The Auk 129(3):427−437, 2012 The American Ornithologists’ Union, 2012. Printed in USA.
GENETIC AND MORPHOLOGICAL DIVERGENCE AMONG COOPER’S HAWK (ACCIPITER COOPERII ) POPULATIONS BREEDING IN NORTH-CENTRAL AND WESTERN NORTH AMERICA Sarah A. Sonsthagen,1,9 Robert N. Rosenfield,2 John Bielefeldt,8 Robert K. Murphy,3 Andrew C. Stewart,4 William E. Stout,5 Timothy G. Driscoll,6 Michael A. Bozek,7 Brian L. Sloss,7 and Sandra L. Talbot1 1
Alaska Science Center, U.S. Geological Survey, 4210 University Drive, Anchorage, Alaska 99508, USA; 2 Department of Biology, University of Wisconsin, Stevens Point, Wisconsin 54481, USA; 3 Department of Biology, University Nebraska at Kearney, Kearney, Nebraska 68849, USA; 4 3932 Telegraph Bay Road, Victoria, British Columbia V8N 4H7, Canada; 5 W2364 Heather Street, Oconomowoc, Wisconsin 53066, USA; 6 Urban Raptor Research Project, Grand Forks, North Dakota 58201, USA; and 7 U.S. Geological Survey Wisconsin Cooperative Fishery Research Unit, College of Natural Resources, University of Wisconsin, Stevens Point, Wisconsin 54481, USA
Abstract.—Cooper’s Hawk (Accipiter cooperii) populations breeding in the northern portion of the species’ range exhibit variation in morphological traits that conforms to predictions based on differences in prey size, tree stand density, and migratory behavior. We examined genetic structure and gene flow and compared divergence at morphological traits (P ST) and genetic markers (FST) to elucidate mechanisms (selection or genetic drift) that promote morphological diversification among Cooper’s Hawk populations. Cooper’s Hawks appear to conform to the genetic pattern of an east–west divide. Populations in British Columbia are genetically differentiated from north-central populations (Wisconsin, Minnesota, and North Dakota; pairwise microsatellite FST = 0.031–0.050; mitochondrial DNA ΦST = 0.177–0.204), which suggests that Cooper’s Hawks were restricted to at least two Pleistocene glacial refugia. The strength of the Rocky Mountains–Great Plains area as a barrier to dispersal is further supported by restricted gene-flow rates between British Columbia and other sampled breeding populations. Divergence in morphological traits (P ST) was also observed across study areas, but with British Columbia and North Dakota differentiated from Wisconsin and Minnesota, a pattern not predicted on the basis of F ST and ΦST interpopulation estimates. Comparison of P ST and FST estimates suggests that heterogeneous selection may be acting on Cooper’s Hawks in the northern portion of their distribution, which is consistent with hypotheses that variation in prey mass and migratory behavior among populations may be influencing overall body size and wing chord. We were unable to distinguish between the effects of genetic drift and selection on tail length in the study populations. Received 26 July 2011, accepted 20 March 2012. Key words: gene flow, morphological divergence, population genetic structure, P ST/FST comparison.
Divergencia Genética y Morfológica entre Poblaciones de Accipiter cooperii que se Reproducen en el Centro-Norte y Occidente de Norte América Resumen.—Las poblaciones de Accipiter cooperii que se reproducen en la porción más septentrional de su rango de distribución exhiben variación en rasgos morfológicos que se ajusta a predicciones hechas con base en diferencias en el tamaño de las presas, la densidad de árboles y el comportamiento migratorio. Examinamos la estructura genética y el flujo genético y comparamos la divergencia en rasgos morfológicos (PST) y marcadores genéticos (FST) para elucidar mecanismos (selección natural o deriva genética) que promueven la diversificación morfológica entre poblaciones de A. cooperii. Esta especie parece presentar el patrón genético de una división orienteoccidente. Las poblaciones de Columbia Británica están genéticamente diferenciadas de las poblaciones norte-centrales (Wisconsin, Minnesota y Dakota del Norte; FST pareado de microsatélites = 0.031-0.050; ΦST ADN mitocondrial= 0.177–0.204), lo que sugiere que la especie estuvo restringida a, por lo menos, dos refugios glaciales en el Pleistoceno. La fuerza del área de las Grandes Planicies de las Montañas Rocosas como una barrera para la dispersión también se apoya por las tasas limitadas de flujo genético entre Columbia Británica 8 9
Deceased 21 October 2011. E-mail:
[email protected]
The Auk, Vol. 129, Number 3, pages 427−437. ISSN 0004-8038, electronic ISSN 1938-4254. 2012 by The American Ornithologists’ Union. All rights reserved. Please direct all requests for permission to photocopy or reproduce article content through the University of California Press’s Rights and Permissions website, http://www.ucpressjournals. com/reprintInfo.asp. DOI: 10.1525/auk.2012.11166
— 427 —
428
— S onsthagen
et al.
— Auk, Vol. 129
y otras poblaciones reproductivas muestreadas. A través de las áreas de estudio también se observó divergencia en rasgos morfológicos (PST), pero Columbia Británica y Dakota del Norte se diferenciaron de Wisconsin y Minnesota, un patrón no predicho con base en los estimados de FST y ΦST interpoblacionales. La comparación de los estimados de PST y FST sugiere que en la poción norte de la distribución de A. cooperii podría existir selección heterogénea, lo que sería consistente con la hipótesis de que la variación entre poblaciones en la masa de las presas y el comportamiento migratorio puede estar influenciando el tamaño corporal en general y la cuerda alar. No pudimos distinguir entre los efectos de deriva genética y la selección que actúan sobre la longitud de la cola en las poblaciones de estudio. Morphological variation is often observed in species with wide-ranging distributions or species that occupy a variety of habitats. Diversification of morphological traits among populations may result from spatial heterogeneity in selection or the stochastic process of genetic drift (Merilä and Crnokrak 2001). Although both evolutionary processes may lead to geographic variation in morphology, their influence on the distribution of neutral genetic variation may differ. Diversifying selection can act rapidly on a trait or suite of traits, and, therefore, corresponding differentiation at neutral genetic markers may not be observed (i.e., incomplete lineage sorting). On the other hand, differentiation driven by long-term genetic drift rather than recent selection on a suite of morphological characters might result in neutral genetic subdivision among populations. Therefore, the characterization of variation at neutral genetic markers and morphological characters among populations may help to disentangle the relative roles of selection and drift in shaping phenotypic variation (Merilä 1997, Merilä and Crnokrak 2001, Storz 2002, Sæther et al. 2007, Leinonen et al. 2008). Distinguishing between the influences of selection and genetic drift in the diversification of traits is difficult and ideally involves detailed experimental designs (i.e., common garden experiments) to gain insight on the underpinnings of diversification of a character (Whitlock 2008, Brommer 2011). Such experiments are difficult to carry out in a natural vertebrate population. The comparison of morphological and neutral genetic differentiation among populations provides an avenue to determine whether (1) specific traits are under diversifying selection or (2) observed deviations result from the stochastic evolutionary force of genetic drift (Whitlock 2008, Brommer 2011). Spitze (1993) developed a measure of quantitative variation (Q ST) among populations as an analog to Wright’s (1951) measure of genetic variation (FST) among populations. Comparison of Q ST estimates of a trait or suite of traits to FST estimates from a set of presumably neutral loci can provide insight on whether selection (diversifying or stabilizing) may be acting on individuals at the population level and a starting point to identify characters potentially under selection (e.g., Merilä 1997, Merilä and Crnokrak 2001, Storz 2002, Sæther et al. 2007, Leinonen et al. 2008). Size and shape of morphological traits of various birds are influenced by behavioral (foraging and migratory) characteristics and habitat (Wattel 1973, Andersson and Norberg 1981, Whaley and White 1994, Milá et al. 2009). Body size varies directly with prey size; larger birds take larger prey. Prey agility has also been argued to influence body size, such that smaller body mass is associated with smaller agile (avian) prey (Andersson and Norberg 1981). Longer wings provide more efficient flight (Kerlinger 1989); accordingly, migratory populations within species typically have longer wings than resident populations (Wattel 1973, Winkler and Leisler 1992). Conversely, shorter wings and longer tails are hypothesized to allow for better maneuverability of birds
that maneuver in dense forested habitats (Wattel 1973, Milá et al. 2009). Variation in morphological characteristics among Cooper’s Hawk (Accipiter cooperii) populations at the northern portion of their distribution appears to conform to predictions based on differences in prey size, tree stand density, and migratory behavior (Rosenfield et al. 2010). Specifically, smaller hawks of British Columbia and North Dakota take smaller prey (25–80 g birds; Peterson and Murphy 1992, Rosenfield et al. 2010) than larger Minnesota and Wisconsin hawks (80–100 g birds and Eastern Chipmunk [Tamias striatus], respectively; Bielefeldt et al. 1992, Rosenfield et al. 2010; Fig. 1). Differences in tail length observed among study sites appeared to vary with tree stand density; hawks that reside in the denser forest stands of British Columbia and Wisconsin have longer tails than those in the sparse woodlands surrounded by prairie grassland of North Dakota and western Minnesota (Rosenfield et al. 2010). In addition, Cooper’s Hawk populations that exhibited some migratory tendency had significantly longer wings than resident birds in British Columbia (Rosenfield et al. 2010). Therefore, heterogeneous selection based on habitat and foraging and migratory behavior may underlie variation in morphological characteristics observed among Cooper’s Hawk populations. However, morphological differences observed among local populations may also arise by isolation and subsequent genetic drift.
Fig. 1. Location of Cooper’s Hawk populations breeding in the northern portion of their distribution, in British Columbia (BC), northwestern North Dakota (ND), eastern North Dakota–western Minnesota (MN), and Wisconsin (WI). The dashed line indicates the northernmost boundary of the breeding range.
July 2012
— Cooper’s Hawk Population Structure —
Mechanisms that affect gene flow among populations may be behavioral or geographic. For example, species that are highly philopatric often exhibit fine-scale genetic structure (e.g., Sonsthagen et al. 2009), whereas species that disperse long distances may have limited or no genetic structure (e.g., Pearce et al. 2004). Geographic barriers to dispersal, such as mountain ranges (e.g., Hull and Girman 2005) or ice sheets (e.g., Kelly and Hutto 2005, Colbeck et al. 2008), can also influence the extent of genetic structure among populations. Both the Rocky Mountains and Pleistocene ice sheets likely influenced the distribution of Cooper’s Hawks breeding at the northern portion of their range. British Columbia, Minnesota, Wisconsin, and North Dakota were at the southern limit of the Cordilleran and Laurentide ice sheets (Clague et al. 1980, Clark 1992). However, portions of British Columbia and western North Dakota were ice free during the Wisconsin glacial (Warner et al. 1982, Clark 1992). In addition, Cooper’s Hawks exhibit restricted dispersal because males and, to a lesser extent, females are highly philopatric (Rosenfield and Bielefeldt 1996, Stout et al. 2007, A. Stewart unpubl. data). Although morphological variation of Cooper’s Hawks appears to be correlated with heterogeneous selection, restricted dispersal (behavioral, geographic, or both) could also promote the maintenance of morphological variation among sites. Therefore, morphological differences may also result from the stochastic evolutionary process of genetic drift rather than variation in selection across the landscape. We used allelic and haplotypic frequency data coupled with Bayesian and coalescent-based analyses to assess population genetic structure of breeding Cooper’s Hawks and to examine hypotheses associated with the morphological diversification among populations. Specifically, we aimed to assess whether genetic drift following isolation or selection is the more likely explanation for the observed patterns of genetic and morphological variation among populations. M ethods Field techniques.—Study sites, trapping techniques, and morphological measurements are described in detail in Rosenfield et al. (2010). Briefly, adult (≥2 years old) breeding Cooper’s Hawks (n = 341 males, n = 173 females) were trapped at nest sites within four study areas in the northern portion of their distribution from 1999 to 2007 (east to west): Stevens Point, Wisconsin (n = 69 males, n = 58 females); western Minnesota–eastern North Dakota, hereafter “Minnesota” (n = 25 males, n = 31 females); northwestern North Dakota, hereafter “North Dakota” (n = 42 males, n = 38 females); and Victoria, British Columbia (n = 53 males, n = 46 females) (Fig. 1). Morphological characters (mass, wing chord, and tail length) were measured for each individual by the same field personnel (R.N.R. and L. J. Rosenfield). Blood samples (n = 106) were collected from a subset of the individuals (Wisconsin [n = 39], Minnesota [n = 13], North Dakota [n = 20], and British Columbia [n = 34]) and stored in buffer (Longmire et al. 1988). Laboratory techniques.—DNA was extracted using m ethods described in Sonsthagen et al. (2004). Nine polymorphic loci with dinucleotide repeat motifs were selected for analysis: Aa11 (MartínezCruz et al. 2002), BV13, BV20 (Gautschi et al. 2000), AgCA222, AgCA224 (Takaki et al. 2009), Age7 (Topinka and May 2004), NVH195, NVH203, and NVH206 (Nesje and Røed 2000). Primers for loci Aa11 (F: 5′–GCTGCCTCATAAAACTAATAGC–3′) and Age7 (R: 5′–GTACTGGTAGTATGTTCTTGCTC–3′) were
429
redesigned for the present study. Polymerase chain reaction (PCR) amplification and electrophoresis followed protocols described in Sonsthagen et al. (2004). Ten percent of the samples were amplified and genotyped in duplicate for the nine microsatellite loci for quality control. We amplified a 419-base-pair portion of domains I and II of the mitochondrial DNA (mtDNA) control region using primer pairs COHA L15219 (5′–CATCATATTCAACTCATGG–3′) and H15426 (Sonsthagen et al. 2004). The PCR amplifications, cycle-sequencing protocols, and post-sequencing processing followed Sonsthagen et al. (2004). ExoSAP-IT (USB Corporation, Cleveland, Ohio) was used to remove excess primers and dNTPs in PCR products. For quality-control purposes, 10% of the individuals were amplified and sequenced in duplicate. Sequences are archived in GenBank (accession nos. JQ894324–JQ894336). Analysis of genetic diversity.—We calculated allelic richness, inbreeding coefficient (FIS), observed and expected heterozygosities, Hardy-Weinberg equilibrium (HWE), and linkage disequilibrium in FSTAT, version 2.9.3 (Goudet 1995). We used ARLEQUIN, version 2.0 (Schneider et al. 2000), to estimate haplotype (h) and nucleotide (π) diversity at the mtDNA control region. We tested the hypothesis of selective neutrality for mtDNA control-region sequence data using Fu’s FS (Fu 1997) and Tajima’s D (Tajima 1989), implemented in ARLEQUIN. An unrooted haplotype network for mtDNA control region was constructed in NETWORK, version 4.510 (Fluxus Technology, Clare, United Kingdom), using the reduced median method (Bandelt et al. 1995), to illustrate possible reticulations in the gene tree because of homoplasy. Analysis of population genetic subdivision.—Population genetic differentiation (overall and pairwise FST and RST for microsatellite loci and FST and ΦST for mtDNA locus) among breeding Cooper’s Hawk populations was calculated in ARLEQUIN, adjusting for multiple comparisons using Bonferroni correction (α = 0.05). Ninety-five percent confidence limits for microsatellite FST estimates were calculated in FSTAT. Pairwise ΦST was calculated using a Tamura-Nei nucleotide substitution model with an invariant site parameter (Tamura and Nei 1993) as determined using MODELTEST (Posada and Crandall 1998). Because the upper possible FST value for a set of microsatellite loci is usually FST, the trait(s) that P ST was calculated from has diversified more than expected on the basis of genetic drift alone; P ST < FST, the trait(s) are under stabilizing selection that maintained the same value across the landscape in spite of
et al.
— Auk, Vol. 129
genetic drift; and P ST = FST, genetic drift cannot be ruled out as a driving force in diversification. PST variance measures were calculated using a two-way analysis of variance on PC1 scores, as well as the morphological traits individually, following Storz (2002). It is important to note that body mass of breeding adult Cooper’s Hawks varies negligibly (
