Jan 23, 1989 - form the basis for the construction of a second generation of .... 89:224. 22 Visser, S., F. A. Exterkate, C. J. Slangen, and G.J.C.M. dc Veer. 1986 ...
Gene Organization and Expression in Mesophilic Lactic Acid Bacteria WILLEM M. DE VOS, 1 PIETER VOS, GUUS SIMONS, and SILKE DAVID Molecular Genetics Group Department of Biophysical Chemistry Netherlands Institute for Dairy Research PO Box 20, 6710 BA EDE, The Netherlands
A~A~ A detailed understanding of gene structure and expression in lactic acid bacteria is essential for the successful application of genetic modification techniques for both the improvement of these bacteria used in industrial dairy and food fermentations and their use as food-grade production organisms. This paper is intended to review the organization and expression of homologous and heterologous genes in the mesophilic lactic acid bacteria of the genera Lactococcus and Leuconostoc. Specific attention is given to the wellstudied lactococcal lactose and proteinase genes encoding the fermentation of lactose and the degradation of casein, respectively. The detailed molecular analysis of these genes and their gene products has been applied in lactococci to the development of a food-grade marker system and overproduction and complete secretion of a proteinase with an unique caseinolytic specificity. In addition, it enabled the construction of expression and secretion vectors. These have been used for the expression of Escherichia coil lacZ gene fusions encoding ~-galactosidase in Lactococcus and Leuconostoc. Moreover, the functionality of the identified expression and topogenic signals has been demonstrated by the production and secretion of bovine prochymosin in lactococci. INTRODUCTION Considerable progress has been made in the
ReceivedJanuary23, 1989. AcceptedJune19, 1989. 11"owhomcorrcspundenc,shouldbe addressed. 1989 J Dairy Sci 72:3398-3405
genetic analysis of lactic acid bacteria used in industrial dairy fermentations as a result of the rapid development of host-vector systems (2, 6, 15). Two main factors have contributed to establishing these systems that were originally developed for the mesophilic lactic acid bacteria belonging to the species Lactococcus lactis ssp. lactis or cremoris (previously designated Streptococcus crernori$ or Streptococcus lactis). First of all, transformation protocols based on the process of electroporadon, which had demonstrated its efficiency in Lactobacillus casei (2), could be successfully applied to various lactic acid bacteria (3). This included strains of transformable species that had been recalcitrant to the established protoplast transformation procedures (15), such as the industrially used L. lactis ssp. cremoris strains and also species and genera that could not be transformed at all, such as Streptococcus thermophilus, LactobaciUus bulgaricus, and various Leuconostoc spp. (3, 4, 16). Second, it appeared that most of the broad host-range lactococcal cloning vectors (6) were able to replicate in these transformable lactic acid bacteria. As a result, many of the important dairy lactic acid bacteria may now be genetically modified using the panoply of plasmid vectors developed for lactococci (see Table 1 for a summary). Strong interest continues for the further development of these first generation cloning systems and their use in establishing genetically modified lactic acid bacteria. The objectives underlying this interest have both fundamental and applied aspects. First of all, improved cloning systems allow the detailed investigation of fundamentally interesting genetic, physiological, and ecological properties of lactic acid bacteria. In addition, specific and controllable improvements may be introduced into the fermentative properties of lactic acid bacteria. Finally, there are a number of inherent properties that make lactic acid bacteria promising candidates as production organisms for the synthesis
3398
SYMPOSIUM: GENETICS OF LACTIC ACID BACTERIA
3399
TABLE 1. Lacticacid bacteriathat are accessibleto geneticmodificationtechniquesusingthe cloningvectorsdeveloped for lactoct~i (3, 4, 16). Species Streptococcus thermoptu'lus LacwbaciU~ acidophii~ Leuconostoc dextranicum Leuconostoc lactis Leuconostoc paramesenteroides Lactococcus lactis ssp. lac~ Lactococcus lactis ssp. lactia vat. diacetylactis Lactococcus lactis ssp. cremoris
of proteins or metabolites for the food industry. Lactic acid bacteria are food-grade and palatable; they have the potential to ferment cheap subswates under simple, anaerobic conditions; and they have the capacity to secrete proteins since they are gram-positive bacteria. The latter property is of particular relevance for the production of heterologous proteins since lactic acid bacteria have a low level of exwacellular proteases, which make them attractive alternafives for the production organisms presently used in the food or pharmaceutical industry. However, for the application of genetic modification techniques in lactic acid bacteria, a detailed understanding of gene expression and gene structure is essential. This paper is intended to summarize the organization and expression of the lactococcal lactose and proteinase genes, which presently are the best characterized genes of lactic acid bacteria. In addition, the applications of the resulting-molecular information in developing food-grade selection, expression, and secretion systems for the mesophilic lactic bacteria of the genera Lactococcus and Leuconostoc are briefly discussed. LAGTOCOCCAL LACTOSE GENES
The primary function of lactic acid bacteria is the fermentation of lactose into lactate. It is well-known that industrially used strains of Lactococcus lactis ferment lactose in a homolactic fashion that is initiated by the t~'ansport of the milk sugar via a phosphoenolpyruvate (PEP)-dependent phosphowansferase system (PTS) (12). In this lactose:PTS the phosphoryl group of PEP is transferred to lactose via a chain of reactions in which the lactose-specific
phosphocarrier Factor III (Enzyme III) and the transmembrane protein Enzyme II are the last intermediates. The resulting lactose-6-phosphate is subsequently hydrolyzed into glucose and galactose-6-phosphate by a phospho-~-galactosidase, which is unique for this lactose: PTS. The observation that in various lactococcal stxains the genes encoding these three lactose-specific enzymes are plasmid encoded has both facilitated and stimulated the genetic analysis of these lactose genes (8). The best characterized lactose genes so far are those of L. lactis strain 712. Structure of the Lactococcus 712 Lactose Genes
The lactose genes of L. lactis 712 have been located on the mini-lactose plasmid pMG820 by deletion mapping studies (10). This allowed the cloning and expression of the phospho-l~galactosidase gene in E. coil (17) and subsequently in L. lactis (8, 9). The nucleotide sequence of a 4.5-kilobase (kd) fragment containing this gene was determined and appeared to contain various, unidirectional open reading frames. A number of approaches have been used to assign the genes for Enzyme II (lacE) and Factor III (lacF) and phospho-{3-galactosidase (/acG) to these open reading frames, including cloning and overexpression in E. coil; cloning, expression, and complementation in L. lactis; and the analysis of the expression products using antibodies raised against purified proteins (7, 9, 12). Furthermore, the N-terminal amino acid sequences of the purified expression products of the lacG and lacF genes have been determined (9) (W.M.de Vos et al., manuscript in preparation), allowing the exact positioning of these genes. The final result of this analysis Journal of Dairy Science Vol. 72, No. 12, 1989
3400
Lac F
DE VOS El" AL.
Lac E
l.ac G
,
,
1 kb
Figure 1. Structure and transcriptional organization of the Lactococcus/act/s ssp./act/s 712 lactose (Lac) genes.
kb = Kilobase.
(Figure 1) indicates that the lactose genes are organized in an operon-type structure containing small intercistronic regions. Expression and transcription studies in L. lactis showed that the lactose genes are indeed organized into a single transcriptional unit. The upstream region of lactose operon is not contained in the sequenced DNA regions that, therefore, do not contain the original, strong lac-promoter. This promoter has now been isolated and is presently the subject of further genetic analysis. The exact positioning of the lacF and lacG genes allowed the direct identification of translational initiation signals for these highly expressed genes. The ribosome-binding sites have a high complementarity (TAG values varying from -14 to -16 kcal/mol) to the 5" end of the L. lactis 16S rRNA, similar to what has been observed for other putative lactococcal translational initiation signals (6). Furthermore, the first of the lactose-specific genes, the /acF gene, starts with an T r G codon, whereas the /acG gene, and presumably also t h e / a c e gene, starts with the more common ATG triplet. Development of a Food-Grade Selection b'~/stem in /.a~oco~/act~
Because lactose is the only fermentable sugar present in media used in the dairy industry, and lactose-proficient strains may be easily distinguished from lactose-deficient strains (10, 18), the ability to ferment lactose may have wide potential as a food-grade selection marker in lactic acid bacteria. An ideal marker gene should be as small as possible. Therefore, the 318-bp lacF gene was selected as the most suitable candidate to develop a food-grade selection system. Additionally, an important factor supporting this initial Journal of Dairy Science Vol. 72, No. 12, 1989
choice was the fact that Park and McKay (18) and Wolfe and McKay (25) had isolated a lacFdeficient mutant, designated YP2-5, after mutagenesis of a L. lactis derivative containing chromosomally encoded lactose genes. Further genetic analysis of strain YP2-5 using specific DNA probes showed that this strain contained a single copy of the lactose genes. Therefore, the chromosomal/acF gene from strain YP2-5 was isolated, cloned, and sequenced and indeed contained a mutation in the lacF gene (W. M. de Vos et al., manuscript in preparation). Subsequently, a functional /acF gene was isolated as a .4-kb DNA fragment from pMG820 and cloned in L. lactis under direction of a vector located promoter. This precaution was necessary to obtain expression of the lacF gene; it is located within the lactose operon and as a consequence does not contain a functional promoter (see Figure 1). When the final construct was introduced by electroporation into the L. /actis strain YP2-5, a direct selection of lactose-proficient transformants appeared possible by the complementation o f / a c F deficiency of this host (7; W, M. de Vos et al., manuscript in preparation). In addition, the resulting hostplasmid combination could be stably mainmined for more than 100 generations in both laboratory and industrially used media containing lactose. In glucose-containing media, however, curing of the plasmid was observed as a result of the segregational instability of the selected plasmid vector. These results demonstrate that based on a detailedgenetic analysis of its constituents, it is possible to develop a food-grade system for the selection and maintenance of genetically modified lactic acid bacteria. LACTOCOCCAL PROTEINASE GENES
Lactococci contain a complex proteolytic system that is essential for rapid growth in milk and the development of flavor during maturation of a fermented dairy product (20). A key enzyme in this proteolysis is a cell envelope located serine proteinase. Two main types of this proteinase, PI and PIII, may be distinguished on the basis of their cleavage specificity toward casein (21). Model studies have shown that the Pill type proteinase that is capable of degrading O.sr, ~-, and r-casein does not produce the bitter testing peptides
SYMPOSIUM: GENETICS OF LACTIC ACID BACTERIA 1 33
Prt M
Prt P
187
PROT~INASE
3401 1962
,
1 kb
Figure 2. Structure and transcriptional organization of the Lactococc~ lactis ssp. cremorisSKII proteinase (Prt) genes. The overlapping promoter region is indicated by 0 on the arrow, kb = Kilobase.
f~om casein that are observed with the PI type proteinase (5, 6). The structural genes for both types of proteinase have been cloned, expressed, and sequenced (6, 14), and the primary sequences appear to differ in 44 amino acid residues, some of which are located in essential regions (23). The genetic information for the PIII type proteinase from the industrial L. lactis ssp. cremoris strain SK11 has been analyzed in detail and used as a model to explore the possibilities for a rational alteration of the proteolytic system in lactococci (5, 7, 23). Structure of the Lactococcus lactis SK11 Protl)inase Genes and Their Products
Lactococcus lactis ssp. cremoris strain SKI 1 carries a 78-kb plasmid pSK111 that encodes the production of a PIII-type proteinase. A region of approximately 10 kb, containing the genetic information for this proteinase, has been identified on pSK111 and completely sequenced (7, 23, 24). Cloning and expression studies in L. lactis and E. coli have shown that this region contains two oppositely orientated genes, prtP and prtM (see Figure 2 for a summary of their organization). These are essential for the production of an active proteinase (7, 24). The prtP gene is the structural gene for the S K l l proteinase and contains an open reading frame for a 206-kdal protein with a primary structure that is summarized in Figure 3. Homology studies showed that this lactococcal proteinase has significant amino acid sequence homology to a number of refine proteinases of the subtilisin family (Figure 3). This homology is centered around the aspartic acid, histidine, and serine residues of the active site Iriad of these enzymes and is also found in the substrate binding region. N-Terminal amino acid sequence analysis of the active S K l l proteinase
m
130106
m
m
380
Figure 3. Schematic representation of the Lactococcus lac~ ssp. cremoris SKll proteinasc and comparisonwith subtilisin. The homologous regions around the active site amino acids (D. H, and S) are shown by the bats. Signal pcptides (presequences) and prosequences are represented by the black and dashed boxes, respectively.The black box designated MA indicates the membrane anchor sequence, which is separated from the active site triad by a spacer region,
showed that, in analogy with other refine proteinases, the SK11 proteinase is produced as a pre-pro-protein (23, 24). The prtM gene encodes a 33 kdal protein that is involved in the maturation of the proteinase precursor into an active enzyme (24). An identical protein is also required for the activation of the PI type proteinase of L. lactis ssp. cremoris Wg2 (11). Evidence for the role of the prtM gene product as a trans-acting maturation enzyme is based on the following observations (24): 1) only L. lactis clones containing the DNA region containing both prtP and prtM genes produce a functional proteinase with an apparent size of approximately 135 kdal; 2) in the absence of a functional prtM gene, a proteolytically inactive proteinase precursor is formed that is approximately 80 kdal larger than the active proteinase; 3) active proteinase is also formed when the prtP and prtM genes are located on compatible plasmids; 4) the active SK11 proteinase does not contain the first N-terminal 187 amino acids (with a size of approximately 20 kdal) that are deduced to be present in the primary prtP gene expression product (Figure 3). In order to account for the observed size and N-terminal differences of the precursor and mature proteinase, it is assumed that processing of the inactive, primary translation product of the prtP gene, which is synthesized as a pre-pro-proteinase (see above and Figure 3) occurs both at the N- and C-terminal ends of the protein. Transcription studies have shown that the transcription initiation occurs at the small, 324-base pair (bp), intercistronic region between the oppositely orientated prtP and prtM Journal of Dairy Science Vol. 72, No. 12, 1989
3402
DE VOS
genes. This AT-rich region contains two overlapping promoters that initiate the divergent transcription of both genes (Figure 2 and 4). Interestingly, the transcription of the genes occurs at oppositely located nucleotides in the central part of a 44-bp long region that consists almost exclusively of AT base pairs and has an unusual rotational symmetry (Figure 4). It is likely that this structure is involved in the coordinate expression of both prtP and prtM genes and may constitute a common regulation site in analogy with other divergently organized transcriptional units (1). These results indicate that for a functional expression of the lactococcal proteinase both the prtP and prtM genes have to be cloned and expressed coordinately.
ETAL. anchor sequence (MA) (see Figure 3) that conrains a membrane spanning u-helix flanked by a proline-rich region at the extracellular Nterminal end and a highly charged intracellular region at the C-terminal end (23). Ovorproduetion and Secretion o! the Lactococcus lactis $K11 Proteinase
The detailed information of the SK11 proteinase genes was used to modify the amount and location of the SKl l proteinase. A 6-kh DNA fragment of the proteinase plasmid pSKI 11 carrying the complete SKI 1 proteinase gene, including its transcription terminator that is located approximately 100 bp downstream of the prtP gene and the prtM gene was cloned Topc.~enic Signals in the into a lactococcal plasmid vector. The plasmidLactococcus ~ SKll prlP and pr/M flee L. lactis ssp. lactis strain MG1363 (10) Expression Products containing the resulting plasmid appeared to Inspection of the N-terminal amino acid se- produce several fold more of the PIII-typ¢ proquences deduced from the nucleotide sequences teinase than the original SK 11 strain containing of the priM and prtP genes shows in both cases the wild-type proteinase plasmid p S K l l l (7, the presence of a signal sequence (presequence, W. M. de Vos et al., in press). The initial Figure 3), indicating that these proteins are growth and acidification rates in milk of the located outside the cellular membrane. Evi- strain with elevated proteinase levels were dence for the functionality of the signal se- higher than those of control strains (P. Vos et quence of the SKI 1 proteinase has been ob- al., manuscript in preparation). The most likely tained from gene fusion studies. The prtM explanation for the overproduction of the SK11 expression product may be covalently linked to proteinase is the gene dosage effect as a consethe membrane lipids and therefore associated quence of the use of a plasmid vector with a with the cell envelope, since it contains a con- moderately high copy number, sensus lipoprotein signal sequence (11, 24). Identification of the membrane anchor seThe lactococcal proteinases are also present quence in the proteinase (Figure 3) allowed the at the cell envelope (20, 22). The mechanism construction of prtP genes that lacked this sethat accounts for thisfixed position has recently quence. Such constructs were made in various been clarified by comparing the C-terminal ways and introduced in proteinase-deficient L. amino acid residues of the prtP gene product lactis ssp. lactis and cremoris hosts. The resultwith a number of cell envelope located proteins ing strains were all proteinase proficient and from gram-positive bacteria.All these C-termi- invariably produced a completely secreted pronal sequences consist of a consensus membrane teinase that retained its PIII type specificity
-35
-i0 ~ * TTGAATTTGTTCTTCAATAGTATATAATATAATAGTAT AACTTAAACAAGAAGTTATCATATATTATATTATCATA
ATAATATTATATTATATAATATAAT CTTAACTACATCAA TATTATAATATAATATATTATATTAGAATTGAT GTAGTT -i0
-35
Figure 4. Nucleotide sequence of the overlapping promoter sequences of the Lactococcu~ lactis ssp. cremoris SK11 prtP and prtM genes. The canonical -35 and -10 sequences of the promoter for the prtP gene are overlined and those for
the prtM gen¢ are underlined.The transcription initiationsite of the prtP gene promoter is indicatedwith an astcrix. Journal of D a ~ Science Vol. "/2, No. 12, 1989
SYMPOSIUM: GENETICS OF LACTIC ACID BACTERIA
3403
38
28
18 r (
-10
(
'11
,,
33
,~•
~--
62
-21)
-38 1
Figure 5. Hydropathyplot of the first 74 N-terminalamino acids of the Lactococcus lactis ssp. cremoris SKI 1 pard) gent product.The positionof the signal peptideconsensuscleavagesite alaninedalaninepresent at positions33/34 and 62/ 63 is indicated.
toward casein (5). In contrast to the general properties of other extracellular proteinases in gram-positive bacteria, the production of the SKI 1 proteinase appeared to be independent of the growth phase of the culture in pH-controlled fermentors. Complete secretion of the SK11 proteinase may have advantages for the preparative isolation of this Pill-type proteinase and its application in the degradation of casein into nonbitter peptide fractions.
This provides the additional advantage to analyze the efficiency of the proteinase signal sequence in secreting a heterologous protein. The hydropathy plot of the first N-terminal amino acid sequence of the SKl l proteinase shown in Figure 5 illustrates the characteristics of the employed signal sequence.
HETEROLOGOUS GENE EXPRESSION IN MESOPHILIC LACTIC ACID BACTERIA
The E. coli lacZ gene is one of the best characterized model genes used in the analysis of bacterial gene expression. A lacZ gene fusion was made by fusing the expression signals and the first 9 N-terminal amino acids from the L. lactis SKl l prtP gene to the 8th codon of the lacZ gene (8). After insertion on the broad host-range lactococcal cloning vector pNZ17 (6), the final construct was transformed into E. coli (8), L. lactis (8) and Leuconostoc paramesenteroides (4). In the latter case, use was made of an host-vector system based on a optimized electroporation procedure developed for Leuconostoc (4). In all cases lactose-deficient strains devoid of [3-galactosidase or phospho-13gaiactosidas¢ were employed to allow easy de-
Apart from a variety of antibiotic resistance genes from mainly gram-positive origin, only a few heterologous genes have been expressed in mesophilic lactic acid bacteria. These include the E. coli lacZ gene (8), the bovine prochymosin gene (13, 19), and the gene for egg white lysozyme (21). In all cases, use was made of in-frame gene fusions with well-described streptococcal expression signals. In the expression studies summarized here, gene fusions were made with DNA fragments containing the well-characterized expression signals and part of the coding sequence of the L. lactis SKI 1 prtP gene (Figures 2, 3, and 4).
Expression of an Escherichia coil lacZ Gene Fusion in Lactococcus and Leuconostoc
Journal of Dairy Science Vol. 72, No. 12, 1989
3404
DE VOSETAL.
termination of the expression of the lacZ gene fusion. High expression of the lacZ gene fusion was observed in E. coil [up to 5% of the total protein, (8)]. In the mesophilic lactic acid bacteria containing the lacZ gene fusion, high levels of ~-galactosidase were also found (approximately I000 nmol/min per mg protein). These results demonstrate the functionality and efficiency of the employed lactococcal expression signals in both gram-positive and gram-negative hosts and also illustrate the use of lactococcal expression vectors in the mesophilic lactic acid bacteria. Exprmmion and Secretion of the Bovine Prochymosin in Lactoooccus/aot/s
A cDNA for the bovine prochymosin B (PCB) gene was fused to a DNA fragment containing the expression signals and the coding sequence for either 8, 33, or 62 N-terminal codons of the L. lactis SK11 prtP gene [ (23), see Figure 5]. The resulting constructs were cloned on a broad host range, high copy number, lactococcal cloning vector, and the synthesis of prochymosin was studied by Western blot analysis in E. coli and L. lactis (19, G. Simons et al., manuscript in preparation). In both hosts, only intracellular prochymosin synthesis could
be demonstrated when the PCB gene was fused to the 8th codon of the prtP gene. In contrast, when the PCB gene was fused to codon 33, a protein band with a similar size as prochymosin was found in the periplasmic fraction of E. coli or in cell-flee supematants of L. lactis. When fused to codon 62, however, a protein band with an slightly increased size (approximately 3 kdal) could be detected in both hosts. These results demonsWate the functionality of the SKI 1 prtP signal sequence in secreting heterologous proteins in L. lactis and E. coli and strongly indicate that this signal sequence consists of 33 codons. Moreover, it provides the first example of the exploitation of the secretory pathway of lactic acid bacteria and demonstrates the usefulness of the developed secretion vectors in lactococci. CONCLUDING REMARKS
The detailed molecular analysis of the lactococcal lactose and proteinase genes has initiJournal of Dairy Science Vol. 72, No. 12, 1989
ated a basic understanding of gene organization and expression in lactic acid bacteria. This allowed for the first rational changes to be made in important dairy functions and resulted in starter strains that overproduced or secreted proteinase. Furthermore, it provided the components for a food-grade marker system that could form the basis for the construction of a second generation of homologous and safe vectors. These are indispensable for the uncontained use of genetically modified lactic acid bacteria in dairy and other food products. Finally, the basic genetic analysis of the proteinase gene provided the tools for developing expression and secretion vectors that effected the synthesis of heterologous proteins in the mesophilic lactic acid bacteria of the genera Lactococcus and Leuconostoc. The secretion of bovine prochymosin in lactococci exemplifies a simple production system for an industrial protein and illustrates that genetically modified lactic acid bacteria have potential as food-grade production organisms. ACKNOWLEDGMENTS
We are grateful to L. L. McKay for providing us with lactose-deficient strains. Part of this research was supported by research contracts from the Biotechnology Action Programme of the Commission of the European Communities (CEC contract BAP-0011-NL), the Cooperative Rennet and Colouring Factories (CSKF), and the Netherlands Council for Agricultural Research (NRLO). REFERENCES
1 Beck,C. F., and R.A.J. Warren. 1988.Divergentpromoters, a common form of gene organization. Microbiol. Rev. 52:318. 2 Chassy, B. M., and J. F. Flickinger.1987. Transformationof Lactobacillus casei by electroporation.Fed. Eur.
Microbiol. Soc. Microbiol. Lett. 44:173. 3 Chassy,B. M., A. Mercenier, and J. F. Flickinger. 1988. Transformation of bacteria by electroporation. Trends Biotechnol. 6:303. 4 David, S., G. Simons, and W. M. de Vos. 1989.Plasmid transformationby electroporationof Leuconostocparamesenteroides and its use in molecular cloning. Appl. Environ. Microbiol. 55:1483. 5 De Vos, W. M. 1986. Genetic improvementof starter streptococci by the cloning and expression of the gene encoding a non-bitterproteinase.Page a65 in Biomolecular engineering in the European Community.E. Magnien, ed. Martinus-NijhoffPubl., Dordrecht, Boston, Lancaster. 6 De Vos, W. M. 1987. Gent cloning and expression in
SYMPOSIUM: GENETICS OF LACTIC ACID BACTERIA lactic streptococci, Fed. Ear. Microbiol. Soc. Microbiol. Rev. 46:281. 7 Dc Vos, W. M. 1988. Genetic manipulation of lactic acid bacteria for improved dairy fermentations. Page 29 in Biotechnology Action Programme progress report 1988. Vol. 3. E. Maenien, ed. Office Offic. Publ. Ear. Commun., Luxcmbourg. 8 De Vos, W. M., and G. Simons. 1988. Molecular cloning of lactose genes in dairy lactic streptococci: the phospho15-galactosid,~se and [Ygalactosidase genes and their expression products. Biochimie 70:461. 9 de Vos, W. M., and M. J. Gasson. 1989. Structure and expression of the Lactococcus lactis gene for phospho-~galactosidase (/acG) in E$cherichia coli and L. lacgs. J. Gen. Microbiol. 135:1833. 10 Gasson, M. J. 1983. Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplasbinduced curing. J. Bactcriol. 154:1. 11 Haandrikman, A. J., J. Kok, H. Laan. S. Socmitro, A. M. I.edebocr, W. N. Konings, and G. Venema. 1989. Identification of a gene required for maturation of an extracellular lactococeal proteinasc. J. Bacteriol. 17h 2789. 12 Hengstenherg, W., B. Reiche, R. Eisermann, R. Fischer, U. Keszler, A. Tarrach, W. M. de Vos, H. R. Kalbitzcr, and S. Giaser. 1989. Structure and function of proteins involved in sugar transportby the PTS of gram-positive bacteria. Fed. Eur. Microbiol. Soc. Microbiol. Rev. 63: 35. 13 Klessen, C., K. H. Schmidt, J. J. Ferretti, and H. Malke. 1988. Tripartite streptokinase gone fusions for grampositive and gram-negative procaryotes. Mol. C-en. Genet. 212:295. 14 Kok, J., andG. Venema. 1988. Genetics of proteinases of lactic acid bacteria. Biochimie 79:475. 15 Kondo, J. K., and L. U McKay. 1985. Gene transfer systems and molecular cloning in group N streptococci: a review. J. Dairy Sci. 68:2143. 16 Luchansky, J. B., P. M. Muriana, and T. R. Klaenhammet. 1988. Application of electroporation for transfer of plasmid DNA to Lactobacillus, Lactococcus, Leacono-
3405
stoc, Listeria, Pediococcu& Bacillus, Staphylococcus, Enterococcus and Propionibacterium. Mol. Microbiol. 2:637. 17Maeda, S. M., and M. J. Gasson. 1987. Cloning, expression and location of the Streptococcus lactis gent for phospho-l~-galactosidas¢. J. Gen. Microbiol. 132: 331. 18 Park, Y. H., and L. L. McKay. 1982. Distinct galactose phosphoenolpyruvate-dependent phosphotransferase system in Streptococcus lactis. J. Bacteriol. 149:420. 19 Simons, G., and W. M. de Vos. 1987. Gene expression in lactic streptococci. Page 458 in Proceedings of the Fourth European Congress on biotechnology. Vol. I. O. Neyssel, R. van der Meet, and K. Luyben, cd. Elsevier Sci. Publ., Amsterdam, Neth. 20 Thomas, T. D., and G. G. Pritchard. 1987. Protcolytic enzymes of dairy startercultures.Fed. Eur. Microbiol. Soc. Microbiol. Rev. 46:245. 21 Van de Guchte, M., J.M.B.M. van der Vossen, J. Kok, and G. Venema. 1989. Construction of a lactococcal expression vector: Expression of hen egg white lysozymc in Lactococcus lactiasubsp./act/s.Appl. Environ. Microbiol. 89:224. 22 Visser, S., F. A. Exterkate, C. J. Slangen, and G.J.C.M. dc Veer. 1986. Comparative study of action of cell wall proteinases from various strains from Streptococcus cremoris on bovine asl-, [~-,and z-casein. Appl. Environ. Microbiol. 52:1162. 23 Vos, P., G. Simons, R. J. Siczcn, and W. M. de Vos. 1989. Primary structureand organization of the genc for a prokaryotic, cell-envelope serinc proteinasc. J. Biol. Chem. 264:13579. 24 Vos, P., M. van Asscldonk, F. van Jcvcren, R. L Siczcn, G. Simons, and W. M. de Vos. 1989. A maturation protein is essentialfor the production of active forms of Lactococcua lactisSKI l serinc proteinasc located in or secreted from the cell envelope. J. Bactcriol. 171:2795. 25 Wolfe, T. W., and L. L. McKay. 1984. Isolation and partialcharacterizationof lactose-negativemutants from StreptococcuslactisC2 deficientin the phosphotransfcrasc system. J. Dairy Sci. 67:950.
Journal of Dairy Science Vol. 72, No. 12, 1989
