Gene Synthesis, Expression, Structures, and ... - Semantic Scholar

Vol. 262, No . 29, Issue of October 15. PP. 14213-14221, 1987 Prrnted in U.S A .

THEJOURNAL OF BIOLOGICAL CHEMISTRY C 1987 by The American Society for Biochemistry and Molecular Biology, Inc

Gene Synthesis, Expression, Structures, and FunctionalActivities of Site-specific Mutants of Ubiquitin* (Received for publication, May 13, 1987)

David J. EckerSj, Tauseef R. Butt$, JonMarsh§, EdmundJ. Sternberg$, Neil Margolisgll, Brett P. MoniaQll,Sobhanaditya JonnalagaddaB, Muhammad Ishaq Khan§(I,Paul L. Weber**, Lucian0 Mueller**, and Stanley T. Crookegll From the Departments of $Molecular Pharmacology and **Physical and Structural Chemistry, Smith Kline and French Laboratories, Philadelphia, Pennsylvania 19101 and the (IDepartment of Pharmacology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104

To study the structure and function of ubiquitin we arranged in a head to t.ail manner with no spacer regions (6have chemically synthesized a ubiquitin gene that en- 8).These polygenes are transcribed and translated polyuinto codes the amino acid sequence of animal ubiquitin, biquitin and subsequently processed to monomers by an eninserting a series of restriction enzyme sites that divide zyme recognizing the glycine-methionine bond linking the the gene into eight “mutagenesis modules.” A series of ubiquitin repeats.More recently, asecond set of ubiquitin site-specific mutations were constructed to selectively genes has been cloned which encode heterologous ubiquitin perturb various regions of the molecule. The mutant fusion proteins (9, 10). The first 76 amino acids of the fusion genes were expressed in a large quantity of Esche- proteins are those of ubiquitin followed by other “tail” prorichia coli, and the modified proteins were purified. teins which contain sequences similar to those of the “zinc To determine the structural effects of the amino acid DNA and areactive as transcription substitutions, the solution structure of ubiquitin was finger proteins” that bind (11). The similarity of the tail region of these fusion factors investigated bytwo-dimensional NMR and each of the proteins to the transcription factors suggestssome role in mutant proteins were screened for structural perturDNA binding or gene regulation, but no function for these bations. With one exception, virtually no changes were seen other than at the point of mutation. Functional fusion proteins has yetbeen discovered. The best studied function of ubiquitin is its role in the studies of themutant proteins with the ubiquitin-activating enzyme El and in the reticulocyte protein deg- cytoplasm as an ATP-dependent mediator of selective nonaccepted radation assay were used to identify regions of the lysosomal proteolysis (12, 13). Inthecurrently molecule important to ubiquitin’s activity in intracel- model, proteins are marked for degradation by the covalent lular proteolysis. attachment of the carboxyl terminus of ubiquitin to the amino terminus of the target protein in a peptide bond or at the t amino group of lysine side chains in isopeptide bonds. The ubiquitinated protein is thenrapidly and selectively degraded Ubiquitin is a 76-amino acid,highlyconserved protein by a complex set of ubiquitin-dependent proteases(13).Ubiqfound in all eukaryotes. Several functions of ubiquitin have uitin-dependent proteolysis is an ideal model system to study been identified. Ubiquitin is found in the nucleus covalently protein-protein interactions. The ubiquitin-dependent proattached to histone H2A, where it may play a structural role teolytic pathway involves at least five major classes of enin the nucleosome (1). In the membrane, ubiquitin is cova- zymes which all may have a binding site for ubiquitin. lently attached to several cell surface receptors where it may Ubiquitin is extraordinarilyhighly conserved. It is identical participate in or modulate receptor performance and signal inman, bovine, chicken, Xenopus, and Drosophila. Three transduction processes (2). Ubiquitin may have extracellular conservative amino acid substitutions are found in ubiquitin functions as a hormone or autocrine growthfactor. When from yeast, whereas plant ubiquitin has two of the substituadded to both T-precursor and B-precursor cells, it induces tions found in yeast anda different third substitution(6, 14). their differentiation into T-cells andB-cells (3). A ubiquitin- That ubiquitin interacts with so many other proteinsmay be containing autocrinegrowth factor hasrecently been isolated one source of conservation pressure; a substitution that is from a human leukemic cell line (4). Ubiquitin has been found harmlesstostructuralinteractions of ubiquitin with one in the paired helical filaments which are the principal con- enzyme may disrupt the interactionsbetween ubiquitin anda stituents of the neurofibrillary tangles found in patients with different enzyme. Alternatively, the conservationpressure Alzheimers disease (5). may be associated with some physical property of ubiquitin The first ubiquitinclones that were isolated and sequenced required for its diverse functions, i.e. the ability to undergo were found to contain multiple repeats of the ubiquitin gene conformational changes. A substitution which does not affect of ubiquitin as a cofactor * The costs of publication of this article were defrayed in part by the function (rather than structure) in selective proteolysis may be detrimental to functions in the the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 nucleosome or on cell surface receptors. solely to indicate this fact. The precise mechanisms as to how ubiquitin acts as a signal $ To whom reprint requests should be addressed: Dept. of Molec- for proteolysis remain unknown, although itis proposed that ularPharmacology, L511, SmithKlineandFrench Laboratories, ubiquitin acts as a denaturant to the proteins to which it Research and Development Division, P.O. Box 1539, King of Yrussia, becomes attached (15, 16). In this article we study the strucPA 19406-0939. 11 Present address: Centre for Advanced Molecular Biology, Uni- ture and activity of ubiquitin and its interactions with the versity of the Punjab, New Campus, Lahore, Pakistan. enzymes of the ubiquitin-dependentproteolytic pathway. We

14213

14214

Mutagenesis Site-directed

of Ubiquitin

study these interactions by site-directed mutagenesis, purification of mutant ubiquitin, NMR characterization of the mutant protein structure, and enzymatic studies of mutant ubiquitin with the ubiquitin-activating enzyme El and the enzymes required for in uitro proteolysis. The results help to identify the various regions of the molecule important to the structure and functionof ubiquitin.

Eight restriction enzyme sites were engineered into the synthetic gene that did not change theencoded protein sequence fromthat of wild typeubiquitin (Fig. 1). Therestriction enzyme sites divide the syntheticgene into eight "mutagenesis modules" which can be excised and replaced into a single piece of synthetic double-strandedDNA. This syntheticDNA can contain a mixture of bases in a specific codon to encode a family of mutations at one amino acid position (cassette MATERIALS ANDMETHODS mutagenesis) (24) or to directly encode one or more specific Gene Construction-General methods for DNA manipulation in mutations (modular mutagenesis). The modular design makes vitro were described previously (17). Details of the DNA synthesis it possible to make two independent point mutations on a and assembly scheme for the yeast ubiquitin gene are described in single stretch of DNA resulting inexpression of a double Ref. 18. the human gene was synthesized by replacement of the DNA mutant protein. Thedouble mutant gene can subsequently be in the yeast ubiquitin gene between the XbaI and BsmI restriction rearranged (module switching, Fig. 2) to express each mutaenzyme sites (module 4). This region contains the codons for the three amino acid differences between yeast and human ubiquitin. A tion individually as two single mutants. This procedure can unique NdeI site ( C A T m ) was introduced at the initiation codon also be reversed to create a double mutant from any pair of (module 1) to transfer the synthetic gene to the expression plasmid single mutants that are on different modules. The gene design (pMG27N-S), which was constructed with a unique NdeI site adjacent also allows rapid assembly of any combination of individual to theribosome binding site (19). All of the mutantgene constructions were made starting with the synthetic human ubiquitin gene (Fig. 1) mutations to study theeffects of specific multiple changes on by replacement of the appropriate module with double-stranded syn- protein structure and function. thetic DNA encoding the desired mutation(s). In some cases more Using computer-assisted molecula? modeling and graphics than one mutation was made and then themodules were rearranged the ubiquitin crystal structure (1.8 A resolution, coordinates (module switching, Fig. 2) to express each mutant individually. The sequence of each mutant was confirmed by directly sequencing the kindly provided by W. Cook and C. Bugg) (25) was examined is a singledouble-stranded plasmids as previously described (20). The scheme to identify important structural features. Ubiquitin for ligation of thesynthetic genes intothe expression vector is domain globular structure, madeup of five strands of @described in the legend of Fig. 2. pleated sheet and three and one half turns of a helix (Fig. 3). Gene Expression and Protein Purification-Gene expression in E. It has adense central hydrophobiccore as well as some coli under the X PL promoter was induced with heat as described previously (19). Briefly, 10litercultures of Escherichia coli were hydrophobic patches on thesurface. The last4 residues of the grown in fermentation vessels to OD,, = 4 at 32 "C. The temperature carboxyl terminus, Leu-Arg-Gly-Gly, extend from the comwas rapidly increased to 42 "C and the fermentation continued for 3 pact structure toform a tail. This region becomes attached to h. Cells were harvested by filtration, aliquoted into 100-g (wet weight) theubiquitin-activating enzyme E , throughthe carboxylbatches, and stored at -70 "C. Ubiquitin species were purified from terminal glycine which isthe residue of ubiquitin that is 100 g (wet weight) of E. coli cell paste as follows: cells were resuspended in buffer (50 mM Tris, pH 8 , 2 mM EDTA, 5% glycerol, 1mM ultimately conjugated to the target proteins. dithiothreitol) to a total volume of 800 ml and split into two 500-ml centrifuge bottles. Lysozyme (0.2 g/l) was added, and the suspension was incubated at room temperature for 30 min. Each 400-ml aliquot was sonicated (Branson cell disruptor 200) for 10 min with constant stirring at room temperature followed by centrifugation at 10,000 rpm for 40 min at 0 "C. Ubiquitin species were purified from the supernatant using heat denaturation, ammonium sulfate fractionation, and ion exchange chromatography as previously described (18). Pure ubiquitin fractions from the chromatography step were dialyzed against 100 mM KC1 and then extensively against water and lyophylized. Protein purity was determined on overloaded 18% SDS'-polyacrylamide gels and staining with both Coomassie and silver. Immunochemical detection of ubiquitin was done by electrophoretically transferring (Trans-Blot, Bio-Rad) the proteins from SDS gels to nitrocellulose and binding with antibody raised in rabbits against ubiquitin (purified from bovine blood). Blots were developed using goat anti-rabbit IgG and horseradish peroxidase conjugate (BioRad) following the protocol provided by the manufacturer. Physical and Biochemical Characterization-Details of the NMR methods are provided in the legend to Fig. 5. Amino acid compositions analysis was performed on ubiquitin and each ubiquitin mutant using a Beckman amino acid analyzer. The ubiquitin-activating enzyme El 50 was purified from bovine reticulocytes and the PPi-ATP exchange assay was performed as described previously (21). Details of the El assay are given in the legend of Fig. 8. Preparations of enzymes which support the in vitro ubiquitination and degradation of exogenous proteins were made as previously described (22) and the degradation assays were performed as described in Ref. 22 with the modifications described in Ref. 23.

H

X b

P a

1

M1

1

M2

M3

1""-~""_1""""""""-~"""""""""~""""..

1

CAATTCATATGCAGATCTTCGTCAAGACGTTAACCGGTAAAACCATAACTCTAGAACTTG 60 CTTAACTATACCTCTAGAAGCAGTTCTCCAATTGGCCATTTTGGTATTGAGATCTTCAAC I_"""_"_I"_""""_~"_"""""""""",""~ '

U e t G l n I l a P h s V ~ I L y t T h r L . u T h ~ G l ~ L y ~ T h r I l e T h r L s u C l u V-~ I C l u 10

B m

1 M4 ""_""___"""""""""""""""""""~I_""_"

61

AACCATCCCATACCATCGAAAACGTTAAGGCTAAAATTCAAGACAAGGAACCCATTCCAC TTGCTACCCTATCCTAGCTTTTGCAATTCCGATTTTAAGTTCTGTTCCTTCCGTAACCTC

120

""_"_""_""__""""""""""".""".I___""_..

P r o S a r A s p T h r I l s C l u A ~ ~ V ~ l L y ~ A l ~ L y ~ I l e G l ~ A ~ ~ L y ~ C l ~ C.l y I I a P r o P r o 20 30

X h 0

1 M6

MI3

"""""""""_"""""""",""""""""""""

1 2 1 CTGATCAACAAAGATTCATCTTTGCCGGTAAGCAGCTCGAGCACGGTAGAACGCTGTCTG1E0 GACTAGTTGTTTCTAACTACAAACGGCCATTCGTCGAGCTCCTGCCATCTTCCGACAGAC """""""""""""""""""-I""""""""""

A r p C l n C l n A r g L a u I l e P h ~ A l ~ C l y L y ~ G l ~ L ~ ~ G l ~ A ~ p G l y A ~- g T h ~ L a ~ S ~ ~ A ~ p 40

A f I

K

P

2

1

117

1

M8

""""_""_""_,""""""""~I"_""""___"""""~I

181

ATTACAACATTCAGAAGGACTCGACCTTACATCTTCTCTTAAGACTAAGAGGTGGTTGAGGTACC 245 TAATCTTCTAACTCTTCCTCACCTGGAATGTAGAACAGAATTCTGATTCTCCACCAACTCCATGG

FIG. 1. Synthetic modularhuman ubiquitin gene. The lengths of the mutagenesis modules (MI-M8) ranges from 12 to 64 Modular Mutagenesis-To facilitate site-directed mutagen- base pairs andtherefore allregions of the syntheticgene are accessible esis, the human ubiquitin gene was chemically synthesized. to site-specific or cassette mutagenesis because a single stretch of synthetic double-stranded can bridge the gap between any adjacent The abbreviations used are: SDS, sodium dodecyl sulfate; NOE, restriction sites. In this study modules M1, M4, M6, M7, and M8 were all replaced to produce the mutants listed in Table I. nuclear Overhauser effect; BSA, bovine serum albumin. RESULTSANDDISCUSSION

Site-directed Mutagenesis of Ubiquitin Xhol

14215 XhJ 1

sal1

A

A01

FIG. 2. Mutagenesis and module switching. A , the modular mutagenesis strategy was used to generate a double mutant and two single mutations from one piece of synthetic double-stranded DNA. Synthetic DNA, encoding two specific mutations (Tyr-59+Phe, His-6& Lys) was ligated into the appropriately restricted wild type ubiquitin gene, replacing modules M6 and M7 to generate a double mutant. To generate each single mutant, the double mutant, gene was cut at a unique Sal1 site between the two modules and a t the unique Aat2 site in the pUC vector. The resulting fragments weregel purified and each was ligated with the complementary fragment from a similarly restricted plasmid containing the wild type gene. B , cloning the synthetic ubiquitin gene in the E. coli expression vector pMG27N-S. The synthetic ubiquitin gene has an NdeI site that includes the initiation codonCAT E G . The ubiquitin gene was removed from the pUC plasmid by restriction with NdeI and PuuII. The gene-containing fragment was gel purified and ligated E. coli expression vector into the pMG27N-S which was restricted with HindIII, the overhang flush ended with DNA polymerase (Klenow fragment) and then cut with NdeI. Insertion of the ubiquitin gene at the NdeI site of the expression vector placed the reading frame downstream of the heat-inducible h P L promoter and adjacent to the h cII gene ribosome binding site.

C

Aa1

A01

B P, promoter

CP ribowme Ndol

Nde 1

Eco R1

Humon Ublquitin

pMG27N-S

Site-directed Mutagenesis of Ubiquitin

14216

FIG. 3. The structure of ubiquitinand the location of the mutagenesis sites. The molecular graphics were generated fromthe 1.8A ubiquitin structure coordinates (25). A, the ubiquitin backbone is shown withthe (Y helix region in yellow, the @sheet regions in red, and the remainder of the backbone in blue. B , same as A except the amino acid side chains are included. C, the amino acid side chains that were mutagenized are shown in red, whereas the backbone of the molecule is shown in blue.

TABLEI

antibody prepared in rabbits against bovine ubiquitin (Fig. 4). No significant cross-reactivity was observed in control E. coli extracts which did not contain the synthetic ubiquitin gene (Fig. 4B control lanes), consistent with the notion that E. coli does not normally produce ubiquitin. Each mutant protein waspurified to homogeneity (Fig. 4). The yield of pure protein was approximately 100 mg/100 g of wet-packed E. coli pellet. Amino acid compositionanalysis of each mutant confirmed the correct expression of the mutaMutant Location of I n uitro BSA tions as predicted from theDNA sequence to within 10-15% structure Protein numchange degradation accuracy at the level of each aminoacid residue. Immunologber activitv ical detection of the mutant proteins with polyclonal antibodcow) ubiquitin (from Animal 100 ies raised against bovine ubiquitin showed that thecarboxyl1(expressed 100 ubiquitin Animal terminal tail of ubiquitin is a major recognition epitope for in E. coli) tail portion of ubiquitin were these antibodies. Mutants in the Surface 2 Pro-19 Ser, Ala-28 + 100 Ser, Glu-24 + Asp (yeast poorly immunoreactive, whereas mutants in other areas of ubiquitin, from E. coli) the protein such as the globular surface or hydrophobic core 3 Pro-19 Surface + Ser 100 were as reactive as wild type ubiquitin (Fig. 4C). Core 0 4 Leu-67 -+ Asn,Leu-69 -+ Protein Structure-Since altered activitiesof ubiquitin muAsn tants could be due to major changes in the protein conforTail 0-10 5 Gly-76 + Ala mation, we used NMR, an extremely sensitive indicator of Tail 6 Leu-73-A 0 7 Leu-73 + A, Arg-72 + Ser Tail 0 protein conformational changes, to probe the solution strucSurface 70-100 8 Tyr-59 + Phe ture of each mutant (for recentreviews, see Refs. 26 and 27). Surface 30 9 His-68 + Lys Structural perturbationswere monitored using three different Surface 30 10 Tyr-59 -+ Phe, His-68 “t NMR parameters, namely scalar couplings, resonance chemLYS ical shift, anddipolar cross-relaxation. Scalar or J-coupling is dependent upon the torsion angle formed by a vicinal pair of The selected mutations are divided into three general cat- protons, and the conversion between them (the Karplus reegories (Table I): tail, hydrophobic core, and protein surface lationship) is well known (28, 29). Dipolar cross-relaxation regions. The mutant genes were expressed under the strong (the NOE) is strongly dependent upon the distance separating heat-inducible X PI, promoter in E. coli on the expression two protons (30), and the conversion between NOE buildup vector pNMHUB (Fig. 2). Upon induction, ubiquitin(s) was rates and interproton distance can often be made with an expressed at very high levels (10-15% of total E. coli protein). accuracy within 10% (31).The conversion between chemical Expression was monitored by electrophoresis on 18%polyac- shift and the“chemical” environment surrounding a proton, rylamide gels and staining with Coomassie Blue. Ubiquitin however, is not well defined, but an altered chemical shift wasidentified by co-migration with aubiquitin standard may be taken to indicate an altered structure. Two caveats, isolated from bovine blood and immunological detection with however, must be understood in thisanalysis: first, thedegree Description and location of ubiquitin mutations and their activities in supporting the in vitro degradation of “‘I-BSA by the ubquitin dependent pathway The activities of mutant ubiquitins are reported relative to the act.ivity of animal ubiquitin, isolated from bovine blood,in the degradation of substrate with 4 pg of ubiquitin or mutant ubiquitin per assay. Aliquots were removed at hourly intervalsuntil the end of the experiment at 4 h, and the rate of substrate degradation with time was measured.

“t

Site-directed Mutagenesis of Ubiquitin Control

A Ub

Std.

26K -

6K

-

Ubiquitin plasmid

plasmid

1

I 1

I

0

.5h

lh

0

2h

.5h

lh

2h

D

3K-

Control plasmid

'0

C

.5h

lh

Ubiquitin plasmid I

2h

1

0

.5h

l h 2h

I

6 1 2 3 4 5 6 7 8 9 1 0 6

43 25.7 18.4 14.3 6.2 3.0 -

F I G . 3. Large scale expression and protein purification. A , total b,'. c d i proteins from cells containing a control plasmid (pMG27N-S)and the sameplasmid with the svnthetic ubiquitingene inserted (pNMHUH). Gene expressionwasinduced by raising the temperature from 32 to 4 % "C. Aliquots were removed and centrifuged. ('ell pellets were resuspended in loading dve containing SDS, loaded on an 18"; SI)S-polvacrylamide gel, andstained withCoomassie I3lrte. H , a gel identical to A was blotted onto nitrocellulose and prohed with antibodv raised to purifiedbovine ubiquitin. C', purified sitespecific ubiqrtitin mutant on anSDS-polvacrvlamide gel stained with Coomassie Blue and an identical gel blotted onto nitrocellulose paper and probed with antibodies raised to purified bovine uhiquitin. The number at the top of each lane corresponds with a ubiquitin mutation as descrihed in Table 1. H = hovine uhiquitin.

14217

of chemical shift cannot readily he used to indicate the degree of structuralchange;andsecond, a structural change can occurwithoutanychangeinthechemicalshift(s) of the resonance(s) involved. The NMR data can he fully exploited only when resonance assignments have been made; t?lpically it is not useful to know the torsion angle or distance between two protons without knowing the identityof the protons involved. To this end the ubiquitin NMR spectrum has been assigned,? so that structural changes in the ubiquitin mutants can be readily interpreted using the indicators described above. We have concentrated on screening mutations by searching for chemical shift differences in the amide protons (which would indicate an alteredbackbonestructure)usingone-dimensionalNMR techniques. A few selected mutants were studied using twodimensionalNMRmethods.Measurements of accurate .Jcouplings could not he made using the DQF-COSY experiment. due to complications arising from the resonance line widths; such measurements are presently being made using t h e new PE-COSY technique (32) and will be reported elsewhere. Fig. 5 shows all mutant spectra that displayed only minor changes from the wild t-ye spectrum. For mutations in the carboxyl terminus (residues72-76), virtually no changes were seen other than at the point of mutation. In other cases, slight changes were seen in surrounding resonances. For example, t h e H i s - 6 b L y s m u t a t i o n showed slight chemical shift perturbations of surroundingprotons,consistentwithsubtle loss of the backboneconformationalchanges,and/orthe imidazole ring current chemical shift contributions. The one exception was theLeu-W-Asn, Leu-69-Asn double mutant (not shown), which was difficult to solubilize at high enough concentrations to collect reproducible data. We also experienced sample-dependent variations with this mutant which may reflect a substantially less stable protein structure. A more detailed analysisof the mutant uhiquitin structures was performed using two-dimensional NMR techniques, but for the mutants analyzed, little or no structural changes could be detected. DQF-COSY spectraof t h e G l y - 7 b A l a a nLeud 73-1 mutantswereidenticaltothe wild t-yespectrum, exceptfor ( a ) the loss of t h e Gly-76 resonancesandthe appearance of Ala-76 resonances and ( h ) the loss of Leu-73 resonances accompanied bya minor shift (50.05 ppm) in the Arg-74 C"H and C"H resonances. These data are consistent with our observations' that residues 72-76 are highly mobile in solution; hence deletions and mutations in this region will onlyalterthestericandchemicalnature of thecarboxyl terminus, since it has no defined structure. The most detailed analysis of the mutant structures inall interproton volves the analysis ofoNOESY data, where distances less than 4 A can, in principle, be measured and compared with the wild type. We selected the Tyr-59+Phe 7 ) .since it was mutation to analyze in this fashion (Fig. 6 and reported that the loop containing residues 50-60 was stahiof Tyrlized by a hydrogen bond involving t.he hydroxyl group 59 (25). Furthermore, Tyr-59 is included in a region involved in immunostimulatory activity (3). Even at thelevel of detail available in the NOESY spectrum, we could detect only two very minor changes from the wild t.ye spectrum. suggesting ~~~~

~~~~

Weher, P., Brown, S., and Mueller. L. (1987) Rinchcrnistn. 261, in press. "11.J. Rcker, T. R. Butt, ,J. Marsh, E. .J. Sternherg. N. Margolis, H. P. Monia, S. .Jonnalagadda, M. I. Khan. P. I,. Weber. L. Mueller. and S. T. Crooke, unpublished ohservations. ''

14218

Site-directed Mutagenesis of Ubiquitin

I

FIG. 5 . 500 MHz NMR spectra of wild type and mutant ubiquitins. The wild type ( WT) ubiquitin spectra are shown a t the top and bottom. The spectra for each of the mutant ubiquitin species are identified at thefar right side of the spectra using the one letter amino acid code (i.e. P19S = proline 19serine). The region of the 1H NMR spectrum containing amide and aromatic proton resonances is shown. In the WT spectra, arrowheads indicate WT resonance positions of amide (bottom spectrum) and aromatic (top spectrum) protons of thesites of mutation. In the mutant spectra, thesepositions are again indicated by open arrows. Large arrowheads indicate new resonances arising from the mutation involved;small arrows indicate shifts in resonances other than those at the siteof mutation. All samples were prepared in 0.4 ml 25 mM NaOAc4, pH 4.7, with 10% (v/v) D,O added; protein concentrations ranged from 0.1 to 5 mM in ubiquitin. Spectra were obtained at 500 MHz using a spectralwidth of 6250 Hz divided into 8192 complex data points. All data were collected on a JEOL GX500 and transferred to a microVAX I1 for processing using the FTNMR software (Hare Research, Inc.).

n

s57

__

1

I

10

both that the Phe-59 ring is in a similar position as the Tyr59 ring (detectable by both resonance chemical shifts and NOE distances) and that the loop does not require the hydrogen bond for stability. Protein Function-The role of ubiquitin as an essential cofactorinselective ATP-dependent proteolysis has been studied primarily in experiments using a rabbit reticulocyte lysatewhich is purified of ubiquitin and ATP by DEAEcellulose chromatographyand dialysis (22).Thepartially purified cell extract is supplemented with ATP, ubiquitin, and an iodinated protein such as BSA or lysozyme as sub-

I

I 9

I 8

PPM

I

I

I

7

strate. Proteolysis of the labeled substrate is followed by the release of trichloroacetic acid soluble counts. In this assay, animal ubiquitin, isolated from bovine blood and fromexpression in E. coli were equally active in supporting the in vitro degradation of BSA over a range of ubiquitin concentrations from 0.1 to 4 pg/assay (not shown). The triple mutant pro-l9--tSer, Ala-28+Ser, Glu-24-+Asp (the sequence of yeast ubiquitin), and the single mutant Pro-19-Ser were as active as wild type ubiquitin. Thefull biological potency of yeast ubiquitin, isolated from expression in E. coli, is consistent with the previously reported result that wild type yeast

14219

Site-directed Mutagenesis of Ubiquitin

Lo M

0

U

8

8

0

F59

3

Loa

.Q-

U

0 0

0

0 0

Lo

0

.

- "

.D

o

o.

Lo

M

"

0 U

Lox 1138;

0

LD

Lo Lo

9.5

9.0

8.5

8.0

7.5

7.0

6.5

PPM

FIG. 6. NH-C"H cross-peak regions of wild type (luwer) and Tyr-BO+Phe (upper) ubiquitins. The identity of each cross-peak is labeled in the wild type spectrum; in the mutant those peaks which shift by more than 0.10 ppm are relabeled, and a line connects their position to that in the wild type. Despite the large changes in the Leu-50, Glu-51, and Phe-59 cross-peaks, no significant structural change occurs except for the loss of Tyr590fH-Glu-51NHhydrogen bond.

Site-directed Mutagenesis of Ubiquitin

14220

the interactions between ubiquitin and the enzymes of the ubiquitin pathway. Moreover, mutations in the tail resulted in substantially lower binding of ubiquitin antibodies. The most studiedof the ubiquitin pathwayenzymes is the ubiquitin-activating enzyme E l , which activates ubiquitin in anATP-dependentreactiontoforman enzyme-ubiquitin thiolester. According to the current model, activated ubiquitin is then transferred to other enzymesin the pathway and ultimately to the target protein that be is degraded. to Failure of E , to successfully activate ubiquitin would be expected to 55 prevent ubiquitin-dependent proteolysis. Another model for RTLSDVF:IQKEET ubiquitin-dependent proteolysis that does not include El and targetproteinubiquitinationhas beenproposed in which ubiquitin and ATP cause the release of a protease inhibitor from anendogenous protease, thereby activating the protease (35). dNN We studied the activities of the ubiquitin mutants with FIG. 7. Backbone sequential NOEs for residues near posi- purified E1 using the PP,-ATP exchange assay as previously tion 59. The thickness of the bars correspond to the intensities of described (21). The rate of PP,-ATP exchange was strongly NOEs identified in the wild type (above dashed line) and Phe-59 dependent on the ubiquitin concentration and severe inhibimutant (below dashed line). tion of exchange was observed above 5 p~ ubiquitin. Inhibition of PP,-ATP exchange a t high ubiquitin concentrations is ubiquitin, isolated from yeast, is fully active in supporting indicative of an ordered additionof substrates, with ubiquitin proteindegradationin reticulocyte extracts (18, 33). The binding to the enzyme after ATP. This result is identical to single mutant Pro-19-Ser is an animal-yeasthybrid protein, that reportedpreviously (21). The important pointis that the having a Ser-19 residue as in yeast ubiquitin, butGlu-24 and PPi-ATP exchangeassay is useful tostudythesubstrate Ala-28 residues as in animal ubiquitin. This hybrid was con- specificity of El (for ubiquitin) and to monitor the activation structedtotestthe possibility that the three differences of the ubiquitin mutant proteins. The ubiquitin mutants with between yeast and animal ubiquitin represent a mutation, the conservative substitutions Pro-lS+Ser,A l a - 2 b S e r , Glufollowed by a "second site compensation" to restore the pro- 2 4 j A s p (yeast ubiquitin) and thesingle mutant Pro-lS+Ser tein to the active structure (34). The identical activities of the all had activities identical to wild type ubiquitin in thisassay three proteins suggest that this is not the case. Rather the (Fig. 8). conservative substitutions in these amino acid positions are All of the mutants in the carboxyl-terminaloftail ubiquitin tolerated by the enzymes that utilize ubiquitin as a cofactor were completelyinactive in catalyzing PPi-ATP exchange, for proteolysis. including the conservative G l y - 7 b A l a substitution (Fig. 8). Mutagenesisofthe single tyrosine at position 59 to a This suggests a high degree of substrate specificity for the phenylalanine resulted in a substantial loss in Solubility (less ubiquitin tail in the El active site. It is noteworthy that the than 1 mg/ml in pure water), but the solution structure was tail mutants were alsocompletelyinactive in the in vitro not detectably changed from the wild type structureby NMR protein degradation assay. The two-dimensional NMR data when dissolved in 25 mM NaOAc buffer at pH4.7 (see below). on these mutants showed that the globular domains of the In thein uitro degradation assay, this mutantwas consistently mutant ubiquitins are identical to wild type uhiquitin and 70-100% as active as wild type ubiquitin, suggesting that the that structural changes in these mutants are restricted exclusingle tyrosine side chain plays no essential role in the prosively to the tailregion. The failure of the tail mutants tobe teolytic function of ubiquitin. Uhiquitin contains a single histidine at position 68, which activated by El or stimulate in vitro proteolysis strongly implies a requirement for El activation as a prerequisite to is on the surface of the molecule. Surprisingly, mutagenesis ubiquitin-dependent proteolysis and supports the more widely of this residue to a lysine resulted in loss in solubility. In in vitro degradation thismutant was approximately 30% as accepted model. This is also consistent with the previously reported data that ubiquitinwhich has lost the terminal Glyactive as wild type ubiquitin. The double mutant Leu-67-Asn, Leu-69-+Asn was com- Gly residues by tryptic cleavage is inactive in supporting in pletely inactive in supporting thein vitro degradation of BSA. vitro proteolysis (23, 36). The surface mutants Tyr-59--tPhe, His-6bLys and the These two mutations are in a strand of a @-sheet with the of these changeswere partially side chains buried deepin thehydrophobic coreof the protein. double mutant containing both active in the PPi-ATP exchange assay. These activities were Substitution of Asn for Leu would be sterically possible in uhiquitin, hutwould result in a substantially less hydrophobic concentration-dependent andincreased by increasing themuwe know that these mutants core. Insertion of amide groups in lipopholic pockets may also tant protein concentration. Since generate repulsive interactions that prevent the protein from are folded properly from the NMR data and that they are not we conclude that during folding properly. Alternatively, the increased hydrophylicity changed in the carboxyl-terminal tail, the El activating reaction the enzyme has points of contact of Asn over Leumay create amoreenergeticallyfavored unfolded structure because of the increased number of hydro- with the globular domain of ubiquitin, which are disfavored gen bonds that can be formed between Asn and water when by these mutations. This conclusion is further supported by the protein is unfolded. The NMR data were insufficient to our observations that synthetic peptides with the sequences like the ubiquitin tail (Arg-Gly-Gly, Leu-Arg-Gly-Gly, Argdetermine the structureof this mutant. All of the mutants affecting the carboxyl-terminal tail of Leu-Arg-Gly-Gly) are inactive inthis assay,whereas the hexamer (Leu-Arg-Leu-Arg-Gly-Gly) catalyzes only a small ubiquitin were completely inactive in the proteolysis assay. Mutations in the ubiquitin tail did not disrupt the globular amount of PPi-ATP exchange at very high concentrations. domain as evidenced in the NMR, but more likely disrupted The double mutant Leu-67-Asn Leu-69-+Asn, which is 22

26

T I E N V

46

50

A G K Q L E D G

9.........~..........~........,

Site-directed Mutagenesis of Ubiquitin

30

14221

uitin and the enzymes of the pathway. This should provide an interesting model system for further studies of proteinprotein interactions during enzymatic reactions.

25

Acknowledgments-We gratefully acknowledge Allan Shatzman for the expression vectors and large scale fermentations, W. Cook, K. Wilkinson, and C. Bugg for supplying the crystal structure coordinates of ubiquitin, Scott Dixon and Drake Eggleston for assistance with the molecular modeling and computer graphics, Stephen Brown for assistance with the NMR assignments, and Angela Varrichio for the aminoacid composition analysis.

-5 20 E \

0,

5 15

EQ

REFERENCES 1. Busch, H. (1984) Methods Enzymol. 106,238-262 > 2. Siegelman, M., Band, M., and Gallatin, M. W. (1986) Science 231,823-829 5 3. Audhya, T., and Goldstein, G. (1985) Methods Enzymol. 116, 279-291 4. Okabe, T., Fujisawa, M., Mihara, A., Sato, S., Fujiyoshi, N., and 0 Takaku, F. (1986) J. Cell Biol. 103, 442a 5. Mori, H., Kondo, J., and Ihara, Y. (1987) Science 235, 16410 1 0 20 30 4 0 5 0 6 0 7 0 1644 [Ubiquitin] pM 6. Ozkaynak, E., Finley, D., and Varshavsky, A. (1984) Nature 3 1 2 , 663-666 FIG. 8. Ubiquitin and mutant ubiquitin concentration de7. Dworkin-Rastl, E., Shrutkowski, A., and Dworkin, M. B. (1984) pendence of ATP:PPI exchange rates catalyzed by the ubiqCell 39,321-325 uitin-activating enzyme E,. Each reaction contained purified El, 8. Wiborg, O., Pedersen, M. S., Wind, A., Berglund, L. E., Marcker, 0.09 mg; Tris-HC1 50 mM, pH 7.6; ATP 1 mM, PP,, 100 FM, specific K. A., and Vuust, J. (1985) EMBO J. 4,755-759 activity 6.6 X 10' dpm/nmol; MgCl,, 10 mM; dithiothreitol, 0.1 mM, 9. Lund,P. K., Moats-Staats, B. M., Simmons, J. G., Hoyt, E., and varying ubiquitin concentrations. The reactions were stopped D'Ercole, A. J., Martin, F., and Van Wyk, J. J. (1985) J . Biol. after 20 min and counts in ATP adsorbed to charcoal were measured Chem. 260,7609-7613 as previously described (36). Animal ubiquitin, isolated from bovine 10. Ozkaynak, E., Finley, D., Solomon, M., and Varshavsky, A. (1987) blood, from expression in E. coli, yeast ubiquitin from expression in EMBO J. 6, 1429-1439 E. coli, and animal ubiquitin mutant Pro-19jSer were identical in 11. Miller, J., McLachlan, A. D., and Klug, A. (1985) EMBO J. 4, this assay and represented in the single curve A. The experimental 1609-1614 variation on each data point was approximately 5-10%. Mutants in 12. Hersko, A., and Ciechanover, A. (1986) Prog. Nucleic Acid Res. the tail, Gly"IhAla, Leu-734elete, Leu-734elete, Arg-72+Ser, Mol. Biol. 33, 19-56 and Leu-67,69+Asn were completely inactive and shown in the single 13. Rechsteiner, M. (1987) Annu. Reu. Cell Biol. curve (0).0, Tyr-59-Phe; H i s - 6 h L y s ; A, double-mutant Tyr14. Vierstra, R. D., Langan, S. M., and Schaller, G. E. (1986) Bio59+Phe, H i s - 6 h L y s . chemistry 25,3105-3108 15. Haas, A. L., and Bright, P. M. (1985) J. Biol. Chem. 260,1246412473 structurally changedin the globular domain but hasa normal 16. Wilkinson, K. D., and Mayer, A. (1986) Arch. Biochem. Biophys. tail, was also completely inactive in the E, assay. 250,390-399 From these studies we draw the following conclusions on 17. Maniatis, T., Fritch, E. F., and Sambrook, J. (1982) Molecular ubiquitin structure, folding, and function in proteolysis. 1) Cloning: A Laboratory Manual, Cold Spring Harbor LaboraThroughout the entire known eukaryotic domain there are tory, Cold Spring Harbor, NY only three forms of ubiquitin; animal, yeast, and plant. The 18. Ecker, D. J., Khan, M. I., Marsh, J., Butt, T. R., and Crooke, S. latter two differ from animal ubiquitin by only three amino T. (1987) J . Biol. Chem. 2 6 2 , 3524-3527 acid substitutions. The full biological activity of an animal- 19. Shatzman, A. R., and Rosenberg, M. (1986) Ann. N. Y. Acad. Sci. 478,233-248 yeast hybrid protein suggests that the substitutions groups (in Chen, E. Y., and Seehurg, P. H. (1985) DNA (NY) 4 , 165-170 of three) are not required in concert to maintain a properly 20. 21. Haas, A. L., and Rose, I. A. (1982) J. Biol. Chern. 2 5 7 , 10329folded, active structure. Conservative changes in these posi10337 tionsdonotinterfere with protein folding, stability,and 22. Hersko, A., Ciecbanover, A., and Rose, I. A. (1979) Proc. Natl. functionin proteolysis. 2) Mutationsintheubiquitintail Acad. Sci. U. S.A. 76, 3107-3110 completely destroy the biological activity of ubiquitin as a 23. Wilkinson, K. D., and Audhya, T . K. (1981) J . Biol. Chem. 2 5 6 , 9235-9241 cofactor in proteolysis. This is a result of an inability of the 24. Dalbadie-McFarland, G., Neitzel, J. J., and Richards, J. H. (1986) first enzymein the pathway ( E , ) to recognize the mutant Biochemistry 25,332-338 ubiquitin tail. 3) E , also interacts with the globular domain 25. Vijay-Kumar, S., Bugg, C. E., and Cook,W. J. (1987) J. Mol. of ubiquitin and surface mutations can hinder this. 4) ActiBid. 1 9 4 , 531-544 vation of ubiquitin by E, appearsto be essential for all 26. Bax, A., and Lerner, L. (1986) Science 232, 960 ubiquitin-dependent proteolysis in our assays, as no mutant 27. Wemmer, D. E., and Reid, B. R. (1985) Annu. Reu. Phys. Chem. 3 6 , 105 was active in in vitro proteolysis that was not active in theEl 28. Karplus, M. (1959) J . Chem. Phys. 30, 11 assay. 5 ) That ubiquitin is so highly conserved suggests that 29. Bystrov, V. F. (1976) Prog. NMR Spec. 10, 41 there is selection pressure fromsome sourceon virtuallyevery 30. Solomon, I. (1955) Phys. Reu. 9 0 , 559 amino acid to maintain either the proper folding, stability, or 31. Keepers, J. W., and James, T. L. (1984) J. Magn. Reson. 57,404 function of ubiquitin. With only one exception, all of the 32. Mueller, L. (1987) J . Mugn. Reson. 72, 191-196 mutants reported here were folded in a manner similar or 33. Wilkinson, K. D., Cox, M. J., O'Connor, L. B., and Shapira, R. (1986) Biochemistry 25, 4999-5004 identical to wild type ubiquitin, suggesting that some amino acid substitutions canbe made in ubiquitin without destroying34. Ho, C., Jsin, M., and Schimmel, P. (1985) Science 229,389-393 35. Speiser, S., and Etlinger, J. D. (1983) Proc. Natl. Acad. Sci. the ability of the protein to fold properly. However, in the U. S. A. 80,3577-3580 proteolysis function of ubiquitin, activity was lost when the 36. Haas, A. L., Murphy, K. E., and Bright, P. M. (1985) J . Biol. mutations adversely affected points of contact between ubiqChem. 2 6 0 , 4694-4703 0

10

-

.,