(Hybond. N, Amersham. International plc, Amersham,. United Kingdom). The full-length hu- man muscle phosphofructokinase. cDNA and exon 4 of the human P-.
THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1990 by The American Society for Biochemistry
Genetic
Defect
Vol. 265, No. 16, Issue of June 5, pp. 9392-9395, 1990 Printed in U.S.A
and Molecular Biology, Inc.
in Muscle
Phosphofructokinase
ABNORMAL SPLICING OF THE MUSCLE PHOSPHOFRUCTOKINASE POINT MUTATION AT THE 5’-SPLICE SITE*
Deficiency GENE
DUE TO A
(Received for publication, Hiromu NakajimaS, Masamichi Kuwajima,
Norio Kono, Tomoyuki Yamasaki, Kikuko Hotta, Masanori Tamio Noguchis, Takehiko Tanaka& and Seiichiro Tarui
From the Second Department of Internal Medicine, Osaka University 553 and the SDepartment of Nutrition and Physiological Chemistry, Kita-ku, Osaka 530, Japan
Kawachi,
1-I-50 Fukushima, Fukushima-ku, Medical School, 4-3-57 Nakanoshima,
Osaka
uricemia (9). Recently, partial cDNA cloning of human muscle phosphofructokinase (lo), its full-length cDNA sequence (ll), the expression of the full-length cDNA in mammalian cells (12), and the partial genomic sequence (13) have been reported. But there are no reports of studies on the genetic defect in patients with hereditary phosphofructokinase deliciency. In this paper, we describe the identification of the genetic defect in a patient with Tarui disease by cDNA cloning and gene amplification. MATERIALS
AND METHODS
Source of Human Materials-A muscle biopsy specimen was obtained from a male patient (T. K.) with typical Tarui disease. His parents were first cousins, and three of the five siblings, including this patient, were affected. The detailed clinical features and definite diagnosis of the enzyme defect in this patient have already been described in the first case report (5) of this disease, in which this patient was case 2. Normal muscle was obtained during surgical operation as reported previously (11). Informed consent to participate in the study was obtained from the patient, and the research was carried out in conformity with the declaration of Helsinki. Genomic DNAs of the patient and a normal subject were prepared from
peripheral blood lymphocytes by a standard protocol (14). Phosphofructokinase (ATP:D - fructose - 6 - phosphate 1 phosphotransferase, EC 2.7.1.11) is a tetrameric enzyme that plays a key role in the glycolytic pathway. There are three isozymes of phosphofructokinase, known as the muscle, platelet, and liver types. The platelet-type isozyme is also called the fibroblast type (1). The genes for the muscle, platelet (fibroblast), and liver types have been assigned on chromosomes 1, 10, and 21, respectively (2-4). Hereditary phosphofructokinase deficiency in muscle (5) is classified as type VII glycogenosis and is also called Tarui disease (6). This disease has several heterogeneous symptoms (7), but typical clinical manifestations are intolerance to muscular exercise (5), increased hemolysis (5, 8), and hyper* This work was supported by a basic research grant from Muscular Dystrophy Association of the United States, grants from the Uehara Memorial Foundation and the Yamanouchi Foundation for Research on Metabolic Disorders, a grant-in-aid for scientific research and a grant-in-aid for research on priority areas from the Ministry of Education, Science, and Culture of Japan, and a grant-in-aid from the Ministry of Health and Welfare of Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. $ To whom correspondence should be addressed: Second Dept. of Internal Medicine, Osaka University Medical School, l-l-50 Fukushima, Fukushima-ku, Osaka 553, Japan. 9392
Construction of Full-length cDNA for Human Muscle Phosphofructokinase-The three overlapping cDNA clones for human muscle phosphofructokinase reported previously (11) were suitably digested with restriction enzymes and ligated to obtain a full-length cDNA. The ligated cDNA was introduced into the BamHI site of pUC119 and was sequenced to confirm that it was ligated correctly. Northern Analysis-Poly(A’) RNA was prepared from the muscle as described (14). Poly(A’) RNA (-1 pg) from the patient’s muscle was fractionated through formaldehyde-agarose (0.8%) denaturing gel and transferred to a nylon membrane (Hybond N, Amersham International plc, Amersham, United Kingdom). The full-length human muscle phosphofructokinase cDNA and exon 4 of the human Pactin gene (15) (purchased from Nippon Gene, Toyama, Japan) were labeled with [a-‘*P]dATP by the random primer technique (16). The filter was hybridized with the phosphofructokinase cDNA, washed, and autoradiographed and then was reprobed with the @-actin probe to compare the amount of phosphofructokinase mRNA with that of a normal control. Hybridization, washing, and reprobing procedures were carried out according to the manufacturer’s recommendations. Cloning of Patient’s cDNAs-Poly(A+) RNA (1 rg) from the patient’s muscle was primed with oligo(dT)1Zm18, and the double-stranded cDNA was synthesized by the method of Gubler and Hoffman (17). A cDNA library was constructed using XgtlO arms as described (18). Clones (-1 x 106) were plated without amplification and screened with the full-length cDNA probe. After plaque purification, six clones were isolated and subcloned into the EcoRI site of pUC119 or pBluescript SKII( Sequence analysis from both ends of the clones using forward and reverse universal Ml3 primers revealed that three clones possessed the entire coding sequence. One of them contained the full-length sequence from the 5’-untranslated region to a poly(A’) tract. These clones were sequenced extensively by making nested
Downloaded from www.jbc.org by guest, on July 10, 2011
The genetic defect in muscle phosphofructokinase deficiency (type VII glycogenosis, Tarui disease) was investigated. Six cDNAs for muscle phosphofructokinase, including a full-length clone, were isolated from a non-amplified library of muscle from a patient. By sequence analysis of these clones, a 75-base in-frame deletion was identified. The rest of the sequence was identical to that of the normal cDNA, except for a silent base transition at position 516 (ACT (Thr) to ACC (Thr)). The deletion was located in the 3’-terminal region of exon 13 (numbered with reference to the rabbit muscle phosphofructokinase gene (Lee, C.-P., Kao, M.-C., French, B. A., Putney, S. D., and Chang, S. Il. (1987) J. Biol Chem. 262, 4195-4199)). Genomic DNA of the patient was amplified by polymerase chain reaction. Sequence analysis of the amplified DNA revealed a point mutation from G to T at the 5’end of intron 13. This mutation changed the normal 5’-splice site of CAG:GTATGG to CAG:zTATGG. A cryptic splice site of ACT:GTGAGG located ‘75 bases upstream from the normal splice site was recognized and spliced in the patient.
Medical School, Osaka University
November 13, 1989)
Genetic Defect in Tarui Disease
9393
unidirectional deletion mutants by controlled exonuclease III digestion as described (19). Nucleotide sequences were determined by the dideoxy chain termination technique of Sanger et al. (20) with modified T7 DNA polymerase (Sequenase, United States Biochemical Corp., Cleveland, OH). Polymerase Chain Reaction (PCR)’ (21)-A set of 30-mers flanking the deletion site (5’-primer: 5’- AGT.GGT.TCG.CAC.ACA.GTG. GCT.GTG.ATG.AAC3’; 3’-primer: 5’CAA.GTT.TAG.AGC.CAC. CTT.GGC.CAG.TCC.AGC-3’) were svnthesized in a DNA svnthesizer (Model 381A, Applied Biosystems, Inc., Foster City, CA”). The primer sites were selected so as to be located within exons 13 and 14, numbered with reference to the rabbit muscle phosphofructokinase gene (22). Amplification was performed with 1 pg of genomic DNA and 2.5 units of Taq DNA polymerase (AmpliTaq, Perkin-Elmer/ Cetus, Norwalk, CT). Reaction conditions were essentially as recommended by the manufacturer. Amplification was performed by 25 cycles of denaturation, annealing, and polymerization at 94, 60, and 72 “C, respectively, as reported (23). Amplified DNA fragments were isolated after separation by polyacrylamide gel electrophoresis and subcloned into the HincII site of pUC119. They were sequenced using universal Ml3 and PCR primers. Multiple subclones were sequenced to overcome the possible statistical errors observed during polymerization with Taq DNA polymerase (24). Nomenclature of Exon and Intron Numbers-Recently, the existhuman muscle phosphofructokinase cDNA was identified by analysis of the partial sequenceof the human muscle phosphofructokinase gene (13). Its presence suggests that there is an extra noncoding exon
upstream of the “first” exon, as reported in the rabbit musclephosphofructokinasegene (22). However, the exon and intron numbers of the original rabbit gene are tentatively applied to the human gene throughout this paper since the transcription initiation site and the promoter sequence of the gene have not yet been determined. RESULTS
We examined the mode of expression of muscle phosphofructokinase mRNA in the patient’s muscle by Northern analysis. The amount and apparent size of mRNA from the patient’s muscle were not appreciably different from those from control muscle (data not shown). Next we cloned cDNAs of the patient’s muscle phosphofructokinase and sequenced six independent clones. Taking the first adenine of the ATG initiation codon as position 1, we identified a silent base transition at position 516 (from ACT (Thr) to ACC (Thr)) and a 75base in-frame deletion from positions 1267 to 1341 (Fig. 1). The rest of the sequence was identical to that of the normal cDNA (11). Since the deletion was located in mRNA corresponding to the 3’-terminal region of exon 13 of the rabbit muscle phosphofructokinase gene (22), the genomic sequence was determined by amplifying the relevant region by PCR. Gene amplification gave amplified products of the same size (-650 bp) from normal genomic DNA and from that of the patient, as evidenced by agarose gel electrophoresis of aliquots of the products. These products were introduced into the HincII site of pUC119 and sequenced using forward and reverse universal Ml3 and PCR primers. Sequence analysis of the subclones revealed that they had 150 bp of a coding sequence, a 438-bp intron, and 61 bp of a coding sequence. These sequences corresponded to exon 13, intron 13, and the 5’-part of exon 14, respectively, of the rabbit muscle phosphofructokinase gene (22). The boundaries between exon 13, intron 13, and exon 14 were found to be the same in the human and rabbit genes, except that the intron was longer in the human gene than in the rabbit gene (279 bp). A single base transition from G to T at the first base of the 5’-splice site of intron 13 was identified in all the subclones of the patient’s DNA sequenced (Fig. 2). The normal splice site of CAG:GTATGG was changed ’ The abbreviations base pair(s).
used are: PCR,
polymerase
chain
reaction;
bp,
*
e
-
AGCT patient
AZCT
normal
FIG. 1. Abnormal cDNA sequence in patient with Tarui disease. Part of the nucleotide sequenceand the amino acidsequence (one-letter abbreviations) are shown beside the sequence ladders. The normal seauence (left). GGGGCAG/ATAGAG. is the iunction between exon’s 13 and i4:‘In the patient (right), the 75 bases GTGAGG. . . . GGGGCAG are deleted, and the upstream sequence, TCCACT, is directly connected in-frame to the downstream sequence, ATAGAG.
by the transition to CAG:TTATGG in the patient’s DNA. The rest of the sequence was identical to that of the normal control. A cryptic 5’-splice site of ACT:GTGAGG, located 75 bases upstream from the normal splicesite, was used in the patient, resulting in a 75-base deletion in his mRNA (Fig. 3). DISCUSSION
Since the first report on muscle phosphofructokinase deliciency (5), -30 cases have been described (7). The mode of inheritance is autosomal and recessive. The heterogeneity in symptoms suggests that the genetic cause of this disease is not uniform. In this paper, the defect in one patient in the first family investigated was identified at the gene level. The base transition observed at position 516 in the patient’s cDNA has also been found in the sequence of normal cDNA independently cloned by Sharma et al. (12). This base transition, which does not affect the amino acid, would be irrelevant to the disease. Downstream from this site, a 75-base in-frame deletion from residues 1267 to 1341 was identified. This abnormal mRNA sequence would code for a protein containing a deletion of 25 residues. There are reports of the existence of materials cross-reacting with antibodies to muscle phos-
Downloaded from www.jbc.org by guest, on July 10, 2011
-=-
ence of a splicejunction within the 5’-untranslated region of the
9394
Genetic Defect in Tarui Disease
G GI- -
-,A-
-
\G-
AGCT
AGCT patient
normal
excm 13 AGTGGTTCGCACACAGTGGCTGTGATGAA~GTGGGGG CTCCGGCTGCAGGCATGAATGCT
RIGLIQGNRVLVVH CCTTATCCAGGGCAACCGAGTGCTCG'I-XTCCAT l tttt*ttt
DGPEGLAKGQ
JJ
~ATGGTTTCGAGGGCCTGGCCAAGGGGCA
(...GCCAAGGGCCAG
tcactacct............
438 bp
gtatggggectatctgggacctaggegcag gtatgg...) intron 13
. . . . . . . . . . . . . . ..cccacacaggcctcc exon
taGtgctttagccttgtgcagagctctgtggcttatcccc==~~ (...ctccggtccaacta~
14
ATAGAGGAAGCTGGC
ATTGAGGAAGCC...)
FIG. 3. Mutation in patient with Tarui disease. The sequence of the human muscle phosphofructokinase gene corresponding to exon 13, intron 13, and exon 14 is shown. Sequences of 5’- and 3’splice sites of the rabbit muscle phosphofructokinase gene (22) are also shown in parentheses. Lower-case letters indicate the nucleotide sequence of the intron. A single base transition from G to T at the first base of the 5’splice site is indicated by an arrow. The cryptic splice site used in the patient is indicated by asterisks.Primer regions for PCR are unclerlined. The deletion of 75 bases (25 amino acids, indicated by one-letter abbreviations) found in the patient cDNA is
boxed.
phofructokinase in extracts of muscle specimens from other patients (25-27). Studies are required to determine whether such abnormal protein is present in this case. Southern analysis of genomic DNA digested with EcoRI, BamHI, HindIII, and KpnI suggested the absence of restriction fragment length polymorphism in the patient.* Thus, it is very unlikely that there is any other major rearrangement of a genomic structure besides the point mutation at the 5’splice site identified in this study. Statistical errors, which ‘H. Nakajima, unpublished data.
N.
Kono,
T. Yamasaki,
K.
Hotta,
and
S. Tarui,
Downloaded from www.jbc.org by guest, on July 10, 2011
FIG. 2. Point mutation in patient with Tarui disease. The sequence of the muscle phosphofructokinase gene around the 5’splice site of intron 13 is shown. Subclones of gene amplification products were sequenced using the 5’-primer (see “Materials and Methods”) as a sequencing primer. Nucleotides are thus for the coding strand. Identical nucleotides in the normal gene (left) and in that of the patient (right) are hyphenated. The sequence CAG:GTATGG is the 5’-splice site of intron 13 in the normal gene. A transition from G to T changed the sequence to CAG:TTATGG in the patient, resulting in absence of splicing at this site.
are anticipated when Taq DNA polymerase is used for PCR (24), can be ruled out by the experimental results. Five independent subclones obtained after PCR were sequenced, and an equivocal point mutation was confirmed with no other base mismatch. Moreover, the point mutation identified fully explains the altered splicing found in the patient’s mRNA. Recently, abnormal splicing of the /3-hexosaminidase /3chain gene transcript in one case of the juvenile form of Sandhoff disease has been reported (28). In this case, a single base transition from G to A within an intron created a new 3’-splice site and resulted in the in-frame addition of a 24base intron sequence to the mRNA. The original 3’splice site was not altered, but essentially no normally spliced transcript was detected. In the consensus sequence of the 5’splice site ((C/A)AG:GT(A/G)AGT), the first 2 bases of the donor sequence are reported to be highly restricted to GT (29). For example, a nucleotide substitution of A for the first G completely abolished the splicing at this site in one case of @“thalassemia (30). In our case, the base transition was G to T, which also inactivated the normal 5’-splice site. On the other hand, cryptic splice sites are known to be activated by such substitutions (31). The sequence of the cryptic site used in the patient was ACT:GTGAGG instead of the normal splice site -.CAG*GTATGG - (consensus bases underlined). Candidates for the alternative splice site (GTNNNN; N represents any base) were surveyed within exon 13 and intron 13 in the genomic sequence. Among the possible splice sites within this region, the cryptic site used had the highest degree of homology to the consensus sequence of the 5’-splice site. In addition, the sequence of cDNA clones from the patient suggested that the possibility that the other sites were spliced was very small. Characterization of the abnormal gene product is crucial for understanding the normal physiological function of the enzyme protein as well as the pathophysiology of the disease with defective enzyme activity. Since mammalian phosphofructokinase is double the size of prokaryotic phosphofructokinase, gene duplication during evolution has been suggested (32). The primary structure of rabbit muscle phosphofructokinase shows internal homology, and the molecule can be considered to consist of homologous N- and C-terminal halfpeptides, linked by a so-called “connecting peptide.” Moreover, each half of the enzyme shows homology to prokaryotic phosphofructokinase (22, 32). If we assume that the mutant phosphofructokinase mRNA described here is translated, the 25 residues deleted would be located at positions 422-446. Data from crystallographic analysis of Bacillus stearothermophilus phosphofructokinase (33) and homology studies on rabbit muscle phosphofructokinase (32) indicate that this mutation would be within the C-terminal half-peptide, just downstream from the connecting peptide. In the tertiary structure of the rabbit enzyme, this area is considered to contribute in part to the allosteric sites of ADP/AMP activation and fructose 1,6-bisphosphate activation (32). One arginine residue (Arg423) in the active center of the ADP/ AMP activation site is lost by this deletion. Moreover, the mutation would also eliminate two stretches of a-helices and a short P-sheet structure. Both the destruction of the allosteric sites and the kinking of the helical structure would result in drastic configurational change, leading to loss of catalytic activity. The consequences of this mutation would be very profound. Confirmatory data at the protein level for these deductions are, however, not yet available. The fact that this patient is an offspring of consanguineous mating and our results support the idea of homozygosity of this patient. It is possible, however, that this case is a doubleheterozygote, carrying two different mutant alleles of muscle
Genetic Defect in Tarui Disease phosphofructokinase at the same time. Further analyses of the other members of this family are necessary to determine the genetic lesion of this trait definitely. Moreover, the heterogeneous symptoms in phosphofructokinase deficiency suggest that several independent types of mutation may be involved. Therefore, investigations are also required on the genetic abnormalities in patients in other nonrelated families. Recently, the in uitro expression of normal phosphofructokinase has been reported (12). The expressions of various mutant phosphofructokinases constructed through site-directed mutagenesis would be useful for analyzing not only the pathophysiology of the disease, but also the structure-function relationship of this enzyme. Acknowledgments-We are grateful to Dr. H. Fujimura for help in muscle biopsy and to Drs. T. Tamaki, N. Ogasawara, and H. Yoshikawa for advice. We also thank Drs. K. Imamura, M. Takenaka, and K. Yamada for helpful discussion. REFERENCES
10. Vora, S., Hong, F., and Olender, E. (1986) Biochem. Biophys. Res. Commun. 135,615-621 11. Nakajima, H., Noguchi, T., Yamasaki, T., Kono, N., Tanaka, T., and Tarui. S. (1987) FEBS Lett. 223, 113-116 12. Sharma, P.’ M., Reddy, G. R., Vora, .S., Babior, B. M., and McLachlan, A. (1989) Gene (Am&) ‘77, 177-183 13. Valdez, B. C., Chen, Z., Sosa, M. G., Younathan, E. S., and Chang, S. H. (1989) Gene (Amst.) 76, 167-169 14. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 15. Nakajima-Iijima, S., Hamada, H., Reddy, P., and Kakunaga, T. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 6133-6137 16. Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132, 6-13 17. Gubler, U., and Hoffman, B. J. (1983) Gene (Am&.) 25, 263-269 18. Huynh, T. V., Young, R. A., and Davis, R. W. (1985) in DNA Cloning: A Practical Approach (Glover, D. M., ed) Vol. 1, pp. 49-78, IRL Press, Oxford 19. Henikoff, S. (1987) Methods Enzymol. 155, 156-165 20. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467 21. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Science 239,487-491 22. Lee, C.-P., Kao, M.-C., French, B. A., Putney, S. D., and Chang, S. H. (1987) J. Biol. Chem. 262,4195-4199 23. Yamagata., K, Nakajima, H., Hanafusa, T., Noguchi, T., Miyazaki, A., Mivagawa, J., Sada, M., Amemiva, H., Tanaka, T., _Kono, N., and Tarui, S. (1989) Diabetologia 32, 762-764 24. Dunning, A. M., Talmud, P., and Humphries, S. E. (1988) Nucleic Acids Res. 16, 10393 25. Agamanolis, D. P., Askari, A. D., DiMauro, S., Hays, A., Kumar, K., Lipton, M., and Raynor, A. (1980) Muscle & Nerue 3,456467 26. Zanella, A., Mariani, M., Meola, G., Fagnani, G., and Sirchia, G. (1982) Am. J. Hematol. 12, 215-225 27. Tani, K., Fujii, H., Miwa, S., Imanaka, F., Kuramoto, A., and Ishikawa, H. (1983) Tohoku J. Exp. Med. 141, 287-293 28. Nakano, T., and Suzuki, K. (1989) J. Biol. Chem. 264, 51555158 29. Mount, S. M. (1982) Nucleic Acids Res. 10, 459-472 30. Treisman, R., Proudfoot, N. J., Shander, M., and Maniatis, T. (1982) Cell 29,903-911 31. Green, M. R. (1986) Annu. Rev. Genet. 20,671-708 32. Poorman, R. A., Randolph, A., Kemp, R. G., and Heinrikson, R. L. (1984) Nature 309. 467-469 33. Evans, P. k., Farrants, G. W., and Hudson, P. J. (1981) Philos. Trans. R. Sot. Land. B Biol. Sci. 293, 53-62
Downloaded from www.jbc.org by guest, on July 10, 2011
1. Kahn, A., Meienhofer, M.-C., Cottreau, D., Lagrange, J.-C., and Dreyfus, J.-C. (1979) Hum. Genet. 48,93-108 2. Vora, S., Durham, S., de Martinville, B., George, D. L., and Francke, U. (1982) Somatic Cell Genet. 8,95-104 3. Vora, S., Miranda, A. F., Hernandez, E., and Francke, U. (1983) Hum. Genet. 63,374-379 4. Van Keuren, M., Drabkin, H., Hart, I., Harker, D., Patterson, D., and Vora, S. (1986) Hum. Genet. 74,34-40 5. Tarui, S., Okuno, G., Ikura, Y., Tanaka, T., Suda, M., and Nishikawa, M. (1965) Biochem. Biophys. Res. Commun. 19, 517-523 6. Hers, H.-G., Van Hoof, F., and de Barsy, T. (1989) in The Metabolic Basis of Inherited Disease (Striver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., eds) 6th Ed., Vol. 1, pp. 425452, McGraw-Hill Book Co., New York 7. Rowland, L. P., DiMauro, S., and Layzer, R. B. (1986) in Myology: Basic and Clinical (Engel, A. G., and Banker, B. Q., eds) pp. 1603-1617, McGraw-Hill Book Co., New York 8. Shimizu, T., Kono, N., Kiyokawa, H., Yamada, Y., Hara, N., Mineo, I., Kawachi, M., Nakajima, H., Wang, Y. L., and Tarui, S. (1988) Blood 71, 1130-1134 9. Kono, N., Mineo, I., Shimizu, T., Hara, N., Yamada, Y., Nonaka, K., and Tarui, S. (1986) Neurology 36, 106-108
9395