Genes Preferentially Expressed in Bovine Oocytes Revealed by ...

Download PDF
1 downloads 0 Views 893KB Size Report
Comment
Jun 1, 2005 - Centre National de la Recherche Scientifique/Université François Rabelais de Tours/Haras Nationaux, Nouzilly. F-37380, France.
BIOLOGY OF REPRODUCTION 73, 713–720 (2005) Published online before print 1 June 2005. DOI 10.1095/biolreprod.105.041574

Genes Preferentially Expressed in Bovine Oocytes Revealed by Subtractive and Suppressive Hybridization1 Sophie Pennetier,3 Svetlana Uzbekova,3 Catherine Guyader-Joly,4 Patrice Humblot,5 Pascal Mermillod,3 and Rozenn Dalbie`s-Tran2,3 Physiologie de la Reproduction et des Comportements,3 UMR 6175 Institut National de la Recherche Agronomique/ Centre National de la Recherche Scientifique/Universite´ Franc¸ois Rabelais de Tours/Haras Nationaux, Nouzilly F-37380, France Union Nationale des Coope´ratives d’Elevage et d’Inse´mination Animale,4 station UNCEIA/UCEAR, Chateauvillain F-38300, France Union Nationale des Coope´ratives d’Elevage et d’Inse´mination Animale,5 De´partement R&D, Maisons-Alfort Cedex F-94703, France ABSTRACT

Recently, molecular biology studies have associated these properties with a unique pattern of gene expression, involving complex regulatory mechanisms both at the transcription and posttranscription level. Particular attention has been paid to oocyte-specific messengers, which either are not or are rarely found in other tissues. In mammals, the mouse has been the model of choice for the study of these so-called oocyte-specific genes. Functional studies have established their often essential role in reproduction. Factor in the germline alpha (Figla)-null mice lack primordial follicles and show massive oocyte depletion [1]. Figla coordinates the expression of the zona pellucida (ZP) glycoproteins forming the specific extracellular coat that surrounds the oocyte [2]. These proteins are necessary for optimal oocyte growth and fertilization and for the ovulated egg or early embryo to migrate through the oviduct [3]. Expression of these genes is not affected by the loss of expression of OG2 homeobox gene (Og2x, also known as Nobox) that down-regulates several other oocyte-specific transcripts, including growth differentiation factor 9 (Gdf9), bone morphogenetic protein 15 (Bmp15), or zygote arrest 1 (Zar1). Homozygous-null Nobox animals exhibit a block of follicles that develop at the primordial stage and rapid postnatal oocyte depletion [4]. Both GDF9 and BMP15 have synergistic roles in the development and function of the oocytecumulus complex (COC) [5]. Not surprisingly, oocyte-specific maternal-effect factors were identified. The NACHT leucine-rich repeat and PYD containing 5 (Nalp5, also known as Mater), Zar1, and developmental pluripotencyassociated 3 (Dppa3, also known as Stella and PGC7) are required for normal embryonic preimplantation development. Embryos from Mater-null or Zar1-null mothers were blocked at the 2-cell and the 1-cell stage, respectively [6, 7]. The phenotype was not as precocious with Stella-null mothers, but embryos rarely reached the blastocyst stage [8]. Little is known regarding the conservation of these genes and their restricted expression pattern in cattle. We recently demonstrated preferential oocyte expression of the bovine orthologous MATER, ZAR1, GDF9, and BMP15 genes [9– 11]. In the mouse, several oocyte-restricted gene families have been discovered using an in silico subtraction approach: Egg libraries in public databases were subtracted with expressed sequence tag (EST) from somatic tissue libraries [12, 13]. This approach is not as productive in the bovine, because no oocyte library is available for selection

To isolate bovine oocyte marker genes, we performed suppressive and subtractive hybridization between oocytes and somatic tissues (i.e., intestine, lung, muscle, and cumulus cells). The subtracted library was characterized by sequencing 185 random clone inserts, representing 146 nonredundant genes. After Blast analysis within GenBank, 64% could be identified, 21% were homologous to unannotated expressed sequence tag (EST) or genomic sequences, and 15% were novel. Of 768 clone inserts submitted for differential screening by macroarray hybridization, 83% displayed a fourfold overexpression in the oocyte. The 40 most preferential nonredundant ESTs were submitted to GenBank analysis. Several well-known oocyte-specific genes were represented, including growth differentiation factor 9, bone morphogenetic protein 15, or the zona pellucida glycoprotein genes. Other ESTs were not identified. We investigated the expression profile of several candidates in the oocyte and a panel of gonadal and somatic tissues by reverse transcriptionpolymerase chain reaction. B-cell translocation gene 4, cullin 1, MCF.2 transforming sequence, a locus similar to snail soma ferritin, and three unidentified genes were, indeed, preferentially expressed in the oocyte, even though most were also highly expressed in testis. The transcripts were degraded throughout preimplantation development and were not compensated for by embryonic transcription after the morula stage. These profiles suggest a role in gametogenesis, fertilization, or early embryonic development.

early development, gamete biology, gene regulation, oocyte development, ovary

INTRODUCTION

The oocyte has long been recognized as a unique cell in the organism, with the unshared ability to be fertilized and generate an embryo that will develop into a new individual. 1 Supported by a fellowship to S.P. from the Conseil Re´gional Re´gion Centre and Institut National de la Recherche Agronomique. This work is part of an Agenae selected project and was sponsored by grants from the French Ministry of Research and Apisgene. 2 Correspondence: Rozenn Dalbie`s-Tran, INRA-PRC, Nouzilly F-37380, France. FAX: 33 247 42 77 43; e-mail: [email protected]

Received: 7 March 2005. First decision: 28 March 2005. Accepted: 31 May 2005. Q 2005 by the Society for the Study of Reproduction, Inc. ISSN: 0006-3363. http://www.biolreprod.org

713

714

PENNETIER ET AL.

(see http://www.ncbi.nlm.nih.gov/UniGene/ddd.cgi?ORG5 Bt). Whole-ovary libraries lack many oocyte-specific ESTs, because the oocyte itself is hardly represented in the constitutive tissue. The use of fetal ovaries enriched in oocytes did not entirely circumvent this problem. For example, bovine MATER is not represented in any ovarian library in GenBank. In a recent study, a bovine oocyte cDNA library was generated and screened with probes generated from fetal ovary, spleen, and liver to identify oocyte-specific transcripts. Six genes were confirmed to be overexpressed (.1.8 fold) in fetal ovary relative to either of these somatic organs, including one presumed novel gene, two genes previously reported as being preferentially expressed in oocytes, as well as the ribosomal protein L7a, dynein light chain, double C2-like domain a, calmodulin, and leucinerich protein genes [14]. We have chosen an alternative strategy and generated a library enriched in oocyte-specific bovine ESTs using suppressive and subtractive hybridization (SSH). Differential macroarray hybridization confirmed preferential expression in the oocyte of a large majority of ESTs. A subset of transcripts were followed by reverse transcription-polymerase chain reaction (RT-PCR) in a panel of somatic and gonadal tissues: Most were, indeed, predominantly expressed in the oocyte but also highly expressed in testis. Remarkably, none was reactivated at the time of maternal to embryo transition during preimplantation embryo development in vitro. Our results are discussed in relation with a recently described library generated from immature, postmortem-collected oocytes [15]. MATERIAL AND METHODS

Oocyte, Preimplantation Embryo, and Tissue Collections All procedures were approved by the Agricultural and Scientific Research Government Committees in accordance with the guidelines for Care and Use of Agricultural Animals in Agricultural Research and Teaching (approval A37801). Prepubertal and adult cow ovaries were collected at the slaughterhouse, and COCs were aspirated from 3- to 6-mm antral follicles. After washes in saline solution, COCs were matured for 6 or 24 h in TCM 199 (Sigma, France) supplemented with 10 ng/ml of epidermal growth factor at 398C in water-saturated air with 5% carbon dioxide. Immature oocytes, and oocytes matured for 5 or 24 h, were denuded by mechanical treatment. Other oocytes were collected in vivo by ovum pickup (OPU) from eight Montbeliard cows. Ovum pickup was performed at 12, 48, or 60 h after prostaglandin injection to collect immature, maturing, and in vivo-matured oocytes, respectively. Oocytes were denuded as described above. All samples were stored frozen at 2808C in RNAlater (Ambion, UK). For embryo production, oocyte were collected from slaughterhouse bovine ovaries and matured as described above. In vitro fertilization was performed on groups of 50 intact, in vitro-matured COCs transferred into 500 ml of fertilization medium containing 5 3 105 motile spermatozoa. Twenty-four hours later, presumptive zygotes were denuded. Twenty of them were set aside, whereas groups of 25 zygotes were transferred into 25-ml droplets (under paraffin oil) of modified synthetic oviduct fluid [16] supplemented with 5% fetal calf serum. Embryos were cultured at 398C in a water-saturated atmosphere with 5% CO2/5% O2/90% N2. Groups of 20 embryos were collected during preimplantation development period: 2cell and 4-cell embryos (Day 1), 5- to 8-cell embryos (Day 2), morulae (Days 4–5), and expanded blastocysts (Days 6–7). All oocyte and embryo samples were stored frozen at 2808C in RNAlater (Ambion) until RNA extraction. Various somatic tissues (brain, heart, pituitary, intestine, liver, lung, muscle, spleen, and uterus) as well as male and female gonads were collected from adult cows or bulls, either at a slaughterhouse or in an experimental setting. Cumulus cells were isolated by mechanical treatment from COCs collected as described above, then washed with saline solution, centrifuged twice for 5 min at 1000 rounds per min, and conserved as a pellet. Organ biopsy samples and cumulus cells were frozen in liquid nitrogen and stored at 2808C.

RNA Extraction For library construction, total RNA from each postmortem- and in vivo-collected oocyte groups was extracted using Tripure Isolation Reagent (Roche Diagnostics, Mannheim, Germany) and then pooled to obtain two RNA samples from 113 postmortem-collected and 82 in vivo-collected oocytes. The same protocol was used to purify total RNA from groups of 20 oocytes or embryos for individual gene analysis. Total RNA was extracted from 0.3- to 0.5-g biopsy specimens of somatic and gonadal tissues using Trizol reagent (Invitrogen, France) following the manufacturer’s instructions. Aliquots of RNA were incubated with 10 U of RQ1 DNase (Promega, France) for 20 min at 378C, followed by organic extraction, precipitation, and resuspension into water. The RNA concentration was deduced from optical density, and RNA integrity was checked by electrophoresis on denaturing gel. The GDF9 cDNA primers had been designed based on human GDF9 sequence and were used in a previous study [9].

Construction of Subtractive cDNA Library The cDNA was synthesized and amplified using Super SMART PCR cDNA Synthesis kit (Ozyme, France) following the manufacturer’s instructions with slight modifications. Briefly, total RNA from postmortem- and in vivo-collected oocytes and 1 mg of total RNA from somatic tissues (300 ng of lung, intestine, and muscle RNA and 100 ng of cumulus cell RNA) was reverse-transcribed with a modified oligo(dT) primer. The cDNA was amplified by PCR reactions, followed by digestion with restriction enzyme RsaI. After precipitation and resuspension in water, digested cDNA was quantified by ultraviolet (UV) spectrophotometry. Equal amount of cDNA amplified from postmortem- and in vivo-collected oocytes were pooled and diluted to a final concentration of 300 ng/ml. In the next step, oocyte cDNA was subtracted with an excess of cDNA from somatic tissues using PCR-Select cDNA Subtraction Kit (Ozyme) following manufacturer’s instructions. After ligation of the adaptator to oocyte cDNA and hybridization steps, primary and nested PCRs were run for 24 and 10 thermal cycles, respectively. Subtraction efficiency was checked by PCR amplification of b-actin (ACTB) and GDF9 using the primers described in Table 1.

Differential Screening of the Subtracted Library Macroarray preparation. The subtracted library was subcloned using the TA cloning kit dual promoter (Invitrogen). In all, 768 clones were randomly picked, and the inserts were amplified by two sets of PCR using primers M13RP1 and M13P2 (59-GAGCGGATAACAATTTCACACAGGA and 59-TCCCAGTCACGACGTTGTAAAACGA). After precipitation and resuspension, PCR products were arrayed in duplicate onto Hybond N1 membrane (Amersham Biosciences, France) at the Centre de Ressources Biologiques-GADIE (Jouy en Josas, France). Hybridization controls (pools of clones representing 145 ubiquitously expressed genes) were spotted. The membrane was incubated for 10 min in 0.5 M NaOH/1.5 M NaCl and then for 10 min in 1 M Tris/1 M NaCl, then washed four times in water and baked for 2 h at 808C. Differential hybridization. We generated complex probes from oocyte and somatic tissues (intestine, lung, muscle, and cumulus cells). Briefly, total RNA from groups of 50 immature and in vitro-matured denuded oocytes and 500 ng of pooled somatic tissues RNA were reverse-transcribed and amplified using Super SMART PCR cDNA Synthesis Kit (Ozyme) following manufacturer’s instructions. Equal amounts of immature and mature oocyte cDNA were pooled. Next, 250 ng of oocyte and somatic tissue cDNA were radiolabeled with a[32P]dATP (Amersham) by random priming using Klenow fragment (Eurogentec, France). Macroarrays were hybridized with the probe in ExpressHyb Hybridization Solution (Ozyme) overnight at 688C. Membranes were washed and then exposed to a PhosphorImager screen (Amersham Biosciences, Orsay, France). The image was revealed using the Storm imaging system (Amersham Biosciences), and data were quantified using Imagene 4.0 software (Proteigene, Saint Marcel, France) and normalized to hybridization controls. Duplicates were averaged. DNA sequencing and analysis. Inserts were sequenced (Macrogen, South Korea). Alignments were performed using Blastn (http://www. ncbi.nlm.nih.gov/BLAST/) against bovine EST and mammalian formerly nonredundant nucleotide sequences database (May 2005).

RT-PCR and Southern Hybridization Reverse transcription was performed on total RNA amounts equivalent to five oocytes/embryos and 1 mg of total RNA from somatic and gonadal

715

BOVINE OOCYTE-SPECIFIC GENES TABLE 1. Primer design. Gene or clone

GenBank accession no.

GDF9

NMp005260

ACTB

AY141970

2G12 (5TG4)

DN953737

8C3 (CUL1)

DN953738

4B3 (MCF2)

DN953739

5B4 (MCF2)

DN953732

6D3

DN953733

8D7

DN953734

8B9

DN953735

7F3

DN953736

Primer

Sequence (59-39)

Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense

TAGTCAGCTGAAGTGGGACA ACGACAGGTGCACTTTGTAG GCGTGACATCAAGGAGAAGC TGGAAGGTGGACAGGGAGGC TTTGCAGAAAAGCTGATGACA TCTTTGGATTGCTGACTTTAGGA GAGGAAGATCGCAAACTGCT AGCTTGTCTCCCTCCTTCCT TGCTAGATTCAAACCAATGCAG TGGGTATCGATCACCACCTT TAGGACTACGCCCATTCACC GGGTCCAGGTTGGGTTATCT CTCCAAACCTCACTGCCATT TGGTGGCAAACATTGGTAAA ATGCACGCTTGTTGTGTGAC TGACTGCCCTGTAACCTACG TGCCTTCCGGTGATTAAGAG TGTCTCTTGACCTGCTGCTG ACCCTAGTCCCTAATGCAGT ACCACTGGGTCAACACACAC

tissue biopsy samples. Amounts of cDNA corresponding to 0.05 oocyte (i.e., estimated as 0.1 ng) or embryo and to 50 ng of tissue were amplified by 36 or 38 thermal cycles using the primers described in Table 1. For tissue analysis, the products were then transferred onto Hybond N1 membrane (Amersham Biosciences) and hybridized with the corresponding cDNA fragment labeled with a[32P]dCTP (Amersham) (see [9] for details).

RESULTS

Validation of the Subtracted Library

We generated a library of bovine ESTs preferentially represented in the oocyte using the SSH technique. The cDNA generated from denuded oocytes was subtracted with cDNA generated from selected somatic tissues. Oocytes representing various physiological situations were collected: oocytes from calf (postmortem) and adult cow (postmortem and in vivo) before, during, and after maturation. Intestine, lung, and muscle were chosen as somatic tissue samples as well as cumulus cells to compensate for potential contamination of oocyte samples by remaining cumulus cells. To check the subtraction efficiency, we amplified GDF9 and ACTB by PCR as examples of oocyte-specific and housekeeping genes, respectively. In the subtracted library, 30 PCR cycles were necessary to detect GDF9, compared to 35 cycles in the nonsubtracted library. By contrast, ACTB was detected after 30 PCR cycles in the subtracted library, compared to 20 cycles without subtraction (Fig. 1). So, we observed the expected enrichment in GDF9 cDNA and reduction of ACTB cDNA in the oocyte-subtracted library. To further characterize the library, we randomly picked 192 clones (1A1 to 2H12) and then sequenced the inserts. Next, 185 good-quality sequences were aligned to those in the GenBank database using Blastn. We first searched Bos taurus ESTs, and then the search was extended to the genomic mammalian database. All 185 clones contained an insert. They represented 146 nonredundant sequences, with a maximum of four replicates, which entered one of the following three categories (Fig. 2, as of 1 May 2005). No significant match was returned for 22 clones (15%; novel). Thirty nonredundant clones (21%) presented homology only with unannotated EST or genomic sequences (unchar-

Length of expected PCR product (bp) 278 (human) 432 412 287 103 294 249 192 303 150

acterized). Finally, 94 sequences (64%) corresponded to genes identified in bovine or displayed significant sequence homology with named human or murine genes (expect value , 1e210). Their corresponding expression profiles in the mouse and human are described in UniGene (http://www. ncbi.nlm.nih.gov/entrez/query.fcgi?db5unigene). Sixteen genes were indicated to have an egg- or embryo-restricted expression (i.e., these tissues contribute more than half the EST), as detailed in Table 2. Macroarray Differential Screening

Two sets of macroarrays (see Material and Methods) were hybridized with complex probes generated from either oocyte or pooled somatic tissues (intestine, lung, muscle, and cumulus cells). The resulting artificially colored image is shown in Figure 3. Intensity was normalized to hybridization controls in yellow (except for those in the corners of the membrane, attributable to uneven hybridization). Red and green spots correspond to EST overrepresented in oocytes and somatic tissues, respectively. Then, the ratio of hybridization signals in oocyte versus somatic tissues was calculated. Only six clones displayed a ratio below 1 and were false-positive clones. For 640 clones (i.e., 83%), this ratio was at least fourfold greater, and the corresponding ESTs were considered to be overrepresented in the oocyte relative to intestine, lung, muscle, and cumulus cells. Seventy spots had a ratio greater than 9 and were selected for sequencing. These spots corresponded to 40 independent

FIG. 1. Estimation of the subtraction efficiency. GDF9 and ACTB were amplified by PCR on subtracted and unsubtracted cDNA libraries. The number of PCR cycles is indicated above each lane.

716

PENNETIER ET AL.

FIG. 2. Characterization of the ESTs represented in the subtracted library based on sequence analysis of 146 nonredundant inserts. Identified sequences present significant homology with mammalian known genes (expect value , 1e210). Uncharacterized sequences correspond to sequences homologous to unannotated EST or genomic sequences. Sequences with no significant match were called novel sequences.

clusters, of which 24 were identified, 15 were uncharacterized, and one was novel. Nine genes were labeled with an egg- or embryo-restricted expression in mouse/human (Table 2). Expression in Bovine Tissues

Among those 40 most-oocyte-enriched ESTs, eight were further analyzed. Three identified ESTs, 2G12 (BTG4), 8C3 (CUL1), and 4B3 (MCF2), were chosen based on their description in UniGene as egg or embryo restricted. The other five ESTs were novel bovine sequences at the start of the study but recently have been found in distinct bovine oocyte or 2-cell embryo EST libraries [15] (library Unilib 15406) (Table 3). The 8B9 represents a transcribed locus similar to snail soma ferritin, which has been annotated lately. We analyzed their expression profile within a larger panel of tissues (brain, heart, pituitary, intestine, liver, lung, muscle, spleen, uterus, testis, and ovary) using RT-PCR, a more sensitive and more specific technique compared to array hybridization. An estimated 500-fold excess of substrate cDNA for all tissues over the oocyte was used, except for ACTB (50-fold excess). The PCR-generated fragments were visualized on agarose gel under UV illumination (Fig. 4A). To check the specificity of PCR fragments and to increase sensitivity, PCR products were transferred for Southern hybridization and revealed by autoradiography (Fig. 4B). In parallel, reactions were run onto RNA samples subjected to mock RT to check that signal was not the result of contaminating DNA (not shown). As expected, ACTB cDNA was amplified from all samples. All other genes generated an intense band in the oocyte and were detected in the ovary. BTG4, CUL1, 5B4, 6D3 and 8D7 were preferentially expressed in gonads and at a low level in a subset of somatic tissues: BTG4 in brain, pituitary, lung, and uterus; CUL1 in brain and muscle; 5B4 in intestine; 6D3 in brain, heart, pituitary, liver, and spleen; and 8D7 in brain, pituitary, lung, and uterus. 8B9 was expressed strongly in oocyte and liver, was expressed at a lower level in ovary and brain, and was barely detectable in testis. MCF2 was highly detected in gonads, brain, spleen, and uterus and at trace levels in intestine and muscle, and 7F3 was ubiquitously expressed in our panel of tissues. Expression in Oocytes and Preimplantation Embryos

Expression profiles of BTG4, CUL1, and MCF2 and of the ESTs 5B4, 6D3, 8D7, 8B9, and 7F3 were analyzed in oocyte and preimplantation embryos by RT-PCR. All were strongly detected in immature oocytes, in in vitro-matured oocytes, and in zygotes. MCF2 transcript decreased as early as the 2-cell stage. BTG4 still produced an intense band in morulae and could be detected in blastocysts. Other transcripts were readily observed until the 5- to 8-cell stage and were still present at trace levels in morulae. By contrast, our ACTB control was detected in all samples, and its

expression increased from the 8-cell stage onward. A similar profile was observed for the polymerase (DNA-directed) b transcript (not shown). DISCUSSION

In this article, we describe the generation of a library of ESTs overrepresented in the oocyte from antral follicles as compared to a pool of somatic tissues. To obtain a comprehensive library, various physiological situations were represented. In vivo-collected oocytes represent the most physiological situation, and in vivo-matured oocytes exhibit a better developmental rate than their in vitro-matured counterparts. Transcripts might be present in immature oocytes but degraded by the end of maturation, hence the immature oocytes. Transcription occurs in bovine COCs within the first few hours of maturation [17], which prompted us to include the maturing oocytes (5 h of in vitro maturation or collected 40 h after prostaglandin injection OPU). Finally, some transcripts may have been degraded following translation in the most competent oocytes but still be present in the less competent oocytes. Therefore, it made sense to us to include such lower-quality oocytes as those from prepubertal animals [18]. Overall, oocytes collected by OPU represented almost half the total, and oocytes from adults were in large excess compared to oocytes from prepubertal animals. As this work was completed, a distinct subtracted bovine oocyte library was described [15]. Although the methodology was similar, the biological material was different: This library only included immature oocytes collected from slaughterhouse cow ovaries, and the somatic tissues used for subtraction were muscle, kidney, liver, and spleen. Therefore, both libraries are expected to contain many common ESTs but also a subset of specific clones. Discovering novel transcripts was one of our objectives, because studies on model species like mouse and rabbit have shown that oocytes and early embryos do contain specific transcripts. In fact, 36% of the 146 nonredundant ESTs did not match with an annotated sequence, 21% were homologous to unannotated genomic DNA, and 15% did not return a significant match in GenBank. Indeed, this fairly high proportion of novel transcripts somehow exceeded our expectations. It appears unlikely that these ESTs can all represent novel mammalian genes. More probably, some of these ESTs indeed correspond to nonconserved regions of known human or mouse transcripts. Such divergence is often observed in the 59- or 39-untranslated regions. In fact, approximately 20% of all inserts included a terminal polyA. Yet, we may, indeed, also expect to identify novel genes from this set of uncharacterized/novel ESTs. They could be genes for which mouse orthologues have so far remained hidden in the mouse genome, neither elucidated despite intensive efforts toward genome mining nor detected experimentally. Alternatively, they could be genes that have diverged significantly between the mouse, cow, and human.

717

BOVINE OOCYTE-SPECIFIC GENES TABLE 2. Genes identified in the library with an egg or embryo restricted expression based on Unigene EST counts. Clone (length)

% Identity (length)

Bt transcribed locus, strongly similar to Pt XPp520293.1 similar to GLE1-like, RNA export mediator isoform 1; GLE1 (yeast homolog)-like, RNA export mediator (GLE1L) Bt sushi repeat-containing protein (SRPX)

CN442180

Egg (Mm)

CN437555

Embryo (Mm)

Bt (predicted), similar to checkpoint kinase 1 homolog (CHEK1) Bt (predicted), similar to Hs Maternal embryonic embryonic leucine zipper kinase (MELK) Bt transcribed locus, moderately similar to Hs XPp031561.2 chromosome 15 open reading frame 23 (C15orf23) Bt (predicted), similar to 2 chromosome 15 open reading frame 23 (C6orf52) Bt (predicted), similar to Bisphosphoglycerate mutase (2, 3-bisphosphoglycerate mutase, erythrocyte) (2, 3-bisphosphoglycerate synthase) (BPGM) Bt (predicted) similar to tripartite motif-containing 6 isoform 1 (TRIM6) Bt (predicted) asp (abnormal spindle)-like, microcephaly associated (Drosophila) (ASPM) Bt (predicted) similar to Zinc finger protein 215 (ZNF215) Bt (predicted), similar to Proto-oncogene DBL/MCF2 (MCF2) Bt zona pellucida glycoprotein 2 (ZP2)

XMp591405 XMp581348

Egg (Mm) Embryo (Hs) Embryo (Hs)

CO881391

Embryo (Hs)

XMp596046

Embryo (Hs)

XMp586028

Egg (Hs, Mm)

XMp592353

Embryo (Mm)

XMp587172

Embryo (Hs)

XMp607597

Embryo (Hs)

XMp601577

Embryo (Hs)

NMp173973

Egg (Mm)

XMp584768

0

Bt (predicted) similar to pituitary tumor-transforming protein 1 (PTTG1) Bt cyclin B1 (CCNB1)

L26548

Egg (Mm) Embryo (Hs) Egg (Mm)

0

Bt zona pellucida glycoprotein 4 (ZP4)

NMp173975

Egg (Hs)

0

Bt bone morphogenetic protein 15 (BMP15)

AY572412

Egg (Mm)

e-177

Bt (predicted) similar to BTG4 protein (BTG4)

XMp598225

e-141

Bt (predicted) similar to SCF complex protein cul-1 (CUL1) Bt growth differentiation factor 9 (GDF9)

XMp589507

Egg (Mm) Testis, embryo (Hs) Egg (Mm)

NMp174681

Egg (Mm)

96 (256 nt)

e-118

1D12 (225 nt) 1B4 (251 nt) 1E7 (239 nt)

100 (225 nt) 99 (251 nt) 96 (223 nt)

e-124

1E10 (603 nt)

94 (325 nt)

e-111

1E11 (297 nt) 1G4 (552 nt)

100 (47 nt) 99 (343 nt)

1e-16

207 (207 nt) 2F10 (399 nt) 2G3 (674 nt) 4B3 (218 nt) 681 (490 nt) 683 (601 nt) 6C3 (500 nt) 6G12 (396 nt) 8A2 (381 nt) 2G12 760 nt) 8C3 (347 nt) 8D2 (273 nt)

100 (202 97 (378 90 (393 100 (150 97 (466 98 (429 97 (500 100 (396 100 (381 100 (313 100 (253 98 (206

e-109

b

Restricted expressionb

Blast results species/definitiona

1A4 (260 nt)

a

GenBank accession no.

Expected value

e-136 2e-89

0

nt) 0 nt) e-130 nt) 3e-80 nt) 0 nt) 0 nt) nt) nt) nt) nt) nt) 1e-56 nt)

Bt, Bos taurus. Contributing more than half of the EST frequency; Hs, Homo sapiens; Mm, Mus musculus.

Further experiments are planned to characterize and, potentially, identify these genes. Whereas SSH often is plagued with a high proportion of false-positive clones, our controls by differential hybridization and/or RT-PCR confirmed preferential oocyte expression of a vast majority of the corresponding genes. The low rate of false positives, actually overexpressed in somatic tissues, may be attributable to the choice of a contrasted model for the subtraction (i.e., oocytes vs. a pool of somatic tissues) rather than comparing two physiological populations of a given cellular model. Testis was purposely not represented among the subtractive tissues so that ESTs specific to germ cells of both sexes would not be excluded from our library. This subset of genes would thus be germ cell specific rather than oocyte specific. That germ cellspecific gene products are involved in processes common to both oogenesis and spermatogenesis, such as meiosis, whereas oocyte-specific gene products have a specific function in oogenesis (i.e., ZP genes) or play a role in sustaining early embryo development appears to be an attractive hypothesis. Some experimental data indeed support this hy-

pothesis. Here, we find that BTG4 and MCF2 are strongly expressed in bovine oocyte/ovary and testis. We have not investigated the site of expression of these genes within the testis, but it is tempting to speculate that the transcripts are preferentially found in germ cells. Based on the gene ontology vocabulary, both genes are involved in negative regulation of the cell cycle and cell-cycle arrest, two functions that conceivably are conserved in male and female germ cells. By contrast, we have shown previously that the bovine orthologous gene of Mater, a maternal effect gene in the mouse, was hardly, if at all, expressed in testis in cattle [9]. MATER transcripts also were undetectable in human testis [19], and no ESTs are represented in mouse testis libraries. The situation is not as clear for Zar1, another maternal effect gene. The transcript was not detected in mouse testis, whereas it was expressed in human testis [7]. Contradictory data have been published in the bovine [9, 11]. It cannot be excluded that genes supporting early embryonic development also may have a distinct role in male germ cells. Our library was further validated when we identified bo-

718

PENNETIER ET AL.

FIG. 3. Confirmation of oocyte overexpression by differential hybridization. Macroarrays were hybridized with amplified cDNA probes generated from either oocyte or somatic tissues (intestine, lung, muscle, and cumulus cells). On this artificially colored image, ESTs were overrepresented in oocyte and somatic tissues appear in red and green, respectively. Hybridization controls corresponding to pools of ubiquitous ESTs appear in yellow.

vine orthologous genes of murine or human genes referred to in UniGene as oocyte or embryo restricted. Among them, three cell-cycle regulators (BTG4, CUL1, and MCF2) were further analyzed by RT-PCR. Eight clones generating the most intense hybridization signals represented BTG4, suggesting an abundant transcript in the oocyte, which has been confirmed elsewhere [15]. The corresponding clustered sequence encode a partial open reading frame of 254 amino acids, which present 71% identity with the human complete coding sequence of 223 amino acids (data not shown). BTG4 belongs to the PC3/BTG/TOB family of cell-cycle inhibitors. In the mouse, its expression was restricted to olfactory epithelium, testis, and oocyte [20]. In the present study, we show that BTG4 also is highly expressed in bovine testis and ovary/oocyte, which suggests a role for BTG4 in meiosis, as mentioned earlier. The bovine transcript also is detected in uterus and lung and at trace levels in pituitary and brain. Another gene of interest isolated in our library was CUL1, member of ubiquitin ligase complexes that regulate the abundance of proteins involved in cell-cycle progression at the G1-S phase transition. Mouse Cul12/2 embryos showed an early embryonic lethality, and a deregulation of the cell cycle-regulator cy-

clin E was observed [21]. Human CUL1 was highly expressed in heart, skeletal muscle, and testis and at a lower level in various somatic tissues [22]. In the bovine, based on our RT-PCR experiments, CUL1 presented a more restricted expression profile. It appeared to be expressed preferentially in bovine oocyte and at a low level in testis and muscle, and it was barely detected in brain. The transcript was not amplified from other somatic tissues, including the heart. A third selected EST aligned with the gene encoding the X-linked proto-oncogene MCF2/DBL. Interestingly, Mcf2 was recently shown to display a cancer-testis/germ cell antigen (GCA) expression profile [23]. Members of the cancer testis family of antigens are encoded by genes expressed by cancers of diverse histological origin and, typically, are absent from normal adult tissues, with the exception of male germ cells. Using microarray screening for transcriptional profiling, Segal et al. [23] identified Mcf2 as a novel candidate GCA expressed by clear cell sarcoma/ melanoma of soft parts. Mcf2 expression in mouse is restricted to the gonads and brain, particularly tissues of neuroectodermal origin, with traces in intestine and kidney [24, 25]. These expression sites were confirmed in bovine, with a high expression in the brain, testis, and ovary and expression at trace levels in the intestine. Moreover, we detected MCF2 in spleen and uterus as well as at trace levels in muscle. The other five ESTs selected for experimental confirmation initially were novel sequences but recently have been found in bovine oocyte or embryo libraries. Four remain uncharacterized. The EST 8B9 represents locus 515535, which is similar to snail soma ferritin. Intriguingly, no other mammalian orthologue has been identified so far, although the Mm.26145 gene encoding a ferritin-like structure containing protein was recently isolated in a mouse oocyte-specific EST library [15]. The corresponding five genes displayed distinct patterns of tissue distribution. Four of them were, indeed, preferentially expressed in the oocyte or gonads. 5B4, 6D3, and 8D7 were strongly expressed in the oocyte and testis and were detected in the ovary, with trace levels found in a few somatic tissues. 8B9 was detected at high level in the oocyte and liver but was barely detectable in the testis. Quite surprisingly, this EST also was isolated in a library subtracted with liver cDNA [15]. In mouse, oocyte-secreted protein 1 (Oosp1) displays a similar high expression specifically in the liver and oocyte/

TABLE 3. EST analysed by RT-PCR. Clone (length) 2G12 (760 nt) 8C3 (347 nt) 4B3 (218 nt) 5B4 (566 nt) 6D3 (623 nt) 8D7 (225 nt) 8B9 (498 nt) 7F3 (148 nt) a

% Identity (length) 100 (313 100 (253 100 (150 98 (538 97 (583 99 (225 100 (493 100 (148

Bt, Bos taurus.

Expected value

Blast results species/definitiona

GenBank accession no.

e-177

Bt (predicted) similar to BTG4 protein (PC3b)

XMp598225

e-141

Bt (predicted) similar to SCF complex protein cul-1 (CUL1) Bt (predicted), similar to Proto-oncogene DBL/MCF2 (MCF2) Bt 705pbovine oocyte cDNA subtracted library

XMp589507

Bt UMC-bemivp0A01-026-b10 2-cell in vitro produced embryo cDNA 39 Bt UMC-bemivp0B01-014-d07 2-cell in vitro produced embryo cDNA 39 Bt (predicted) similar to snail soma ferritin

DN639678

nt) nt) 3e-90 nt) 0

XMp601577 CX123771

nt) 0 nt) e-119 nt) 0

CX952279 XMp593571

nt) 1e-78 nt)

Bt UMC-bemivp0B02-019-g05 2-cell in vitro produced embryo bemiv cDNA 39

CX953478

BOVINE OOCYTE-SPECIFIC GENES

719

FIG. 5. Expression pattern in bovine oocyte and preimplantation embryos. Developmental stage is indicated above each lane: immature oocytes (IO); in vitro-matured oocytes (MO); in vitro-cultured zygote (1C); 2-, 4-, and 5- to 8- cell embryos; morula (M); and expanded blastocyst (Bl). RTPCR was performed using corresponding specific primers described in Table 1. No PCR substrate is shown as negative control (2). ACTB is shown as positive controls.

FIG. 4. Expression pattern in bovine oocyte, somatic, and gonadal tissues by RT-PCR. Tissues are indicated above each lane: brain (Br), heart (He), pituitary (Pi), intestine (In), liver (Li), lung (Lu), muscle (Mu), spleen (Sp), uterus (Ut), testis (Te), ovary (Ov), and oocyte (Oo). No PCR substrate (2) as a negative control. A) Ethidium bromide staining of PCR-generated fragments electrophoresed onto agarose gel. ACTB is shown as a positive control. B) Southern blot hybridization.

ovary [26, 27]. This pattern suggests that the corresponding gene is repressed in male germ cells and might be involved in a female specific process in oocyte, follicle, or embryo development. However, the presence in testis of an alternatively spliced transcript cannot be ruled out. Finally, the EST 7F3 was ubiquitously detected. Considering the lower amount of substrate in the PCR reaction for the oocyte as compared to other tissues, the RT-PCR profile remains compatible with an overexpression in the oocyte. Only a quantitative approach could confirm or contradict this hypothesis. To further characterize these eight genes, we studied their expression pattern during in vitro preimplantation development. The transcripts were abundant in oocyte, readily detected until the 5- to 8-cell stage, and dramatically degraded by the morula stage (or the blastocyst stage for BTG4). A similar repression at the maternal-to-embryo transition of the bovine oocyte marker genes MATER, ZAR1, GDF9, BMP15, and NALP9 was previously observed [9–11]. Indeed, the vast majority of mouse oocytespecific genes were reported not to be activated at the time

of major zygotic genome activation [28]. Interestingly, the gene encoding the EST 7F3 also appeared to be silenced in morulae and blastocysts, although it had been detected ubiquitously in our panel of tissues (Fig. 4). We noticed that expression of CUL1 and the EST 7F3 reproducibly displayed a transient increase at the 2- to 4-cell and at the 4- to 5/8-cell transition, respectively. This remains to be confirmed using a quantitative method, such as real-time PCR. However, this would be consistent with data in the mouse showing transient expression of Cul1 at the 1-cell stage, before the major zygotic genome activation [29]. The bovine 4-cell embryo was shown to be transcriptionally active (for review, see [30]), but little is known about the genes that might be activated at such an early stage. ZAR1 was indicated to display such a transient activation [11]. It also was suggested that activating transcription factor 1 might be transcribed that early [31]. It remains to be seen whether a similar profile is observed in the in vivo-produced embryo, because embryo culture was reported to affect gene expression [32]. Altogether, the high level of expression of those eight transcripts in oocytes, contrasting with their degradation in morulae/blastocysts, suggests a specific role in the oocyte or during earlier stages of preimplantation development. Oocyte-specific genes have often proved to be essential for normal oocyte, follicle, and embryo development in the mouse. Further experiments are planned to characterize and identify the genes represented in our library. Beyond that, we will compare their expressions in various physiological situations to analyze their potential involvement in bovine oocyte quality. ACKNOWLEDGMENTS We thank Pascal Papillier, Gae¨l Rame´, and Patricia Solnais for technical assistance; Dr. Florence Guignot and Christine Perreau for help in oocyte/embryo collection; Dr. Franc¸ois Piumi for help in macroarray design and preparation; the Sigenae team for sequence analysis; and Dr. Philippe Monget and Se´bastien Dade´ for helpful discussions and critical reading of the manuscript.

720

PENNETIER ET AL.

REFERENCES 1. Soyal SM, Amleh A, Dean J. FIGa, a germ cell-specific transcription factor required for ovarian follicle formation. Development 2000; 127: 4645–4554. 2. Liang L, Soyal SM, Dean J. FIGa, a germ cell-specific transcription factor involved in the coordinate expression of the zona pellucida genes. Development 1997; 124:4939–4947. 3. Rankin T, Talbot P, Lee E, Dean J. Abnormal zonae pellucidae in mice lacking ZP1 result in early embryonic loss. Development 1999; 126: 3847–3855. 4. Rajkovic A, Pangas SA, Ballow D, Suzumori N, Matzuk MM. NOBOX deficiency disrupts early folliculogenesis and oocyte-specific gene expression. Science 2004; 305:1157–1159. 5. Su YQ, Wu X, O’brien MJ, Pendola FL, Denegre JN, Matzuk MM, Eppig JJ. Synergistic roles of BMP15 and GDF9 in the development and function of the oocyte-cumulus cell complex in mice: genetic evidence for an oocyte-granulosa cell regulatory loop. Dev Biol 2004; 276:64–73. 6. Tong ZB, Gold L, Pfeifer KE, Dorward H, Lee E, Bondy CA, Dean J, Nelson LM. Mater, a maternal effect gene required for early embryonic development in mice. Nat Genet 2000; 26:267–268. 7. Wu X, Viveiros MM, Eppig JJ, Bai Y, Fitzpatrick SL, Matzuk MM. Zygote arrest 1 (Zar1) is a novel maternal-effect gene critical for the oocyte-to-embryo transition. Nat Genet 2003; 33:187–191. 8. Payer B, Saitou M, Barton SC, Thresher R, Dixon JP, Zahn D, Colledge WH, Carlton MB, Nakano T, Surani MA. Stella is a maternal effect gene required for normal early development in mice. Curr Biol 2003; 13:2110–2117. 9. Pennetier S, Uzbekova S, Perreau C, Papillier P, Mermillod P, DalbiesTran R. Spatiotemporal expression of the germ cell marker genes MATER, ZAR1, GDF9, BMP15, and VASA in adult bovine tissues, oocytes, and preimplantation embryos. Biol Reprod 2004; 71:1359– 1366. 10. Sendai Y, Itoh T, Yamashita S, Hoshi H. Molecular cloning of a cDNA encoding a bovine growth differentiation factor-9 (GDF-9) and expression of GDF-9 in bovine ovarian oocytes and in vitro-produced embryos. Cloning 2001; 3:3–10. 11. Brevini TA, Cillo F, Colleoni S, Lazzari G, Galli C, Gandolfi F. Expression pattern of the maternal factor zygote arrest 1 (Zar1) in bovine tissues, oocytes, and embryos. Mol Reprod Dev 2004; 69:375–380. 12. Dade S, Callebaut I, Mermillod P, Monget P. Identification of a new expanding family of genes characterized by atypical LRR domains. Localization of a cluster preferentially expressed in oocyte. FEBS Lett 2003; 555:533–538. 13. Dade S, Callebaut I, Paillisson A, Bontoux M, Dalbies-Tran R, Monget P. In silico identification and structural features of six new genes similar to MATER specifically expressed in the oocyte. Biochem Biophys Res Commun 2004; 324:547–553. 14. Yao J, Ren X, Ireland JJ, Coussens PM, Smith TP, Smith GW. Generation of a bovine oocyte cDNA library and microarray: resources for identification of genes important for follicular development and early embryogenesis. Physiol Genomics 2004; 19:84–92. 15. Vallee M, Gravel C, Palin MF, Reghenas H, Stothard P, Wishart DS, Sirard MA. Identification of novel and known oocyte-specific genes using complementary DNA subtraction and microarray analysis in three different species. Biol Reprod published 2 March 2005; 10.1095/ biolreprod.104.037069. 16. Holm P, Shukri NN, Vajta G, Booth P, Bendixen C, Callesen H. De-

17.

18.

19. 20.

21.

22.

23.

24.

25.

26.

27.

28.

29. 30.

31.

32.

velopmental kinetics of the first cell cycles of bovine in vitro-produced embryos in relation to their in vitro viability and sex. Theriogenology 1998; 50:1285–1299. Kastrop PM, Hulshof SC, Bevers MM, Destree OH, Kruip TA. The effects of a-amanitin and cycloheximide on nuclear progression, protein synthesis, and phosphorylation during bovine oocyte maturation in vitro. Mol Reprod Dev 1991; 28:249–254. Revel F, Mermillod P, Peynot N, Renard JP, Heyman Y. Low developmental capacity of in vitro matured and fertilized oocytes from calves compared with that of cows. J Reprod Fertil 1995; 103:115– 120. Tong ZB, Bondy CA, Zhou J, Nelson LM. A human homologue of mouse Mater, a maternal effect gene essential for early embryonic development. Hum Reprod 2002; 17:903–911. Buanne P, Corrente G, Micheli L, Palena A, Lavia P, Spadafora C, Lakshmana MK, Rinaldi A, Banfi S, Quarto M, Bulfone A, Tirone F. Cloning of PC3B, a novel member of the PC3/BTG/TOB family of growth inhibitory genes, highly expressed in the olfactory epithelium. Genomics 2000; 68:253–263. Dealy MJ, Nguyen KV, Lo J, Gstaiger M, Krek W, Elson D, Arbeit J, Kipreos ET, Johnson RS. Loss of Cul1 results in early embryonic lethality and dysregulation of cyclin E. Nat Genet 1999; 23:245–248. Hori T, Osaka F, Chiba T, Miyamoto C, Okabayashi K, Shimbara N, Kato S, Tanaka K. Covalent modification of all members of human cullin family proteins by NEDD8. Oncogene 1999; 18:6829–6834. Segal NH, Blachere NE, Guevara-Patino JA, Gallardo HF, Shiu HY, Viale A, Antonescu CR, Wolchok JD, Houghton AN. Identification of cancer-testis genes expressed by melanoma and soft tissue sarcoma using bioinformatics. Cancer Immun 2005; 5:2. Galland F, Pirisi V, de Lapeyriere O, Birnbaum D. Restriction and complexity of Mcf2 proto-oncogene expression. Oncogene 1991; 6: 833–839. Komai K, Okayama R, Kitagawa M, Yagi H, Chihara K, Shiozawa S. Alternative splicing variants of the human DBL (MCF-2) protooncogene. Biochem Biophys Res Commun 2002; 299:455–458. Yan C, Pendola FL, Jacob R, Lau AL, Eppig JJ, Matzuk MM. Oosp1 encodes a novel mouse oocyte-secreted protein. Genesis 2001; 31: 105–110. Mano H, Nakatani S, Aoyagi R, Ishii R, Iwai Y, Shimoda N, Jincho Y, Hiura H, Hirose M, Mochizuki C, Yuri M, Hyock Im R, FunadaWada U, Wada M. IF3, a novel cell-differentiation factor, highly expressed in murine liver and ovary. Biochem Biophys Res Commun 2002; 297:323–328. Hamatani T, Carter MG, Sharov AA, Ko MS. Dynamics of global gene expression changes during mouse preimplantation development. Dev Cell 2004; 6:117–131. Zeng F, Baldwin DA, Schultz RM. Transcript profiling during preimplantation mouse development. Dev Biol 2004; 272:483–496. Memili E, First NL. Zygotic and embryonic gene expression in cow: a review of timing and mechanisms of early gene expression as compared with other species. Zygote 2000; 8:87–96. Vigneault C, McGraw S, Massicotte L, Sirard MA. Transcription factor expression patterns in bovine in vitro-derived embryos before maternal-zygotic transition. Biol Reprod 2004; 70:1701–1709. Wrenzycki C, Herrmann D, Keskintepe L, Martins A Jr, Sirisathien S, Brackett B, Niemann H. Effects of culture system and protein supplementation on mRNA expression in preimplantation bovine embryos. Hum Reprod 2001; 16:893–901.