Gene Silencing by Systemic Delivery of Synthetic ...

doi:10.1016/S0022-2836(03)00181-5

J. Mol. Biol. (2003) 327, 761–766

COMMUNICATION

Gene Silencing by Systemic Delivery of Synthetic siRNAs in Adult Mice Dag R. Sørensen1, Marianne Leirdal2 and Mouldy Sioud2* 1 Department of Comparative Medicine, The National Hospital, Oslo 0310, Norway 2

Department of Immunology Molecular Medicine Group The Norwegian Radium Hospital, Montebello, Oslo 0310, Norway

In mammalian cells, RNA duplexes of 21 – 23 nucleotides, known as small interfering RNAs (siRNAs) specifically inhibit gene expression in vitro. Here, we show that systemic delivery of siRNAs can inhibited exogenous and endogenous gene expression in adult mice. Cationic liposome-based intravenous injection in mice of plasmid encoding the green fluorescent protein (GFP) with its cognate siRNA, inhibited GFP gene expression in various organs. Furthermore, intraperitoneal injection of anti-TNF-a siRNA inhibited lipopolysaccharide-induced TNF-a gene expression, whereas secretion of IL1-a was not inhibited. Importantly, the development of sepsis in mice following a lethal dose of lipopolysaccharide injection, was significantly inhibited by pre-treatment of the animals with anti-TNF-a siRNAs. Collectively, these results demonstrate that synthetic siRNAs can function in vivo as pharmaceutical drugs. q 2003 Elsevier Science Ltd. All rights reserved

*Corresponding author

Keywords: RNA interference; small interfering RNA; gene silencing; TNF-a; antisense RNA

Novel tools for evaluating gene function such as ribozymes, DNAzymes and RNA interference (RNAi) are emerging as the most highly effective strategies.1,2 RNAi is the induction of sequencespecific gene silencing by double-stranded RNA (dsRNA). This process in which dsRNA mediated the degradation of homologous transcripts, was first described in the nematode worm Caenorhabditis elegans.2 Long dsRNA molecules are processed to small 21– 23 nucleotides interfering RNAs (siRNAs) by Dicer, an endogenous RNA III enzyme.3 These small interference RNA (siRNA) were first found in plants exhibiting transgene-mediated RNA silencing,4 and are believed to guide the RNA interfering silencing complex (RISC), which contains the proteins necessary for unwinding the double-stranded siRNAs and cleaving the target mRNAs at the site where the antisense RNAs are bound.5 In mammalian cells long dsRNA triggers the interferon responses which are thought to be mediated in part, via the activation of PKR, a Abbreviations used: RNAi, RNA interference; siRNA, small interfering RNA; TNF-a, tumor necrosis factor alpha; GFP, green fluorescent protein; LPS, lipopolysaccaharide. E-mail address of the corresponding author: [email protected]

kinase that is activated by dimerisation in the presence of dsRNA.6 PKR phosphorylates and inactivates the translation factor eIFa, leading to the inhibition of total protein synthesis. Therefore, long dsRNAs are believed not to be useful for gene function analysis in mammalian cells. However, after the finding that RNAi can be accomplished in cultured mammalian cells with siRNAs of 21 – 23 bp, this process has emerged as an effective strategy to selectively silence gene expression in mammalian cells.7 In contrast to dsRNA, siRNAs can bypass the activation of PKR. Although much progress has been made in demonstrating the activity of siRNAs in mammalian cells,8 – 13 their potential therapeutic application has not yet been demonstrated in vivo. Therefore, a study was undertaken to address this question.

In vivo modulation of GFP gene expression by siRNA To investigate the therapeutic potential of siRNA in vivo, we first used the green fluorescent protein (GFP) as an exogenous target gene. Previously we have identified anti-GFP siRNAs that inhibited the expression of GFP in HEK-293 cells.13 Here, siRNA that targets one of the positive sites was chemically made, and its in vivo activity was

0022-2836/03/$ - see front matter q 2003 Elsevier Science Ltd. All rights reserved

762

Attenuation of Gene Expression by siRNAs

Figure 1. In vivo inhibition of GFP gene expression by siRNAs. (a) Mice were i.v. injected with plasmid encoding GFP (pEGFP-N3) and with either active or inactive anti-GFP siRNA complexed with cationic liposomes (DOTAP, Roche Diagnostics GmbH). Three days later, mice were killed by cervical dislocation, organs were frozen in liquid nitrogen and mounted for cryostat sectioning. Sections of 10 mm were fixed with EtOH, washed with PBS and mounted in Mowiol to prevent fading. Slides were viewed under an epifluorescence microscope. The sequences of siRNAs used were: active siRNA, 50 GCACGACUUCUUCAAGUCCdTdT30 ; inactive siRNA 50 GCACGACUGGACCAAGUCC dTdT30 (Integrated DNA Technologies, USA). Only sense sequence is shown. Underlined sequences represent the mismatched bases. Data are from one animal and are representative of four others. (b) Three days after siRNA injection, animals were sacrificed and total RNA was isolated from homogenising liver cells using the guanidine isothiocyanate method. GFP mRNA was analysed by RT-PCR. In these experiments, 5 mg of RNA was reversed transcribed using the first-strand cDNA synthesis Kit and oligo-dT primer as recommended by the manufacturer (Amersham Pharmacia Biotech). Polymerase chain reaction was performed on 10% of the product using specific primers for GFP (50 ACGTAA ACGGCCACAAGTTC30 and 50 AACTCCAGCAGGACCATGTG30 ). As control, b actin mRNA was also amplified using the following primers: (50 GTACCACGGGCATTGTGATG30 and 50 CCAGAGCAGTAATCTCCTTCTG30 ). After 20 cycles of amplification (94 8C one minute, 56 8C one minute, and 72 8C one minute), samples were analysed by electrophoresis on 1.5% (w/v) agarose gels and visualised by ethidium bromide staining. The number of cycles was estimated from preliminary experiments. The data show the RP-PCR from two mice injected with the inactive siRNA (lane i) and from three mice injected with the active siRNA (lane a). m, DNA size markers.

investigated in BALB/c mice. We injected intravenously cationic liposomes (DOTAP) complexed with 50 mg of plasmid-encoding GFP (pGFP-N3) along with 30 mg of siRNA into adult mice. Control animals received pGFP-N3 plasmid along with siRNA with four mismatched bases which have been shown to completely inhibit target silencing.13,14 Three days after siRNA injection, animals were killed and the expression of GFP in the liver and spleen was assessed. Compared to the mismatched siRNA (inactive siRNA), a significant inhibition of GFP gene expression is evident in mice treated with the active version (Figure 1(a), as a representative example). Quantification of GFP mRNA in homogenate liver cells by RTPCR further demonstrated a significant reduction of GFP mRNA in siRNA-treated mice as compared to that treated with the inactive form (Figure 1(b)), thus confirming the specificity of the treatment.

In vitro and in vivo modulation of TNF-a gene expression by siRNAs To test the usefulness of synthetic siRNAs to inhibit the expression of pathogenic proteins, as a first step we have investigated whether lethal injuries induced by the overproduction of tumor necrosis factor (TNF-a) can be inhibited by siRNAs. TNF-a is a proinflammatory cytokine and is primary produced by activated macrophages.15 Although TNF-a is important for immune response against pathogens, it can cause many pathogenic responses such as septic shock, cachexia and rheumatoid arthritis when overproduced. Inhibition of TNF-a is therefore a therapeutic option that deserves some attention.16 Given the known target accessibility problem for siRNAs,11,13,17,18 we have examined the effects of various in vitro transcribed anti-TNF-a siRNAs in murine peritoneal macrophages. Using


763

Figure 2. Analysis of a series of in vitro transcribed anti-TNF-a siRNAs. (a) Peritoneal macrophages (104 cells) were transfected with siRNAs, yielding a final concentration of 100 nM. After 20 hours transfection time, cells were stimulated with LPS (5 mg/ml) for ten hours and produced TNF-a was measured by an ELISA (Pharmingen) as described.16 In vitro transcribed siRNAs were synthesized from DNA template oligonucleotides using the T7 RNA polymerase as described by Milligan & Uhlenbeck.28 After transcription, DNA templates were removed with DNase I treatment followed by phenol/chloroform and ethanol-precipitation of the RNAs. To anneal sense and antisense RNAs, equimolar quantities of sense and antisense RNAs were mixed in 10 mM Hepes (pH 7.4), heated for five minutes at 60 8C and subsequently incubated at 37 8C for two hours. To eliminate single-stranded RNAs, samples were treated with 1 mg/ml ribonuclease A (Sigma) for 15 minutes at 37 8C. The doublestranded RNAs were phenol/chloroform-extracted, cleaned up via CHROMA SPIN-10 column (Clontech), precipitated and then dissolved in water. The mobility of the dsRNA on agarose gel was shifted compared to single RNA transcripts, thus confirming the formation of dsRNA (data not shown). The sequences of the different sites are as follows: Site 1, 50 GUGCCUAUGUCUCAGCCUCU 0 0 0 0 U3 ; site 2, 5 GAUCAUCUUCUCAAAAUUCUU3 ; site 3, 5 GACAACCAACUAGUGGUGCUU30 ; site 4, 50 GGAGAAAGUCAACCUCCUCUU30 ; site 5, 50 GGCCUUCCUACCUUCAGACUU30 . Only sense sequence is given. The values represent means ^ SD of three experiments. S, sense strand; as, antisense strand; ds, double-stranded RNA (siRNA). (b) Effects of chemically synthesized siRNA corresponding to site 3 on TNF-a and IL-1-a gene expression. Peritoneal macrophages were transfected with anti-TNF-a siRNA at 100 nM. After 20 hours transfection time, cells were stimulated with LPS for ten hours and then secreted TNF-a and IL-1a were measured by an ELISA. The values represent means ^ SD of two experiments. siRNAs were chemically synthesized by Integraded DNA Technologies and Eurogentec.

computer-aided prediction of RNA structure some putative accessible sites that do not exhibit extensive base-pairing were identified. The relevance of such analysis, however, is still uncertain, since the method does not take into account either tertiary structure or RNA – protein interactions. Despite these limitations, five sites were selected and the corresponding sense and antisense strands were in vitro transcribed, purified and then tested in tissue culture. Single sense and antisense strands were also examined. Using cationic liposomes (DOTAP, Roche Diagnostics GmbH), we have previously shown that it is possible to transfect murine peritoneal macrophages with synthetic ribozymes.16 At 24 hours after transfection with anti-TNF-a siRNAs,

cells were stimulated with LPS for ten hours and TNF-a production in the culture supernatant was assessed by ELISA (Figure 2(a)). Notably, siRNA (ds) targeted to site 3 inhibited TNF-a gene expression more effectively than those targeted to the other sites. In contrast to the sense strands, some antisense strands showed a significant inhibition effect. When 21 nt antisense RNA against the PKC-a was tested, an inhibition effect was also obtained (data not shown). Experiments using short antisense RNAs as control for ribozyme cleavage activity, also demonstrated their therapeutic potential. In this respect, a 25 nt antisense RNA against the human TNF-a inhibited the expression of TNF-a in HL 60 cells.19 Furthermore, a 19 nt antisense

764


Figure 3. Anti-TNF-a siRNAs protect mice from LPS-induced septic shock. (a) BALB/c mice were randomly assigned to two groups ðn ¼ 8 or 16) and injected i.p. with test molecules formulated in liposomes (DOTAP). Eighteen hours later, animals were injected with 350 mg of LPS from E. coli strain 0111 diluted in 200 ml sterile PBS. The animals were killed by cervical dislocation when they showed reduced locomotoric activity, piloerection, eye/nasal discharge and soiled anus. The data show the number of survivors ten days after LPS injection. The reported death has occurred within the first three observation days. (b) Peritoneal TNF-a and Il-1a levels in mice after siRNA administration and challenge with LPS. Mice were i.p. injected with anti-TNF-a siRNA. After 24 hours, mice were challenged i.p. with LPS and killed ten hours later. The peritoneal cavities were washed with 1.5 ml PBS and lavage fluids were harvested. TNF-a and IL-1a contents were measured by an ELISA. The values represent means ^ SD of four mice. Control animals were injected with only cationic liposomes (DOTAP). The sequences of siRNAs were: active siRNA, 50 GACAACCAACUAGUGGUGCdTdT30 ; 50 GUGCCUAUGUCUCAGCCUCdTdT3; inactive siRNA, 50 GAC AACCAGGGCGUGGUGCdTdT30 . Only sense sequence is shown. Underlined sequence represents the mismatched bases. Animal care and protocols were in accordance with national legislation and institutional guidelines. (c) Semiquantitative RT-PCR for TNF-a and b actin mRNAs in peritoneal cells. Peritoneal cells from the same animals shown in (b) were prepared and total RNA was isolated using the QuickPrep total RNA extraction kit (Amersham Pharmacia Biotech). A total of 5 mg was reversed transcribed using the first-strand cDNA synthesis kit and the oligo-dT primer (Amersham Pharmacia Biotech). For PCR, the cDNA was amplified using the TNF-a primers: 50 CATGAGCACAGAAAGCATGATC30 and 50 CCT TCTCCAGCTGGAAGACT30 . As control b actin mRNA was also amplified using the following primers: 50 GTACCAC GGGCATTGTGATG30 and 50 CCAGAGCAGTAATCTCCTTC TG30 . After 16 or 20 cycles of amplification (94 8C one minute, 56 8C one minute, and 72 8C one minute), 5 ml samples were run on 1.2% agarose gels, visualized by ethidium bromide. (d) Quantification. Samples were transferred to Hybond-Nþ (Amersham Pharmacia Biotech) followed by fixing using UV cross-linker and then hybridized with 32 P-labelled TNF-a or b actin probe. The hybridization signals corresponding to 20 cycles were quantified by ImageQuant 5.0 software (Molecular Dynamics). Mice treated with only DOTAP (control), gave the same signals as those treated with the inactive siRNA.

RNA against PKC-a inhibited glioma growth both in vitro and in vivo.20 Thus, short singlestranded RNAs can be potent inhibitors of gene expression. While much remains to be learned about the mechanisms by which these molecules work in the cells, the recent demonstration that single-stranded RNA can enter RNAi pathways and directly target cleavage at the same site as the corresponding siRNA duplex should expand the use of RNA oligonucleotides for inhibition of gene expression.21,22 Because duplex siRNAs are more resistant to cellular ribonucleases when compared to singlestranded RNAs, we concentrated on testing the efficacy of these molecules in vivo. Based upon the in vitro data, active and inactive siRNAs for site 3

were chemically synthesized and tested. Figure 2(b) shows the in vitro inhibition of TNF-a by the chemically synthesized molecules. Anti-TNF-a siRNA was as effective as its in vitro transcribed counterparts. To test for specificity, the synthesis of IL1-a, a pro-inflammatory cytokine, was also measured. In contrast to TNF-a, the anti-TNF-a siRNA treatment did not reduce IL1-a levels, thus target specificity is confirmed. Furthermore, antiGFP siRNA had no inhibitory effect on TNF-a gene expression. To investigate the effects of anti-siRNA on TNF-a pathological responses such as sepsis, BALB/c mice were intraperitoneally pretreated with antiTNF-a siRNA prior to injection of a lethal dose of LPS (350 mg). A significant protective effect was

765


found relative to mice injected with the inactive form (Figure 3(a)). This result suggests that it may be feasible to use siRNAs as therapy against pathogenic gene products. To determine whether the protection exerted by anti-TNF-a siRNA is due to the inhibition of TNF-a gene expression, mice were treated with siRNAs and TNF-a levels were determined in peritoneal lavages ten hours after LPS injection (Figure 3(b)). Peritoneal TNF-a levels were reduced in mice treated with anti-TNFa siRNA compared to mice that received the inactive form. Analysis of TNF-a mRNA by RT-PCR further demonstrated a significant reduction of TNF-a mRNA in peritoneal cells (Figure 3(c) and (d)). Taken together, the present data indicate that siRNA can specifically inhibit the expression of exogenous and endogenous gene in adult mice. The high degree of protection provided by antiTNF-a siRNA against the lethal effect of LPS, should provide a rationale for gene-therapy approaches against TNF-a that complement existing approaches such as ribozymes, antibodies and receptor antagonists. While this work was in progress, two recent publications reported on in vivo activity of siRNAs. Using the hydrodynamics-based transfection method Lewis et al.23 demonstrated that the expression of exogenous or endogenous transgene can be inhibited in postnatal mice. Importantly, the effect of gene silencing was seen for at least four days after siRNA administration. Using the same method, McCaffrey et al.24 delivered siRNA to the livers of mice and specific gene inhibition of luciferase and HCV-NS5B protein/luciferase fusion was demonstrated. Thus, this innovative delivery method seems to have great potential for nucleic acid delivery, as reported in previous studies.25,26 Development of efficient methods for introducing active siRNAs into target cells in vivo could be the key issue in treating genetic and acquired diseases using this novel strategy. Another limitation is that synthetic siRNAmediated RNAi in human cells is transitory with cells recovering from a single treatment in four to six days.7 When GFP expression in the liver was assessed six days after siRNA injection, there was no significant inhibition. To circumvent this problem, plasmids encoding siRNAs that were driven by RNA polymerase (pol) III promoter have been developed and found to silence gene expression in cultured cells.9 – 11 Using a cis-acting ribozyme to process hairpin siRNAs driven by a pol II promoter, we have found that gene expression can be silenced in mammalian cells (M. L. & M. S., unpublished results). In contrast to pol III promoters, tissue-specific expression of siRNA is feasible with pol II promoters. Prior to cloning into plasmid vectors, however, it may be important to investigate whether the targeted sites are accessible in vivo. By using the in vitro transcription strategy, several siRNAs can be tested in

vivo using suitable delivery methods such as cationic liposomes. Once the best site is identified, pharmaceutical siRNAs can be chemically synthesized or in vivo expressed from plasmids bearing pol II or III promoters. Given that plasmids must also be delivered into cells, identifying the appropriate delivery agents is important. The hydrodynamics and cationic liposome-based methods have proven to be useful for delivering of siRNA in vivo. In addition to their therapeutic potential, genome wide functional screen using siRNAs may be feasible in the mouse, in particular at various developmental stages. Notably, transfection of mouse embryos can be performed in utero.27

Acknowledgements Thus study was supported by a grant from the Norwegian Cancer Society to Dr. M. Sioud.

References 1. Sioud, M. (2001). Nucleic acid enzymes as a novel generation of anti-gene agents. Curr. Mol. Med. 1, 575 –588. 2. Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. & Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature, 391, 806– 811. 3. Bernstein, E., Caudy, A. A., Hammond, S. M. & Hannon, G. J. (2001). Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature, 409, 363– 366. 4. Hamilton, A. J. & Baulcombe, D. C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science, 286, 950– 952. 5. Sharp, P. A. (2001). RNA interference. Genes Dev. 15, 188 –200. 6. Stark, G. R., Kerr, I. M., Williams, B. R. G., Silverman, R. H. & Schreiber, R. D. (1998). How cells respond to interferons. Annu. Rev. Biochem. 67, 264– 277. 7. Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. & Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature, 411, 494– 498. 8. Paddison, P. J., Caudy, A. A. & Hannon, G. J. (2002). Stable suppression of gene expression by RNAi in mammalian cells. Proc. Natl Acad. Sci. USA, 99, 1443 –1448. 9. Lee, N. S., Dohjima, T., Bauer, G., Li, H., Li, M. J., Ehsani, A. et al. (2002). Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nature Biotechol. 20, 500– 505. 10. Brummelkamp, T. R., Bernards, R. & Agami, R. (2002). A system for stable expression of short interfering RNAs in mammalian cells. Science, 296, 550 –553. 11. Miyagishi, M. & Taira, K. (2002). U6 promoter-driven siRNA with four uridine 30 overhangs efficiently suppress targeted gene expression in mammalian cells. Nature Biotechnol. 19, 497– 500.

766


12. Paul, C. P., Green, P. D., Winer, I. & Engelke, D. R. (2002). Effective expression of small interfering RNA in human cells. Nature Biotechnol. 19, 505–508. 13. Leirdal, M. & Sioud, M. (2002). Gene silencing in mammalian cells by preformed small RNA duplexes. Biochem. Biophys. Res. Commun. 295, 744– 748. 14. Jacque, J. M., Triques, K. & Stevenson, M. (2002). Modulation of HIV-1 replication by RNA interference. Nature, 896, 1 – 4. 15. Beutler, B. A. (1999). The role of tumor necrosis factor in health and diseases. J. Reumatol. 57, 16 –21. 16. Sioud, M. (1996). Ribozyme modulation of lipopolysaccharide-induced tumor necrosis factor-a production by peritoneal cells in vitro and in vivo. Eur. J. Immunol. 26, 1026– 1031. 17. Holen, T., Amarzguioui, M., Wiiger, M. T., Babaie, E. & Prydz, H. (2002). Positional effects of short interfering RNAs targeting the human coagulation trigger tissue factor. Nucl. Acids Res. 30, 1757– 1766. 18. Yang, D., Buchholz, F., Huang, Z., Goga, A., Chen, C.-C., Brodsky, F. M. & Bishop, J. M. (2002). Short RNA duplexes produced by hydrolysis with Escherichia coli RNase III mediate effective RNA interference in mammalian cells. Proc. Natl Acad. Sci. USA, 99, 9942– 9947. 19. Sioud, M., Natvig, J. B. & Førre, Ø. (1992). Preformed ribozyme destroys tumour necrosis factor mRNA in human cells. J. Mol. Biol. 223, 831 –835. 20. Sioud, M. & Sørensen, D. R. (1998). A nucleaseresistant protein kinase Ca ribozyme blocks glioma cell growth. Nature Biotechnol. 16, 556– 561.

21. Martinez, J., Patkaniowska, A., Urlaub, H., Luhrmann, R. & Tuschl, T. (2002). Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell, 110, 563– 574. 22. Schwarz, D. S., Hutvagner, G., Haley, B. & Zamore, P. D. (2002). Evidence that siRNAs function as guides, not primers, in the Drosophila and human RNAi pathways. Mol. Cell, 10, 537– 548. 23. Lewis, D. L., Hagstom, J. E., Loomis, A. G., Wolff, J. A. & Herweijer, H. (2002). Efficient delivery of siRNA for inhibition of gene expression in postnatal mice. Nature Genet. 32, 107– 108. 24. McCaffrey, A. P., Meuse, L., Pham, T. T., Conklin, D. S., Hannon, G. J. & Kay, M. A. (2002). RNA interference in adult mice. Nature, 418, 38 – 39. 25. Zhang, G., Budker, V. & Wolff, J. A. (1999). High levels of foreign gene expression in hepatocytes after tail vein injections of naked plasmid DNA. Hum. Gene Ther. 10, 1735– 1737. 26. Liu, F., Song, Y. & Liu, D. (1999). Hydrodynamicsbased transfection in animals by systemic administration of plasmid DNA. Gene Ther. 6, 1258– 1266. 27. Saito, T. & Nakatsuji, N. (2001). Efficient gene transfer into the embryonic mouse brain using in vivo electroporation. Dev. Biol. 240, 237– 246. 28. Milligan, J. R. & Uhlenbeck, O. C. (1989). Synthetic small RNAs using T7 RNA polymerase. Methods Enzymol. 180, 51 – 62.

Edited by J. Doudna (Received 23 October 2002; received in revised form 23 January 2003; accepted 5 February 2003)