Gene therapy targeting cord blood-derived CD34 cells from ... - Nature

Gene Therapy (1998) 5, 233–239  1998 Stockton Press All rights reserved 0969-7128/98 $12.00

Gene therapy targeting cord blood-derived CD34+ cells from HIV-exposed infants: preclinical studies X Li1, A Gervaix1, D Kang1, P Law1, SA Spector2, AD Ho1 and F Wong-Staal1,3 1

Department of Medicine, 2Department of Pediatrics, 3Department of Biology, University of California, La Jolla, CA, USA

Hematopoietic CD34+ cells from placental and umbilical cord blood (PUCB) can be valuable vehicles for gene therapy of immunodeficiencies and genetic disorders. We have conducted preclinical studies towards the treatment of HIV1-infected infants with genetically ‘immunized’ CD34+ cells derived from PUCB using anti-HIV-1 hairpin ribozyme genes. PUCB was collected from 10 newborns of HIV-1positive mothers. CD34+ cells were enriched with a modified procedure using Dynal immunomagnetic beads and chymopapain, stimulated with stem cell factor (SCF), IL-3 and IL-6, and transduced using cell-free recombinant retroviral vector (MJT) expressing a ribozyme against the U5 region of HIV-1. No significant differences were observed in the growth pattern of CD34+ cells from normal infants, HIV-1 exposed infants or infants confirmed to be infected

by HIV-1. The transduction efficiency of the CD34+ cells from all the infants was also comparable. MJT-transduced CD34+ cells from an HIV-1-infected infant were maintained in a liquid culture system for 4 weeks, and the progeny macrophage cells were challenged with the monocytetropic laboratory strain, HIV-Bal, or the HIV-1 isolate from the infant’s mother. Significant inhibition of virus replication was observed in ribozyme-transduced cells. Thus, we have demonstrated efficient and stable gene transfer into progenitor cells from the cord blood of HIV-1-exposed or -infected infants and shown that protection from HIV-1 infection was conferred to the progeny cells produced by CD34+ cells transduced with the anti-HIV ribozyme gene construct.

Keywords: ribozyme; HIV-1; gene therapy; CD34+ cells; cord blood

Introduction Hematopoietic stem/progenitor cells derived from placental and umbilical cord blood (PUCB) are attractive targets for gene therapy for genetic disorders and infectious diseases.1–4 For infants infected by HIV-1, early genetic intervention before the immune system is severely compromised might give a higher probability of success. Additionally, the frequently aggressive course of pediatric HIV infection may provide a shorter clinical endpoint to evaluate efficacy of this novel form of therapy. We have developed ribozymes targeting the HIV genome to inhibit virus replication. Since HIV infection requires reverse transcription of RNA, such ribozymes could potentially lead to degradation of viral RNA before reverse transcription and inhibition of mRNA expression after provirus integration. We have previously documented long-term expression and antiviral effects of a hairpin ribozyme targeting the U5 region of HIV-1 in T cell lines5 and primary human peripheral blood lymphocytes derived from normal donors as well as infected patients.6,7 The target sequence for this ribozyme is highly conserved among all HIV-1 isolates, and site-directed mutations in this region led to dramatic attenuation of virus replication and rapid generation of

Correspondence: F Wong-Staal, Department of Medicine and Biology, Clinical Science Building Room 410, 9500 Gilman Drive, Mail Code 0665, La Jolla, CA 92093, USA Received 22 May 1997; accepted 23 October 1997

wild-type revertants (and no second site mutations at the target site).8 We have also shown that CD34+ cells from PUCB of normal infants can be successfully transduced with the hairpin ribozyme gene and express the ribozyme gene in a persistent fashion. Moreover, macrophage progeny of the transduced CD34+ cells was resistant to challenges from monocyte-tropic HIV-1.9 Although it is conceptually feasible to use transduced stem cells in an allogeneic setting, the need for myeloablation and post-infusion immunological suppressions, such as treatment of graft-versus-host disease, make it impractical for a phase I clinical trial. Therefore, it is more logical to use PUCB CD34+ cells from an autologous source initially to test the concept of gene therapy for HIV-1 infection. However, several fundamental questions must be first addressed: (1) Are there intrinsic functional defects, such as proliferation and differentiation, in the PUCB CD34+ cells from HIV-1-exposed or HIV-1-infected infants? (2) Are these PUCB CD34+ cells as susceptible to transduction by retroviral vectors carrying the hairpin ribozyme gene as those from normal donors? (3) Can transduction with the ribozyme vector confer resistance to the progeny cells against the autologous virus? In this article, our findings indicate that the numbers of progenitor colonies among CD34+ samples from normal infants and infants exposed to, or known to be infected by, HIV1 were not significantly different. The transduction efficiencies were also comparable. Furthermore, transduction of enriched CD34+ cells leads to long-term stable expression of ribozymes in progeny cells and protection

Ribozyme gene therapy using cord blood CD34+ cells X Li et al

234

of such cells from HIV-1 infection can be achieved with either a laboratory strain or an autologous maternal isolate.

Table 2 Comparison of clonogenic formation ability of CD34+ cells obtained from normal, HIV-1-exposed and HIV-1infected infants

Results

Source of CD34+ cells

HIV-1 infection status of infants born to HIV-1seropositive mothers Enrollment in this study was open to HIV-1-positive pregnant women regardless of their CD4+ counts or antiretroviral therapy before or during pregnancy. PUCB samples were evaluated from 10 newborns of HIV-1seropositive mothers (Table 1). The CD4+ counts of these mothers ranged from 148 to 570/mm3; nine had received single or a combination of the following antiretroviral drugs: AZT, nevirapine, or human immunodeficiency immune globulin (HIVIG). Two of the ten infants tested negative at birth but were identified as virus positive at 1 or 3 months by PCR, p24 antigen capture assays and PBMC cocultivation assays. The other eight had no evidence of infection. All positive HIV results were independently confirmed at least twice using these three tests. All PUCB samples were processed for CD34+ enrichment within 24 h. The purity of CD34+ cells using the modified protocol ranged from 87% to 93%.

HIV-1-negative donor (n = 3) HIV-1-negative donor after in vitro exposure to HIVIIIB (n = 2) HIV-1-negative donor after in vitro exposure to HIV-Bal (n = 2) HIV-1-exposed donor (n = 3) HIV-1-infected donor (n = 2)

Progenitor colony formation of enriched PUCB To determine if the PUCB-derived CD34+ cells exposed to HIV in vivo or in vitro are altered in their proliferation and differentiation capabilities, we carried out colony formation assays as shown in Table 2. The PUCB-derived CD34+ cells isolated from three normal infants yielded 150.7 ± 21.2 BFU-E and 271.7 ± 23.1 CFU-GM colonies. After in vitro exposure to the HIV-1 lymphotropic strain, HIVIIIB, or monocyte-tropic strain, HIV-Bal, CD34+ cells isolated from normal donors yielded similar numbers of colonies (149.0 ± 7.1 BFU-E and 216.0 ± 5.7 CFU-GM; 163.0 ± 8.5 BFU-E and 254.2 ± 16.3 CFU-GM, respectively). The number of colonies derived from CD34+ cells from PUCB of HIV-1 exposed infants was 207.0 ± 50.4 BFU-E and 339.0 ± 52.0 CFU-GM. Enriched CD34+ cells from cord blood of HIV-1-infected newborns generated similar numbers of BFU-E and CFU-GM (195.5 ± 67.2 and 346.0 ± 28.3, respectively). The number

Table 1 Fetal cord blood from infants born to HIV-1-positive mothers FCB

HIV infection Sex status

Mother information CD4 count/ml

1 2 3 4 5 6 7 8 9 10

− + − − − − − + − −

F M M F F M F M M F

193 570 148 409 374 150 190 201 321 433

Anti-HIV drug treatment AZT, nevirapine HIVIG, AZT — HIVIG, AZT HIVIG, AZT AZT HIVIG, AZT AZT HIVIG, AZT AZT

CFU-GM X ± s.d.

BFU-E X ± s.d.

271.7 ± 32.1 216.0 ± 5.7

150.7 ± 21.2 149.0 ± 7.1

254.2 ± 16.3

163.0 ± 8.5

339.0 ± 52.0 346.0 ± 28.3

207.0 ± 50.4 195.5 ± 67.2

CD34+ cells (1000) from normal donors with or without exposure to HIV-1 in vitro, from HIV-1-exposed and HIV-1infected infants were plated on methylcellulose plates in the presence of a combination of cytokines according to the method described previously.5 n represents the number of cord blood samples analyzed.

of colonies generated by the CD34+ cells from the HIV1-positive PUCB was not statistically different from that of the normal infants. We did not note any differences in colony morphology, size or color from all sources of PUCB CD34+ cells. Retroviral transduction did not alter the cloning efficiency of CD34+ cells isolated from all sources, as is shown in Table 3. The data suggest that CD34+ cells from PUCB of HIV-1-exposed or -infected infants maintain their proliferation and differentiation ability, and that the colony-forming capacity was not affected by ribozyme gene vector transduction.

Ribozyme transduction and expression in transduced cells To determine whether we can achieve efficient gene transfer into CD34+ cells from all three sources of PUCB, we used a retroviral vector MJT, which expresses a ribozyme against the U5 region of HIV-1 under tRNA promoter, as reported previously.9 Colony formation of

Table 3 Clonogenic formation of transduced CD34+ cells derived from normal, HIV-1-exposed and HIV-1-infected infants Source of CD34+ cells

HIV-1-negative donor (n = 2) HIV-1-negative donor (n = 2) HIV-1-exposed donor (n = 2) HIV-1-exposed donor (n = 2) HIV-1-infected donor (n = 2) HIV-1-infected donor (n = 2)

Transduction

CFU-GM X ± s.d.

BFU-E X ± s.d.

LNL

257.0 ± 26.9 158.1 ± 13.5

MJT

279.2 ± 16.3 177.1 ± 12.7

LNL

312.0 ± 23.3 180.3 ± 14.1

MJT

393.2 ± 48.7 262.0 ± 14.0

LNL

370.0 ± 50.2 213.0 ± 8.7

MJT

340.3 ± 22.6 269.4 ± 31.1

After retroviral transduction with either LNL or ribozyme containing vector, MJT, in the presence of a combination of cytokines, 1000 cells were plated on methylcellulose plates. n indicates the number of cord blood samples examined.


the transduced cells was performed in the absence of G418 selection. Single colonies were collected from each plate and were individually processed for DNA PCR using neo gene primers to determine transduction efficiency. We obtained high transduction efficiency (68.8–87.5%) in CD34+ cells from normal, HIV-exposed or HIV-1-infected PUCB (Figure 1a–c), comparable with the published results of other investigators.5,8,10 Specific amplifications of pyruvate dehydrogenase gene in these three sets of samples are shown in Figure 1a–c as controls. Ribozyme expression in the population of macrophage-like progeny cells derived from transduced CD34+ cells of HIV-1-positive PUCB was assessed by RNA PCR using ribozyme-specific primers. As shown in Figure 2, the ribozyme signal was detected from those transduced with MJT. No signal could be detected when reverse transcription (RT) was omitted from the PCR procedure in the ribozyme-transduced cells, confirming that an RNA rather than DNA signal was detected. RNA extracted from LNL-transduced cells, in the presence or absence of RT, did not give a ribozyme-specific product after PCR amplification.

Protection of progeny cells from HIV-1 challenge To determine if the expression of the ribozyme gene resulted in protection of progeny cells against HIV-1 infection, macrophage-like progeny cells (no colony selection) derived from the transduced CD34+ were cultured on fibronectin-coated 24-well plates in media containing human serum and GM-CSF. G418 was not included in the culture, since high efficiency of transduction was already observed in our system. No p24 antigen was detected from culture media of the progeny cells derived from either LNL- or MJT-transduced CD34+ cells by antigen capture assay before exogenous HIV-1 infection. When these cells were challenged with HIV-Bal,

HIV-1 replication was repressed in the ribozyme-transduced cells whereas the control vector-transduced cells supported high levels of virus replication (Figure 3a). The level of p24 antigen secretion in the control vectortransduced macrophage-like cells infected with the maternal isolate was low, but still it is evident that the ribozyme expressing macrophages were more resistant to infection. Similar difficulty in culturing the patient’s virus was encountered in cocultivation experiments with PBMC or primary macrophage cells obtained from normal donors. The p24 level had only reached a similar level (240 pg/ml) when the equivalent number of PBMC or primary macrophage cells from normal donors were used to cultivate the patient’s virus (data not shown).

Discussion Although antiretroviral intervention has significantly reduced the frequency of mother-to-infant transmission of HIV-1, prenatal transmission of HIV-1 remains an important problem. The lack of a satisfactory, long-term treatment for this disease calls for novel approaches such as gene therapy. The ultimate goal of gene therapy is to reconstitute the immune system with genetically altered cells that resist HIV-1 infection. In vitro studies on PUCB CD34+ cells have indicated that retrovirus-transduced genes can be introduced into 12–95% of progenitor cells.9,11–13 In vivo animal studies using SCID mouse models have demonstrated that CD34+ cells derived from PUCB could be successfully engrafted.14 These promising data have recently led to the initiation of a human gene therapy trial using PUCB-derived CD34+ cells for adenosine deaminase deficiency.15 Preliminary results have shown that infusion of autologous transduced cells into patients has been safe and that long-term persistence of marked cells has been detected, although the level of cells

Figure 1 Transduction efficiency with ribozyme and control vectors from different cord blood sources. Neo and pyruvate dehydrogenase sequence-specific PCR amplification of DNA extracted from transduced CD34+ cells (see Materials and methods). Lanes marked (+) represent PCR products from reaction containing MJT plasmid vector. Lanes marked with (−) are PCR reactions without DNA. (a) Normal cord blood. (b) Cord blood of an HIV-1-exposed infant. (c) Cord blood of an HIV-1-infected infant.

235


236

Figure 2 RT-PCR amplification of RNA extracted from population of macrophage-like cells differentiated from LNL or MJT transduced CD34+ cells obtained from cord blood of an HIV-1-infected infant. There was no amplification of U5 ribozyme for RNA extracted from LNL-transduced cells in either the presence or absence of reverse transcription as shown in lanes 1 and 2. When RT is omitted, the specific U5 ribozyme amplification fragment could not be seen in reaction containing RNA extracted from MJT transduced cells as indicated in lane 3. The U5 ribozyme products were amplified from MJT-transduced cells in the presence of reverse transcription as shown in lane 4. Lane 5 is 55 bp PCR product amplified from normal CD34+ cells known to be transduced with MJT ribozyme.

Figure 3 HIV-1 challenge of ribozyme transduced cells. Macrophage-like cells differentiated from LNL- or MJT-transduced CD34+ cells obtained from an HIV-1-infected infant were grown in 24-well plates and challenged with HIV-1 Bal shown in (a) or with the uncloned maternal isolate in (b). Protection was observed from HIV-Bal infection in MJT-transduced cells up to 20 days as indicated in (a); longer protection was detected in MJTtransduced cells exposed to the mother’s isolate. However, the p24 output was low. Additional challenge experiments using other autologous or primary isolates strengthen this result. Shown in both (a) and (b), LNL-transduced cells supported viral replication.

carrying the gene is low.15 Previous studies from many groups have demonstrated the feasibility of transducing CD34+ cells from normal PUCB samples.9 However, it was not known if CD34+ cells from HIV-1-exposed or HIV-1-infected PUCB samples were functionally intact and could be successfully transduced, and if the transgene would be functional in the progeny cells. It was also not clear if CD34+ cells from such examples were themselves infected by HIV-1 and if such cells could be used as vehicles for gene therapy. It is unclear whether primitive hematopoietic stem cells are susceptible to HIV infection.16–18 Various reports have found a low proportion of CD34+ cells from bone marrow and peripheral blood of adult asymptomatic or AIDS patients to be infected.16,17 We also found that about 1%

of CD34+ cells from PUCB of an HIV-1-infected infant were infected by HIV-1 in vivo (X Li, manuscript in preparation). However, CD34+ cells from such samples did not appear to be impaired in their ability to differentiate into multilineage colonies such as the granulocyte– macrophage colony-forming unit and the erythroid burst-forming unit in vitro. Thus, the potential of these cells to serve as vehicles for gene therapy should not be compromised. Our results show that transduction of PUCB CD34+ from infants of infected mothers was as efficient as that for normal PUCB CD34+ cells. The transgene was stably expressed and the macrophage-like progeny cells resisted infection by both a laboratory strain of HIV-1 and the maternal HIV isolate. These results demonstrate that


clinical trials using PUCB CD34+ hematopoietic cells from HIV-1-infected infants and the ribozyme gene constructs are rational and feasible.

Materials and methods PUCB collection and manipulation Informed consent was obtained from each HIV-1seropositive mother at the University of California, San Diego HIV Mother/Child Program before PUCB collection. Immediately after delivery, 50–150 ml of PUCB were collected into 50 ml sterile tubes containing 1 ml of 1000 U/ml of heparin (Marsam Pharmaceuticals, Cherry Hill, NJ, USA) using procedures previously described.19 The blood was processed for separation of CD34+ cells within 24 h of delivery. The collection of PUCB for this study was approved by the Human Subjects Committee of University of California, San Diego. Enrichment of CD34+ cells Enrichment of CD34+ cells was performed using a modified immunomagnetic procedure.10 Leukocyte concentration in PUCB specimens was determined using Tkrk stain solution. EDTA was added directly to the PUCB for a final concentration of 1 mm. Human immunoglobulin (HIg) (Baxter Immunotherapy, Hyland, CA, USA) was included at 0.5% to reduce nonspecific binding due to Fc receptors. Target CD34+ cells were sensitized with mouse anti-human CD34 antibody (9C5, kindly provided by Baxter Immunotherapy) at 0.5 ␮g/106 nucleated cells for 30 min at 4°C under slow rotation. Sensitized cells were washed three times using phosphate-buffered saline (GIBCO, Grand Island, NY, USA) containing 1% bovine serum albumin (Sigma, St Louis, MO, USA) and 1 mm EDTA (PBS/BSA/EDTA). Washed cells were mixed with paramagnetic microspheres coated with sheep antimouse IgG (Dynal, Lake Success, NY, USA) at a bead-tocell ratio of 0.5 for 30 min at 4°C under slow rotation. Rosetted cells were captured with a permanent magnet (MPC-1, Dynal), and washed three times in PBS/BSA/EDTA. Captured CD34+ cells were released by 5 min incubation at 37°C with chymopapain (2000 pkat per 5 x 107 cells, kindly provided by Baxter Immunotherapy). Released cells were separated from beads using MPC-1, washed, resuspended in Iscove’s modified Dulbecco’s medium (IMDM; GIBCO) containing 10% FCS. Cells were analyzed by flow cytometry to assess the proportion of CD34+ cells.20 Vector production and transduction Retroviral vector LNL and the anti-HIV ribozyme expression vector were made by transfection of corresponding plasmids into a PA317 package cell line. Colonies secreting high titer of retroviral particles were selected and cultured. Viral supernatants were collected and filtered through 0.45 ␮m filter flasks (Nalgene, Rochester, NY, USA). CD34+ cells isolated from PUCB of either normal, HIV-exposed or HIV-1-infected infants were stimulated, transduced using either LNL or MJT cell-free viral supernatants at a multiplicity of infection of two to five according to the method described previously.9 A schematic diagram of the MJT and LNL vectors is shown in Figure 4.

Assays for hematopoietic progenitor cells Hematopoietic progenitor colonies were cultured in methylcellulose medium (Stem Cell Technology, Vancouver, BC, Canada) containing IL-3 (500 U/ml; Genetics Institute, Cambridge, MA, USA), IL-6 (500 U/ml; Genetics Institute), SCF (25 ng/ml; Amgen, Thousand Oaks, CA, USA), GM-CSF (50 ng/ml; Immunex, Seattle, WA, USA) and EPO (3 U/ml; Amgen). Each 35-mm dish contained 1000 enriched cells with or without transduction. CFU-GM and BFU-E were scored under inverted microscope after 14 days of culture. Analysis of transduction by DNA PCR Colonies derived from CD34+ cells obtained from PUCB of normal, HIV-1-exposed or HIV-1-infected newborns were removed. Each colony was individually processed for DNA extraction using the method described previously.21 PCR reactions using neo-specific primers were performed in 50 ␮l solution containing reagents described previously13 except that neo-sequence specific primers were used: neo3 (5′-GATCAAGAGACAGGATGAGG-3′) and neo4 (5′-CAGCCATGATGGATACTTTC3′). The PCR program was as follows: 94°C for 3 min followed by 35 cycles of 94°C for 30 s, 54°C for 30 s and 72°C for 30 s, and then 72°C for 10 min. PCR reactions using pyruvate dehydrogenase (pdh)-specific primers as controls for amplification were carried out by the following program: 94°C for 3 min followed by 30 cycles of 94°C for 30 s, 60°C for 30 s and 72°C for 30 s, and then 72°C for 10 min. The primer sequences for pdh are 5⬘ GGTATGGATGAGGAGCTGGA 3⬘ (left primer) and 5⬘ CTTCCACAGCCCTCGACTAA 3⬘ (right primer). Amplified DNA were analyzed by electrophoresis on 1.5% agarose (GIBCO) and visualized with ethidium bromide under UV light. HIV challenge of macrophage-like cells derived from CD34+ cells of an HIV-infected infant CD34+ cells from PUCB of an HIV-1-infected infant were transduced with LNL and MJT as described above. Cells were then cultured in media containing IL-3 (500 U/ml), IL-6 (500 U/ml) and SCF (25 ng/ml) for 4 weeks, and macrophage-like cells were selected on fibronectin-coated 24-well plates (Costar, Cambridge, MA, USA). After culturing for another 2 weeks, macrophage-like cells growing as a population were subjected to the following experiments: (1) challenged with the monocyte-tropic strain HIV-Bal; (2) or the virus isolated from the infant’s mother with a multiplicity of infection (MOI) of 0.01–0.02 in the presence of 4 ␮g/ml polybrene for 3 h; (3) analyzed for the ribozyme expression. For challenge experiments, cells were washed three times with PBS and cultured in RPMI containing 10% FCS, 10% human serum and 1 ng/ml of human GM-CSF for 3–6 weeks. An aliquot was taken from the supernatant once every 2–3 days for p24 antigen capture assays. HIV-1 isolated from the mother was first propagated in normal peripheral blood mononuclear cells (PBMC) obtained by Ficoll gradient separation and then passed on macrophage cells selected from normal PUCB before the collection for viral stock. Ribozyme expression RNA was extracted from the population of macrophagelike cells derived from the transduced CD34+ cells obtained from HIV-1-infected PUCB specimens as men-

237


238

Figure 4 Schematic representation of retroviral vector pLNL and pMJT (a) MoMLV retroviral LNL vector. (b) U5 ribozyme was inserted downstream of tRNAval promoter and cloned into LNL vector in an antisense orientation with respect to the MoMLV LTR. (c) Hairpin ribozyme against the U5 region of HIV-1.

tioned above in the challenge experiment. RT-PCR was performed using ribozyme-specific primer Rib 2: (5′TACCAGGTAATATAC CAC-3′). Reverse transcription was performed at 60°C for 20 min using a downstream primer and TthDNA pol (Boehringer Mannheim, Germany) using conditions recommended by the manufacturer. DNA PCR was performed by addition of 32Plabeled upstream primer Rib 4: (5′-CACACAACAAGAAGGCAA-3′) under conditions for DNA PCR recommended by the same manufacturer. Rib 4 primer was 5′ labeled by 32P-␥ ATP (Dupont, Boston, MA, USA) using T4 DNA kinase (Phamarcia, Uppsala, Sweden) under the conditions suggested by the manufacturer. The PCR products were separated from free primers by electrophoresis on 10% polyacrylamide gel and visualized by exposing to radiographic film for 6 h.

Statistical analysis Statistically significant differences among sets of samples were determined by Student’s t test.

Acknowledgements We thank Dr Mark C Leavitt for LNL and MJT viral supernatants, Dr David Looney for HIV-Bal viral stock, Mary Caffery and Dr Mitchell Besser for collecting cord blood samples from HIV-1 exposed infants. The work was supported by the NIAID SPIRAT and CFAR awards (F Wong-Staal), grant AI49619 (F Wong-Staal), and AI 2763 and AI39004 (SA Spector). X Li is a Pediatric AIDS Foundation Scholar.

References 1 Abboud M, Xu F, Lavia M, Laver J. Study of early hematopoietic precursors in human cord blood. Exp Hematol 1992; 20: 1043– 1047. 2 Broxmeyer HE et al. Umbilical cord blood hematopoietic stem and repopulating cells in human clinical transplantation. Blood Cells 1990; 17: 313–329. 3 Apperley JF, Willians DA. Gene therapy: current status and future directions. Br J Haematol 1990; 75: 148–155.


4 Willians DA, Moritz T. Umbilical cord blood stem cells as target for genetic modification: new therapeutic approaches to somatic gene therapy. Blood Cells 1994; 20: 504–516. 5 Yamada O et al. Intracellular immunization of human T cells with a hairpin ribozyme against human immunodeficiency virus type 1. Gene Therapy 1994; 1: 39–45. 6 Leavitt M et al. Transfer of an anti-HIV-1 ribozyme gene into primary human lymphocytes. Hum Gene Ther 1994; 5: 1115–1120. 7 Leavitt M, Yu M, Wong-Staal F, Looney D. Prelude to a ribozyme gene therapy trial. Gene Therapy 1996; 3: 599–606. 8 Yamada O et al. Conservation of a hairpin ribozyme target sequence in HIV-1 is required for efficient viral replication. Virology 1996; 220: 361–366. 9 Yu M et al. Intracellular immunization of human fetal cord blood stem/progenitor cells with a ribozyme against human immunodeficiency virus type 1. Proc Natl Acad Sci USA 1995; 92: 699–703. 10 Lane TA et al. Harvesting and enrichment of hematopoietic progenitor cells mobilized into the peripheral blood of normal donors by granulocyte–macrophage colony-stimulating factor (GM-CSF) or G-CSF: potential role in allogenic marrow transplantation. Blood 1995; 85: 275–282. 11 Lu L et al. High efficiency retroviral mediated gene transduction into single isolated immature and replatable CD34+++ hematopoietic stem/progenitor cells from human umbilical cord blood. J Exp Med 1993; 178: 2089–2096. 12 Ho AD et al. Stem cells as vehicles for gene therapy: novel strategy for HIV infection. Stem Cells 1995; 13: 100–105. 13 Hanley ME, Nolta JA, Parkman R, Kohn D. Umbilical cord

14

15

16

17

18

19

20

21

blood cell transduction by retroviral vectors: preclinical studies to optimize gene transfer. Blood Cells 1994; 20: 539–546. Vormoor J et al. Immature human cord blood progenitors engraft and proliferate to high levels in severe combined immunodeficient mice. Blood 1994; 83: 2489–2497. Kohn D et al. Engraftment of gene-modified umbilical cord blood cells in neonates with adenosine deaminase deficiency. Nature Med 1995; 1: 1017–1023. Neal TF et al. CD34+ progenitor cells from asymptomatic patients are not a major reservoir for human immunodeficiency virus-1. Blood 1995; 88: 1749–1756. Von Laer D et al. CD34+ hematopoietic progenitor cells are not a major reservoir of the human immunodeficiency virus. Blood 1990; 76: 1281–1286. Davis B et al. Absent or rare human immunodeficiency virus infection of bone marrow stem/progenitor cells in vivo. J Virol 1991; 65: 1985–1990. Wagner JE, Broxmeyer HE, Cooper S. Umbilical cord and placental blood hematopoietic stem cells: collection, cryopreservation, and storage. J Hematother 1992; 1: 167–173. Huang S, Terstappen L. Formation of hematopoietic microenvironment and hematopoietic stem cells from single human bone marrow stem cells. Nature 1992; 360: 745–749. Lu M et al. High efficiency retroviral-mediated gene transduction into CD34+ cells purified from peripheral blood of breast cancer patients primed with chemotherapy and granulocyte– macrophage colony-stimulating factor. Hum Gene Ther 1994; 5: 203–208.

239