surfaces or in intracellular compartments such as endosomes (Kaisho and Akira, 2006). TLR2 can form heterodimers with TLR1 and TLR6 and recognize a broad spectrum of bacterial proteins: peptidoglycans, lipopeptides, and lipoteichoic acid. It can also bind with dectin to broaden the range of recognized proteins (Gantner et al., 2003). The most important ligand of TLR4 is lipopolysaccharide of Gram-negative bacteria. TLR4 forms complexes with the MD-2 molecule and recognizes many other PAMPs and damage-associated molecular patterns. TLR5 recognizes flagellin, a major structural subunit of bacterial flagella, but is insensitive in ruminants (Osvaldova et al., 2014). TLR9 is an intracellular receptor; its ligand is unmethylated CpG DNA from intracellular bacteria. TLR10 is the only receptor without a known ligand, although recent studies have indicated that it plays a role in recognizing intracellular pathogens, including Listeria monocytogenes and Salmonella Typhimurium (Regan et al., 2013). Another important group of pattern-recognition receptors are NOD-like receptors (NLR), which are present in the cytoplasm of the cell. NOD1 recognizes bacterial peptidoglycans and NOD2 muramyl ⁎ Corresponding author. E-mail address: [email protected] (J. Matiasovic).

http://dx.doi.org/10.1016/j.rvsc.2017.02.026 0034-5288/© 2017 Elsevier Ltd. All rights reserved.

dipeptide. Dectin is a non-TLR receptor with a role in antifungal immunity; its ligand is β-glucan. RP-105 is a transmembrane receptor, which recognizes lipopolysaccharide (LPS) and is essential for TLR4-MD2 dependent B cell proliferation (Miura et al., 1998; Nagai et al., 2012). CD2 and CR2-like receptors were selected as control molecules since they are typically expressed on both, pig and human NK and T-cells (CD2) or on B-cells (CR2-like). Expression of molecules was assessed at the mRNA level due to a lack of specific monoclonal antibodies against most studied porcine molecules. We also investigated the early response of PRRs in porcine leukocyte subpopulations to Salmonella enterica serovar Typhimurium (Salmonella Typhimurium) infection. Salmonella enterica is an obligate pathogen that colonizes hosts including reptiles, birds, and mammals. Salmonella Typhimurium is one of the most important Salmonella enterica serovars in pigs in Europe (European Food Safety Authority, 2009), where it causes high economic losses. It is also responsible for self-limiting gastroenteritis in humans (Crum-Cianflone, 2008). The main antigen of Salmonella is LPS that is attached to the outer part of the bacterial membrane and consists of three parts independently recognized by porcine neutrophils: lipid A, core polysaccharide part, and O-antigen (Matiasovic et al., 2011). Other important antigens are lipoproteins and flagellin. These molecules are recognized by PRRs and can trigger immune response (Kaisho and Akira, 2006). Pattern recognition receptor function and distribution among leukocyte subpopulations is well documented in mice and humans (Applequist et al., 2002; Sandor and Buc, 2005), but research in pigs is

32

A. Osvaldova et al. / Research in Veterinary Science 114 (2017) 31–35

fluorochrome were used as compensation controls. Compensations were calculated by FACSDiva software. For neutrophil sorting, two methods were used: one subpopulation was sorted according to FSC/SSC characteristics, and the second specifically as CD172α+ SWC8+ cells in order to increase purity of cell suspension. Sorting according to FSC/SSC characteristics was used due to a risk of unspecific stimulation possibly caused by antibody binding. In white blood cells used for sorting, the subpopulation proportions were, on average, 2.3% double positive CD 4+ CD8α+ T cells, 6% Th cells, 15.1% γδ+ T cells, 3% Tc cells, 1.2% NK cells, 7.3% B cells, 7.6% monocytes, 22% neutrophils and 35.4% CD172α+ SWC8+ cells. Purity of sorted cell subpopulations (an average from 3 animals) was as follows: NK cells (96.9%) Th cells (95.2%), Tc cells (99.2%), double positive CD4+ CD8α+ T cells (92.1%), γδ T cells (98.6%), B cells (98.3%), neutrophils CD172αhighSWC8+ (98.7%), neutrophils FSC/SSC (99.4%) and monocytes (95.4%). Gene expression values shown in Table 2 represent an average of the values obtained from all three animals.

rare. The goal of this study was to expand knowledge of PRR expression in porcine immune cells through identification of receptors exhibiting recognition of bacterial molecular patterns and characterization of their distribution among leukocytes and their up- or down-regulation on leukocyte subpopulations following stimulation with phorbolmyristyl-acetate (PMA) and ionomycin or in vitro infection with Salmonella Typhimurium. 2. Materials and methods 2.1. Sample collection and PBMC isolation Peripheral blood was taken from the jugular vein of three 2 to 5month-old Salmonella-free pigs into tubes containing Heparin (1000 U/mL of blood, Léčiva, Czech Republic). For fluorescence activated cell sorting (FACS), 30 mL of hemolytic solution (8.26 g NH4Cl, 1 g KHCO3, 0.037 g EDTA, 1 L distilled water) was added to 3 mL of whole blood to lyse erythrocytes, and cells were resuspended in 30 mL PBS containing 0.2% gelatin from cold-water fish skin (Sigma-Aldrich Inc., St. Louis, USA), 0.1% NaN3, and 0.63 mM EDTA (Sigma-Aldrich Inc., St. Louis, USA). The subpopulations of white blood cells were further isolated on a BD FACSFusion sorter (BD Biosciences, New Jersey, USA). FACS was done in three separate experiments. For magnetic cell sorting (MACS) the peripheral blood mononuclear cells (PBMC) were isolated with Histopaque-1077 (Sigma-Aldrich Inc., St. Louis, USA). MACS from all three animals was done in one experiment. All procedures involving animals were in accordance with applicable laws and ethical standards of the institution.

2.3. Magnetic sorting To investigate leukocyte subpopulation responses to stimulation with PMA and ionomycin and infection with Salmonella Typhimurium, magnetic sorting was applied to obtain a sufficient number of cells in each subpopulation. The isolated subpopulations were monocytes (CD14+ cells), T helper cells (CD4+ cells), γδ+ T cells (γδTCR+ cells) and B cells (IgM+ cells). PBMCs were stained with primary mouse anti-pig antibodies: anti-CD14 (MIL2, IgG2b, AbD Serotec), anti-CD4 (74-12-4, IgG2b, WSU Monoclonal Antibody Center), anti-γδTCR (PGBL22A, IgG1, WSU Monoclonal Antibody Center) or anti-IgM (K521C3, IgG1, AbD Serotec). After incubation (45 min at 4 °C) cells were washed in PBS and goat anti-mouse IgG microbeads (Miltenyi Biotech, Gladbach, Germany) were used as secondary antibodies. The suspension was incubated for 45 min at 4 °C. Subpopulations were sorted on LS columns and a QuadroMACS separator (Miltenyi Biotech, Gladbach, Germany). Purity of sorted cell subpopulations was checked by flow cytometry: CD4+ (CD4+ FSClow: 88.1%; CD4+ cells included approximately 5.5% FSChigh dendritic cells), γδTCR+ (91%), IgM+ (95.4%) and CD14+ (85.4%).

2.2. Fluorescence activated cell sorting (FACS) Selected leukocyte populations were obtained using a BD FACSFusion sorter (BD Biosciences, New Jersey, USA). The sorted subpopulations were NK cells (CD2+ CD16+), Th cells (CD4+ CD8α− γδTCR−), Tc cells (CD8αhighCD4− γδTCR−), double positive CD4+ CD8α+ T cells (CD4+ CD8α+ γδTCR−), γδ T cells (γδTCR+ CD8α± CD4−), B cells (IgM+), neutrophils (CD172αhighSWC8+), and monocytes (CD172αhighSWC8−). Gating strategy is presented in Supplement 1. The cells were stained with primary mouse anti-pig monoclonal antibodies specific to the studied subpopulations (Table 1), then 200 μL goat serum was added and the suspension was incubated for 15 min at 4 °C. Subsequently, cells were washed with PBS and stained with secondary antibodies conjugated with fluorescent dyes (Table 1). The cells were then incubated for 20 min at 4 °C, propidium iodide was added 5 min before the end of incubation, then the samples were washed and resuspended in PBS. Samples stained only with secondary antibodies were used as controls for gating setup. Moreover, one-color samples for each

2.4. In vitro infection and stimulation Cells obtained with magnetic sorting were used in the infection and stimulation trials. The first group of cells was infected in vitro with Salmonella Typhimurium wild type, strain DT104, as described previously (Pavlova et al., 2011). Multiplicity of infection was 10 bacterial cells to 1 culture cell. A second group of cells was stimulated with 0.06 μg of phorbol myristate acetate (PMA) and 1.2 μg of ionomycin

Table 1 Primary and secondary reagents used for FACS. Antigen

Primary Ab clone

Panel 2: NK cells (CD2+ CD16+) CD2 PG168A CD16 G7

−

Primary Ab isotype −

high

IgG3 IgG1

−

−

Fluorochrome +

+

−

Primary Ab source

CD4 γδTCR ; DP T: CD4 CD8α γδTCR ; γδ T: γδTCR CD8α CD4−) Panel 1: T lymphocytes (Th: CD4 CD8 γδTCR ; Tc: CD8α WSU Monoclonal Antibody Center CD4 74-12-4 IgG2b FITCb WSU Monoclonal Antibody Center CD8α 76-2-11 IgG2a PEc a WSU Monoclonal Antibody Center γδTCR PGBL22A IgG1 Alexa Fluor 647 +

FITCb Alexa Fluor 647a

Panel 3: B lymphocytes (IgM+), Neutrophils (CD172αhighSWC8+), Monocytes (CD172αhighSwc8−) IgM K521C3 IgG1 Alexa Fluor 647a CD172α 74-22-15A IgG2b FITCb SWC8 MIL3 IgM PEc a b c

Secondary antibody goat anti-Mouse IgG1-AlexaFluor 647, Life Technologies. Secondary antibody goat anti-Mouse IgG2b (or IgG3) - FITC, Southern Biotechnology. Secondary antibody goat anti-Mouse IgG2a (or IgM) - R-Phycoerythrin, Southern Biotechnology.

+

±

WSU Monoclonal Antibody Center AbD Serotec

AbD Serotec WSU Monoclonal Antibody Center Dr. K. Haverson, University of Bristol, UK

A. Osvaldova et al. / Research in Veterinary Science 114 (2017) 31–35

33

per mL to measure the non-specific response. Cells in a third group were non-stimulated controls. After 2 h incubation in Dulbecco's Modified Eagle's Medium (Gibco, Carlsbad, USA) at 37 °C and 5% CO2, cells were harvested, and RNA was isolated using Tri-reagent (MRC, Cincinnati, USA). Gene expression values shown in Table 3 represent an average of the values obtained from all four animals used for magnetic sorting.

CR2-like mRNA, a typical B-cell molecule in humans, was found to be present in porcine IgM + B cells at a level of 2 orders of magnitude higher than in other leukocyte subpopulations. On the other hand, mRNA for CD2, a molecule typical of human T and NK cells (Plunkett et al., 1987), was, in pigs, found to be distributed at similar levels in all subpopulations.

2.5. qRT-PCR

3.2. PRRs distribution on leukocyte subpopulations following stimulation with PMA and ionomycin or infection with Salmonella Typhimurium

The expression of PRRs was measured by qRT-PCR at the mRNA level normalized based on β-actin gene expression. The β-actin gene was selected for normalization as a second most stable gene in this experiment, while the most stable gene HPRT had very high Ct's or was not detected in samples with low amount of FACS sorted cells. RNA isolated by Tri-reagent (MRC, Cincinnati, USA) was further purified on RNeasy Mini Kit columns (Qiagen, Darmstadt, Germany), and M-MLV reverse transcriptase was used for cDNA generation. Expression of 15 genes of interest was measured: TLR1, TLR2, TLR4, MD2, TLR5, TLR6, TLR9, TLR10, NOD2, CD14, RP105, CR2like, CD2, IL8, and dectin. Gene specific primers were designed using Primer-BLAST (http://www.ncbi.nlm.nih. gov/tools/primer-blast/; β-actin F:tcatcaccatcggcaacg, R:ttcctgatgtcc acgtcgc; IL-8 F:tgaagagaactgagaagcaacaacaacagcag, R:tcttgggagcca cggagaatgggt; TLR1 F:ccttcctgcacagccttcac, R:ctcagtgatcctgacctcttcca; TLR2 F:cggaagataatgaacaccaggac, R:atcgcagctctcaaatttaacca; TLR4 F:gtgctggatttatccagatgtga, R:gatttcccgtcagtatcaaggtg; TLR5 F:tcatgggtt tatcttctccctga, R:gcttggtctgcaatcttgtttatc; TLR6 F:ccaaaagacctgcc accccaaacca, R:accgtcagctgcgagagaaagctg; TLR9 F:ctcagaggacttcatgc caaact, R:actggattgtcaccaggttgttc; TLR10 F:ggtatctcagaatgctgggtcag, R:tgagttgtccttgggttgttttc; NOD2 F:gagcgcatcctcttaactttc, R:acgctcgtg atccgtgaac; CD14 F:gcctggacctcagtcacaact, R:agcgaatgacaaattgagagagc; MD2 F:gagctctgaagggagagactgtg, R:ttcccagagatggcttctacaac; RP105 F:ctttttggatctgacaaggtgc, R:gggatttcctgttaacacaatgg; dectin F:tcaaggc atgtgtcttcccaacctga, R:ctcccaaagccatggcccttcagtc; CD2 F:gggccggaa gccccatccatttc, R:ccgggacgaggagtaggtgcctg; CR2like F:aggctcaccttc cagccagtgtgt, R:agctgcccgtgtgtcttccattgc; TSPAN33 F:attgttcagaag acaaccccagc, R:atggtgttgatcactgcctggtt). When possible, one primer in each primer pair is located on exon-exon junction. Qiagen QuantiTect SYBR Green PCR MasterMix was used for qRT-PCR performed on a LightCycler 480 (Roche, Basel, Switzerland). Total volume of PCR reaction was 10 μL, concentration of each primer was 1 pmol/μL. 2.6. Data analysis mRNA expression in specific leukocyte subpopulations was expressed as relative to mRNA expression of β-actin gene [1/(2Ct gene)]/[1/(2Ct β-actin)] (Zelnickova et al., 2008). mRNA levels in cells subjected to infection and stimulation were normalized to β-actin mRNA and expressed as relative to the unstimulated control. 3. Results 3.1. Distribution of PRRs on porcine white blood cell subpopulations Distribution of pathogen recognition receptors were studied on noninfected and non-stimulated FACS sorted porcine leukocytes. The highest expression of all TLRs, NOD2, CD14, MD2, and dectin was observed on cells of the innate immune system: neutrophils and monocytes (Table 2). The highest values of TLR4 were detected on neutrophils. The lowest expression of TLR4 was on NK cells. Similar results were observed for MD2 and CD14, both important TLR4 co-receptors. Significant expression of RP105 was found in IgM+ B cells and in monocytes and neutrophils, but at lower levels than in B cells. Other TLR's, included TLR1, TLR6, TLR9, TLR10 and TLR2, was found in IgM+ B cells at levels similar to those in γδ+ T cells.

To investigate ability to be activated, we stimulated immune cells non-specifically with PMA and ionomycin. The highest expression of most studied genes was recorded primarily in monocytes (Table 3). Results of the Salmonella Typhimurium infection trial showed that only monocytes and γδ+ T cells exhibit an early response to infection characterized by increased PRR expression (Table 3). The highest upregulation in infected cells was detected for receptors TLR2, TLR5, TLR9, TLR10, and NOD2. In cells of adaptive immunity (Th and B cells), following infection with Salmonella Typhimurium, most of the studied receptors were down-regulated, particularly TLR2, TLR5, TLR9, TLR10, NOD2, RP105. This pattern was mainly seen in B cells, even after stimulation with PMA. The expression of TLR4 and its co-receptor MD2 was reduced following infection with Salmonella Typhimurium in all studied leukocyte types. IL8, a chemokine known to be produced by myeloid cells following S. Typhimurium infection, was measured in tandem with PRRs. Highest response to Salmonella infection was again found in monocytes, with mRNA levels 20 times higher than in control cells. TSPAN33, a marker of activated B cells in human, was in porcine IgM + cells, similarly to other genes measured, found to be downregulated 2 h post both treatments. 4. Discussion It had to be taken into account that positive sorting may influence the expression of molecules investigated. On the other hand, the positive sorting enable to work with very pure subpopulations of cells. We routinely reach better than 95% of purity for FACS and around 90% for magnetic sorting. We believe it is important to reach maximum of purity because the high-expressing contaminants may shift level of molecule studied. 4.1. Distribution of PRRs on FACS porcine white blood cell subpopulations Neutrophils sorted by size and granularity and those sorted by CD172α in combination with the SWC8 marker showed nearly identical expression of all receptors measured. This suggest that both sorting strategy led to very similar subpopulations and/or the labeling did not change the molecule expression a lot. In accordance with results on human and mouse cells (Applequist et al., 2002; Sandor and Buc, 2005), the highest expression of all TLRs, NOD2, CD14, MD2, and dectin was observed on neutrophils and monocytes. The LPS recognition system CD14-TLR4-MD2 showed highest expression in neutrophils, similarly to human cells (Muzio et al., 2000). In contrast, O'Mahony et al. (2008) found expression of TLR4 on human neutrophils and monocytes on the same level. RP105 is another important receptor involved in LPS recognition. It has been identified as a B cell receptor, acting as a TLR4 co-receptor augmenting B cell proliferation, plasma cell production, and immune reaction to T-independent antigen (Miura et al., 1998; Nagai et al., 2012). Divanovic et al. (2005) stated that expression of RP105 in humans is not confined to B cells, but appears also in myeloid cells (monocytes and neutrophils), in which it may show a different function from that in B cells. In myeloid cells, the RP105 prevents the formation of the LPS-TLR4-MD2 complex

34

A. Osvaldova et al. / Research in Veterinary Science 114 (2017) 31–35

Table 2 Distribution of PRRs on unstimulated porcine white blood cell subpopulations.

Porcine leukocytes from three animals were sorted by FACS, and mRNA expression of selected PRRs was measured by qRT-PCR. Number indicate mRNA expression relative to β-actin mRNA level. Standard errors are shown in italics under corresponding expression level. Highest level for each receptor is in bold. Red segue into white is graphical representation of mRNA levels.

Table 3 Distribution of PRRs on stimulated porcine white blood cell subpopulations.

RP105 Std. Error TLR4 Std. Error MD2 Std. Error TLR2 Std. Error CD11a Std. Error TLR5 Std. Error TLR10 Std. Error NOD2 Std. Error CD14 Std. Error TLR9 Std. Error IL8 Std. Error TSPAN33 Std. Error

Th cells PMA+IONO 126% 37% 120% 20% 37% 21% 67% 19% 120% 19% 62% 25% 55% 25% 50% 21% 56% 25% 45% 16% 78% 25% 34% 4%

STM 32% 10% 18% 5% 49% 4% 76% 14% 70% 5% 85% 19% 82% 14% 80% 22% 78% 22% 74% 17% 136% 93% 74% 7%

IgM + B cells PMA+IONO STM 12% 37% 1% 5% 26% 29% 9% 19% 36% 74% 2% 30% 43% 75% 5% 23% 37% 68% 8% 17% 41% 77% 15% 31% 37% 70% 14% 34% 47% 85% 17% 48% 44% 77% 11% 33% 40% 76% 4% 24% 45% 99% 16% 28% 18% 63% 10% 43%

Monocytes PMA+IONO STM 407% 116% 71% 21% 305% 95% 27% 11% 332% 86% 83% 14% 264% 160% 55% 24% 245% 101% 32% 29% 230% 166% 96% 35% 224% 162% 96% 26% 259% 221% 51% 27% 125% 78% 20% 40% 119% 83% 12% 35% 125% 2386% 13% 1095% 158% 178% 6% 65%

γδ + T cells PMA+IONO STM 74% 58% 43% 28% 160% 23% 69% 13% 75% 63% 11% 6% 79% 97% 7% 43% 158% 109% 13% 51% 74% 106% 8% 65% 72% 107% 11% 62% 76% 112% 11% 65% 67% 98% 10% 53% 70% 115% 11% 60% 89% 368% 30% 304% 44% 68% 25% 30%

Porcine leukocytes from four animals were sorted by magnetic sorting and stimulated with phorbol myristate acetate and ionomycin (PMA + IONO) or infected with Salmonella Typhimurium (STM). mRNA expression was measured by qRT-PCR. Red shades indicate up-regulation, green shades down-regulation. Numbers represents percentages of mRNA expression of genes measured under specific conditions relative to unstimulated cells. Standard errors are shown in italics under corresponding expression level.

A. Osvaldova et al. / Research in Veterinary Science 114 (2017) 31–35

and therefore inhibits immune reaction to LPS (Divanovic et al., 2005). Our results showed highest expression of RP105 in porcine IgM+ B cells, at least ten times higher than in monocytes and neutrophils. The ratio of CD14-TLR4-MD2/RP105 is thus much higher on myeloid cells. This indicate possible different role of RP105 in B-cells and myeloid cells. 4.2. PRRs distribution on magnetic-sorted leukocyte subpopulations following stimulation with PMA and ionomycin or infection with Salmonella Typhimurium First, we investigated ability of sorted cells to be further activated by stimulation with PMA and ionomycin. All the cell subpopulations responded by up- or down-regulation of at least some of the molecules studied. In agreement with studies on human monocytes (Zarember and Godowski, 2002), also porcine monocytes responded to PMA and ionomycin most of all subpopulations studied. To Salmonella Typhimurium infection responded by increase of PRR expression mainly monocytes and γδ+ T cells. These cells are present mostly on epithelial surfaces and in tissues and therefore participate in the initial immune response against Salmonella (Janeway et al., 1988). The highest up-regulation in infected cells was detected for receptors TLR2, TLR5, TLR9, TLR10, and NOD2. These results were in accordance with Schwacha and Daniel (2008) who confirmed up-regulation of several PRRs on mouse γδ+ T cells during immune response. On the other hand, cells of adaptive immunity (Th and B cells) down-regulated most of the molecules studied. Interestingly, in porcine IgM+ cells was after both treatments found to be downregulated also TSPAN33, a marker of activated human B cells (Luu et al., 2013). The expression of TLR4 was reduced following infection with Salmonella Typhimurium in all studied leukocyte types, but was not changed in monocytes. It has been previously speculated that down-regulation of TLR4 in cells exposed to LPS is a mechanism of LPS tolerance (Nomura et al., 2000; Martin et al., 2001; Medvedev et al., 2002). However, other studies have reported TLR4 up-regulation after stimulation with LPS (Frantz et al., 1999; Muzio et al., 2000; Zarember and Godowski, 2002). Our results favor the hypothesis of TLR4 down-regulation as a mechanism of LPS tolerance. 5. Conclusion We conclude that pattern-recognition receptors in pigs are chiefly expressed on the cells of innate immunity, i.e. neutrophils and monocytes, which can migrate to tissues, engage in the innate immune response, and recognize PAMPs. Among the studied white blood cell subpopulations, monocytes showed the highest response to Salmonella infection and PMA stimulation. Our study has shown that basic values of gene expression of important PRRs in pigs are similar to those observed in other animals or in humans. Also, Salmonella as a model infection caused by intracellular Gram-negative bacteria, showed cell responses which are in accordance with the situation known in other species. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.rvsc.2017.02.026. Conflict of interest statement The authors have no financial or personal relationships with people or organizations that could have inappropriately influenced this work. Acknowledgement The work was supported by the project LO1218 and ED2.1.00/ 19.0385 from the Ministry of Education, Youth, and Sports of the Czech Republic under the NPU I program. The authors wish to thank Dr. Ludmila Faldíková and Mr. Paul Veater (Bristol, United Kingdom) for proofreading the manuscript.

35

References Applequist, S.E., Wallin, R.A.P., Ljunggren, H.G., 2002. Variable expression of Toll-like receptor in murine innate and adaptive immune cell lines. Int. Immunol. 14, 1065–1074. Crum-Cianflone, N.F., 2008. Salmonellosis and the gastrointestinal tract: more than just peanut butter. Curr. Gastroenterol. Rep. 10, 424–431. Divanovic, S., Trompette, A., Atabani, S.F., Madan, R., Golenbock, D.T., Visintin, A., Finberg, R.W., Tarakhovsky, A., Vogel, S.N., Belkaid, Y., Kurt-Jones, E.A., Karp, C.L., 2005. Negative regulation of TLR4 signaling by RP105. Nat. Immunol. 6, 571–578. European Food Safety Authority, 2009. Analysis of the baseline survey on the prevalence of Salmonella in holdings with breeding pigs, in the EU, 2008, Part A: Salmonella prevalence estimates. EFSA J. 7, 1377. Frantz, S., Kobzik, L., Kim, Y.D., Fukazawa, R., Medzhitov, R., Lee, R.T., Kelly, R.A., 1999. Tol4 (TLR4) expression in cardiac myocytes in normal and failing myocardium. J. Clin. Invest. 104, 271–280. Gantner, B.N., Simmons, R.M., Canavera, S.J., Akira, S., Underhill, D.M., 2003. Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2. J. Exp. Med. 197, 1107–1117. Janeway Jr., C.A., Jones, B., Hayday, A., 1988. Specificity and function of T cell bearing y/δ receptors. Immunol. Today 9, 73–76. Kaisho, T., Akira, S., 2006. Toll-like receptor function and signaling. J. Allergy Clin. Immunol. 117, 979–987. Luu, V.P., Hevezi, P., Vences-Catalan, F., Maravillas-Montero, J.L., White, C.A., Casali, P., Llorente, L., Jakez-Ocampo, J., Lima, G., Vilches-Cisneros, N., Flores-Gutiérrez, J.P., Santos-Argumedo, L., Zlotnik, A., 2013. TSPAN33 is a novel marker of activated and malignant B cells. Clin. Immunol. 149, 388–399. Martin, M., Katz, J., Vogel, S.N., Michalek, S.M., 2001. Differential induction of endotoxin tolerance by lipopolysaccharides derived from Porphyromonas gingivalis and Escherichia coli. J. Immunol. 167, 5278–5285. Matiasovic, J., Stepanova, H., Volf, J., Kubala, L., Ovesna, P., Rychlik, I., Faldyna, M., 2011. Influence of the lipopolysaccharide structure of Salmonella enterica serovar Enteritidis on interactions with pig neutrophils. Vet. Microbiol. 150, 167–172. Medvedev, A.E., Lentschat, A., Wahl, L.M., Golenbock, D.T., Vogel, S.N., 2002. Dysregulation of LPS-induced Toll-like receptor 4-MyD88 complex formation and IL-1 receptor-associated kinase 1 activation in endotoxin-tolerant cells. J. Immunol. 169, 5209–5216. Miura, Y., Shimazu, R., Miyake, K., Akashi, S., Ogata, H., Yamashita, Y., Narisawa, Y., Kimoto, M., 1998. RP105 is associated with MD-1 and transmits an activation signal in human B cells. Blood 92, 2815–2822. Muzio, M., Bosisio, D., Polentarutti, N., D'amico, G., Stoppacciaro, A., Mancinelli, R., Van't Veer, C., Penton-Rol, G., Ruco, L.P., Allavena, P., Mantovani, A., 2000. Differential expression and regulation of Tol-like receptors (TLR) in human leukocytes: selective expression of TLR3 in dendritic cels. J. Immunol. 164, 5998–6004. Nagai, Y., Yanagibashi, T., Watanabe, Y., Ikutani, M., Kariyone, A., Ohta, S., Hirai, Y., Kimoto, M., Miyake, K., Takatsu, K., 2012. The RP105/MD-1 complex is indispensable for TLR4/ MD-2-dependent proliferation and IgM-secreting plasma cell differentiation of marginal zone B cells. Int. Immunol. 24, 389–400. Nomura, F., Akashi, S., Sakao, Y., Sato, S., Kawai, T., Matsumoto, M., Nakanishi, K., Kimoto, M., Miyake, K., Takeda, K., Akira, S., 2000. Cutting edge: endotoxin tolerance in mouse peritoneal macrophages correlates with down-regulation of surface toll-like receptor 4 expression. J. Immunol. 164, 3476–3479. O'Mahony, D.S., Pham, U., Iyer, R., Hawn, T.R., Liles, W.C., 2008. Differential constitutive and cytokine-modulated expression of human Toll-like receptors in primary neutrophils, monocytes, and macrophages. Int. J. Med. Sci. 5, 1–8. Osvaldova, A., Woodman, S., Patterson, N., Offord, V., Mwangi, D., Gibson, A.J., Matiasovic, J., Werling, D., 2014. Replacement of two aminoacids in the bovine Toll-like receptor 5 TIR domain with their human counterparts partially restores functional response to flagellin. Dev. Comp. Immunol. 47, 90–94. Pavlova, B., Volf, J., Ondrackova, P., Matiasovic, J., Stepanova, H., Crhanova, M., Karasova, D., Faldyna, M., Rychlik, I., 2011. SPI-1-encoded type III secretion system of Salmonella enterica is required for the suppression of porcine alveolar macrophage cytokine expression. Vet. Res. 42, 16. Plunkett, M.L., Sanders, M.E., Selvara, J.P., Dustin, M.L., Springer, T.A., 1987. Rosetting of activated human T lymphocytes with autologous erythrocytes. Definition of the receptor and ligand molecules as CD2 and lymphocyte function-associated antigen 3 (LFA3). J. Exp. Med. 165, 664–676. Regan, T., Nally, K., Carmody, R., Houston, A., Shanahan, F., MacSharry, J., Brint, E., 2013. Identification of TLR10 as a key mediator of the inflammatory response to Listeria monocytogenes in intestinal epithelial cells and macrophages. J. Immunol. 191, 6084–6092. Sandor, F., Buc, M., 2005. Toll-like receptors. II. Distribution and pathways involved in TLR signalling. Folia Biol. 51, 188–197. Schwacha, M.G., Daniel, T., 2008. Up-regulation of cell surface Toll-like receptors on circulating γδ T-cells following burn injury. Cytokine 44, 328–334. Zarember, A., Godowski, P.J., 2002. Tissue expression of human toll-like receptors and differential regulation of toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines. J. Immunol. 168, 554–561. Zelnickova, P., Matiasovic, J., Pavlova, B., Kudlackova, H., Kovaru, F., Faldyna, M., 2008. Nitric oxide production by rat, bovine and porcine macrophages. Nitric Oxide Biol. Chem. 19, 36–41.