Genistein Enhances Insulin-Like Growth Factor Signaling Pathway in ...

0021-972X/04/$15.00/0 Printed in U.S.A.

The Journal of Clinical Endocrinology & Metabolism 89(5):2351–2359 Copyright © 2004 by The Endocrine Society doi: 10.1210/jc.2003-032065

Genistein Enhances Insulin-Like Growth Factor Signaling Pathway in Human Breast Cancer (MCF-7) Cells WEN-FANG CHEN

AND

MAN-SAU WONG

Central Laboratory of the Institute of Molecular Technology for Drug Discovery and Synthesis (W.-F.C., M.-S.W.), Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hung Hom, Kowloon, Hong Kong Special Administrative Region, People’s Republic of China; and Department of Physiology (W.-F.C.), Medical College of Qingdao University, Qingdao 266021, People’s Republic of China Physiological concentration of genistein, a natural isoflavonoid phytoestrogen, stimulates human breast cancer (MCF-7) cells proliferation. In this study, we hypothesize that low concentration of genistein mimics the action of 17␤estradiol in stimulation of MCF-7 cell growth by enhancement of IGF-I signaling pathway. Genistein, at 1 ␮M, stimulated the growth of MCF-7 cells. Cell cycle analysis showed that 1 ␮M genistein significantly increased the S phase and decreased the G0G1 phase of MCF-7 cells. The protein and mRNA expression of IGF-I receptor (IGF-IR) and insulin receptor substrate (IRS)-1, but not Src homology/collagen protein, in-

G

ENSITEIN, AN ISOFLAVONE that is naturally found in soy product, can bind to estrogen receptors (ER) (1), affects estrogen-regulated gene expression (2), and displays both estrogen agonist and antagonist properties (3). Despite the favorable association found between soy product intakes and risk of breast cancer in epidemiological studies, conflicting data exist in experimental studies using soy isoflavones for prevention of human breast cancer (2–7). According to the previous reports, the effect of genistein on the growth of ER-positive human breast cancer (MCF-7) cells is biphasic. At a dose of 10 ␮m or above, genistein inhibits the growth and survival of MCF-7 cells, most likely by inhibiting the intrinsic tyrosine kinase activities of growth factor receptors (5, 7). However, at low concentration (0.01–1.0 ␮m), genistein appears to mimic the action of 17-␤-estradiol (E2) to stimulate cell proliferation through its interaction with ER and to induce E2-dependent gene expression (8, 9). In ovariectomized athymic mice implanted with MCF-7 cells, both genistein and soy protein stimulate tumor growth in a dosedependent fashion (2). Serum genistein and isoflavone levels increase in a dose-dependent manner in response to genistein administration in animals (10) and soy food consumption in humans (11); however, the plasma level of genistein is seldom over 1 ␮mol/liter, even in populations Abbreviations: AF, Activation function(s); E2, 17-␤-estradiol; ER, estrogen receptor(s); FBS, fetal bovine serum; GAPDH, glyceraldehyde3-phosphate dehydrogenase; IGF-IR, IGF-I receptor; IRS-1, insulin receptor substrate 1; MTT, 3-[4, 5-dimethylthiazol 2-yl]-2, 5-diphenyltetrazolium bromide; Shc, Src homology/collagen; TAM, tamoxifen. JCEM is published monthly by The Endocrine Society (http://www. endo-society.org), the foremost professional society serving the endocrine community.

creased in response to 1 ␮M genistein in a time-dependent manner. These effects could be completely abolished by cotreatment of MCF-7 cells with estrogen antagonist ICI 182,780 (1 ␮M) and tamoxifen (0.1 ␮M). Our results also showed that genistein induction of IGF-IR and IRS-1 expression resulted in enhanced tyrosine phosphorylation of IGF-IR and IRS-1 on IGF-I stimulation. Taken together, these data provide the first evidence that the IGF-IR pathway is involved in the proliferative effect of low-dose genistein in MCF-7 cells. (J Clin Endocrinol Metab 89: 2351–2359, 2004)

with high traditional soy food intake. Concern has arisen over a possible detrimental effect of soy consumption in breast cancer patients because of the estrogen-like effects of isoflavones. A high proportion of primary breast cancers contains ER and requires estrogenic activity for tumor growth. According to the classical model, estrogens carry out their action by binding to ER. Bound ER undergoes conformational change, interacts with chromatin, and modulates the transcription of target genes in estrogen-responsive tissues (12). However, there is accumulating evidence that cross-talk exists between ER and IGF-I receptor (IGF-IR)-mediated pathway in ERpositive breast cancer cells (13). Recent studies clearly indicated that, apart from the classical model, estrogen-stimulated mitogenesis in human breast cancer cells could also be mediated by the enhancement of IGF-I signaling pathway. The latter was supported by studies that demonstrated the up-regulation of IGF-IR (14) and insulin receptor substrate (IRS)-1 (15) expressions and the down-regulation of inhibitory IGF-binding protein expression (16) in MCF-7 cells on treatment with E2. The IGF signaling system exerts pleiotropic effects on mammalian cells (17). More recently, evidence has shown that IGFs play an important role in the regulation of breast cancer cell growth (18, 19). IGF-IR has been found to be significantly overexpressed and highly activated in cancer cells, with respect to its status in normal or benign breast tissues. The overexpression of IGF-IR has been linked with increased radioresistance and cancer recurrence at the primary site (20). Binding of IGFs to IGF-IR will trigger autophosphorylation, tyrosine phosphorylation of downstream signaling molecules, including IRS-1 and Src homology/

2351

2352

J Clin Endocrinol Metab, May 2004, 89(5):2351–2359

Chen and Wong • Genistein Enhances IGF-IR and IRS-1 in MCF-7 Cells

TABLE 1. Primers used for RT-PCR Product Primer

ER␣ IGF-IR IRS-1 GAPDH

Sequence

Orientation

Size (bp)

Tm

Cycles

AAGTTCAGGCACAATTGGATG CCCTGCATGACACTGATTACA ACTATGCCGGTGTCTGTGTG TGCAAGTTCTGGTTGTCGAG CTTCTGTCAGGTGTCCATCC CTCTGCAGCAATGCCTGTTC ACCACAGTCCATGCCTACAC TTCACCACCCTGTTGCTGTA

Sense Antisense Sense Antisense Sense Antisense Sense Antisense

502

50 C

23

522

60 C

30

311

60 C

30

452

55 C

20

Tm, Temperature.

collagen (Shc), and subsequent induction of growth factormediated signaling pathways (17). In MCF-7 cells, the mitogenic effects of IGF-I are primarily mediated by IRS-1 (21, 22). A high level of IRS-1 was found to be correlated with tumor size and shorter duration of disease-free survival in ER-positive tumors (15, 23). Thus, it appears that both IGF-IR and IRS-1 play critical roles in the control of breast cancer cell growth and development. Based on the above information, we hypothesized that IGF-IR-mediated pathway may also be involved in the proliferative effect of low concentration of genistein in MCF-7 breast cancer cells. In the present study, we investigated the molecular mechanisms involved in the proliferative effect of genistein in MCF-7 human breast cancer cells. Our results show that IGF-IR and IRS-1 expressions are increased on treatment with a low concentration of genistein in a timedependent manner, and these effects could be completely blocked by cotreatment with estrogen antagonists. Moreover, on genistein treatment, tyrosine phosphorylation of the IGF-IR and IRS-1 in response to IGF-I stimulation was enhanced in MCF-7 cells. These results indicate that the IGF signaling pathway is responsible, at least in part, for the growth-promoting effects of genistein in MCF-7 human breast cancer cells. Materials and Methods Culture of human breast cancer cell line (MCF-7) MCF-7 cells (ATCC no. HTB-22) were routinely cultured in DMEM supplemented with 5% fetal bovine serum (FBS), penicillin (100 IU/ml), and streptomycin (100 ␮g/ml) (Invitrogen, Carlsbad, CA) at 37 C in a humidified atmosphere of 95% air-5% CO2. Cells were transferred to phenol-red free DMEM supplemented with 1% charcoal-stripped FBS, penicillin (100 U/ml), and streptomycin (100 ␮g/ml) by standard methods of trypsinization, plated in six-well dishes for 5 d, and allowed to replicate to 80% confluence. Then, cells were treated with genistein (10⫺6 m) or 17␤-E2 (10⫺8 m) (Sigma, St. Louis, MO) for 6, 24, 48, and 72 h. The medium and test compounds were replenished at 24 h. For antiestrogen treatment, MCF-7 cells were exposed to genistein or E2 in the presence or absence of estrogen antagonist ICI 182,780 (10⫺6 m) (Tocris, Bristol, UK) or tamoxifen (TAM) (10⫺7 m) (Sigma) for 48 h.

Cell proliferative assays For growth study, MCF-7 cells were seeded in 96-well plates (3⫻103 cells/well) in phenol-red free DMEM supplemented with 1% charcoalstripped FBS for 4 d and then treated with genistein (10⫺6 m) or E2 (10⫺8 m) for 48 h. As an indirect measure of growth, the 3-[4, 5-dimethylthiazol 2-yl]-2, 5-diphenyltetrazolium bromide (MTT) assay was used as described previously (24). Briefly, the medium was removed and replaced with 100 ␮l tetrazolium (MTT, 5 mg/ml, Sigma) in PBS. The plates were incubated

FIG. 1. Effect of genistein on cell proliferation and cell cycle distribution in human breast cancer (MCF-7) cells. A, MCF-7 cells were cultured and treated with either 1 ␮M genistein (G) or 10 nM E2 (E) for 48 h, and then the cell number was determined by MTT assay. This result is representative of six independent experiments and is expressed as mean ⫾ SEM. **, P ⬍ 0.01 vs. control; ***, P ⬍ 0.001, n ⫽ 6. Genistein and E2 significantly increased the cell proliferation. B, MCF-7 cells were cultured and treated with either 1 ␮M genistein (G) or 10 nM E2 (E) for 24 h. Flow cytometric analysis of cell cycle distribution in MCF-7 cells was performed. Distribution of cells in different phases of cell cycle was determined using a software program Modfit (Becton Dickinson, Immunocytometry Systems). G0G1, Quiescent to gap1 phase; S, synthesis of DNA phase; G2M, gap2 to mitosis phase. Results were obtained from three independent experiments and are expressed as mean ⫾ SEM. *, P ⬍ 0.05 vs. control (C), n ⫽ 3. Both genistein and E2 significantly increased the S phase and decreased the G0G1 phase. for 4 h at 37 C, followed by the addition of 100 ␮l lysis buffer (0.04 n HCl in propan-2-ol). The multiwell plates were shaken for 1 h, and the signals were detected by a microplate reader using a wavelength of 595 nm.

Flow cytometry MCF-7 cells were treated with genistein (10⫺6 m) or E2 (10⫺8 m) for 24 h, then cells were isolated into conical tubes, washed twice with PBS, and fixed in 70% ice-cold ethanol at ⫺20 C. For DNA analysis, cells were



2353

FIG. 2. Effect of genistein on the ER␣ protein and mRNA expression. MCF-7 cells were treated with either 1 ␮M genistein or 10 nM E2 for increasing periods of time (6, 24, 48, and 72 h). Protein and total RNA were isolated and subjected to Western blotting analysis of ER␣ and ␤-actin protein expression (A), as well as semiquantitative RTPCR analysis of ER␣ and GAPDH mRNA expression, respectively (B). The protein and mRNA expression levels of ER␣ were expressed as a ratio to the expression of ␤-actin and GAPDH, respectively. Graphic results shown are representative of three independent experiments and are expressed as mean ⫾ SEM (C and D). *, P ⬍ 0.05 vs. control, n ⫽ 3. Genistein significantly down-regulated ER␣ protein, but not mRNA, expression in a time-dependent manner, whereas E2 down-regulated both ER␣ protein and mRNA expression.

centrifuged and washed two times with PBS. DNA contents of the nuclei were determined by staining nuclear DNA with propidium iodide (Sigma, 50 ␮g/ml) solution containing 50 ␮g/ml ribonuclease A and incubated at 37 C in the dark for 30 min. The DNA content, as reflected by the fluorescence signal of propidium iodide, was measured by using a flow cytometer (Becton Dickinson, Immunocytometry Systems, Mountview CA). Distribution of cells in different phases of cell cycle was determined using the software program Modfit (Becton Dickinson, Immunocytometry Systems) (25).

RT-PCR for IGF-IR and IRS-1 expression Total RNA was isolated from cells by using Trizol reagent according to the standard protocol. Total RNA (2 ␮g) was used to generate cDNA in each sample using SuperScript II reverse transcriptase with oligo(deoxythymine) 12–18 primers (Invitrogen). Aliquots (5–10%) of total cDNA were amplified in each PCR mixture that contains 0.5 ␮m of sense and antisense primers (Genemed Synthesis, Inc. South San Francisco, CA) of selected genes (Table 1). PCR amplification was performed on a GeneAmp 9600 PCR system (Perkin-Elmer, Foster City, CA). The optimal PCR cycles for each gene product were determined to ensure that the PCR products were obtained within the linear logarithmic phase of each amplification curve. Samples were first denatured at 95 C for 4 min, amplified for optimized cycles, and finally extended at 72 C for 7 min. Each cycle consisted of 95 C for 45 sec, different melting temperature for 1 min (Table 1), and 72 C for 1 min, 30 sec. The PCR products were analyzed on agarose gel electrophoresis. Optical densities of ethidium bromide-stained DNA bands were quantified by Luminal Imager (Roche Molecular Biochemicals, Mannheim, Germany), and the mRNA expression levels were normalized to the expression of a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Immunoblotting and immunoprecipitation For Western blot, protein was isolated from cells by using Trizol reagent according to the standard protocol. Protein concentrations were analyzed by the method of Bradford (Bio-Rad, Hercules, CA) (26). Equal amounts of cytosolic proteins (5 ␮g) were separated by SDS-PAGE on 10% reducing gels at a constant voltage (150 V) for 1 h, as previously described (27), and transblotted to polyvinylidene difluoride membranes (Immobilin-P, Millipore Corp., Bedford, MA). Immunoblotting was performed after blocking nonspecific binding on the membrane with 5%-powered milk. The blots were probed first with polyclonal

rabbit antihuman IGF-IR␤, IRS-1, Shc (1:2000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), ER␣ (1:3000; Sigma) or monoclonal mouse antihuman actin (C-2) (1:200; Santa Cruz Biotechnology, Inc.) as the primary antibody, followed by incubation with the goat antirabbit antibody conjugated with horseradish peroxidase (1:2000; Santa Cruz Biotechnology, Inc.) or with the goat antimouse antibody conjugated with horseradish peroxidase (1:1000; Upstate Biotechnology, Inc., Lake Placid, NY) for 1 h. Finally, the antigen-antibody complexes were detected using an enhanced chemiluminescence reagent (28) and visualized by the Lumi-Imager with the software Lumi Analyst version 3.10 (Roche). The level of ␤-actin protein expression was also detected and used as an internal control for equal loading for each blot. For immunoprecipitation, proteins were obtained by lysing the cells in Nonidet P-40 buffer (20 mm Tris-HCl, pH 7.5; 150 mm NaCl; 1 mm CaCl2; 1 mm MgCl2; 10% glycerol; 1% Nonidet P-40). The buffer was supplemented with protease inhibitors (2 ␮g/ml aprotinin, 2 ␮g/ml leupeptin, 1 mm phenylmethylsulfonylfluoride) and phosphatase inhibitors (1 mm sodium orthovanadate, 10 mm NaF). Lysates were centrifuged at 14,000 rpm for 30 min at 4 C, and then the protein concentrations were analyzed by the method of Bradford. To compare the level of phosphorylation of IGF-IR and IRS-1 among samples pretreated with or without genistein, limiting concentration of the corresponding antibodies was used in the immunoprecipitation to ensure similar levels of proteins were being immunoprecipitated in different samples. The immunoprecipitation was carried out as follow: 500 ␮g protein lysate was precipitated with 6.5 ␮g of the corresponding antibodies at 4 C on a rocker platform for 2 h, followed by the addition of 100 ␮l protein A Sepharose slurry and incubation for another 1.5 h at 4 C. After three sequential washes using Nonidet P-40 buffer, the resulting pellets were resuspended in electrophoresis sample buffer and boiled for 5 min and subsequently detected by Western blot with an antiphosphotyrosine monoclonal antibody (P-Tyr-100, 1:1000; Cell Signaling Technology, Hitchin, Herts, UK). After washing, immunoreactivity was detected with goat antimouse horseradish peroxidase-conjugated secondary antibody (1:1000) followed by enhanced chemiluminescence reagent.

Statistical analysis Data are reported as the mean ⫾ sem. Significance of differences between group means was determined by one-way ANOVA. P ⬍ 0.05 was considered statistically significant.

2354



FIG. 3. Western blot analysis of the expression of IGF-IR, IRS-1, and Shc in MCF-7 cells treated with 1 ␮M genistein. MCF-7 cells were cultured and treated with 1 ␮M genistein (A) or 10 nM E2 (B) for 6, 24, 48, and 72 h. Proteins were isolated and fractionated using 10% SDS-PAGE and immunoblotted with antibody against IGF-IR, IRS-1, and Shc. ␤-actin was used as a loading control. C and D, The graphical representation of IGF-IR and IRS-1 expression, respectively, after densitometry. E and F, The graphical representation of 52 and 46-kDa Shc isoform expression after densitometry. Results were obtained from three independent experiments and are expressed as mean ⫾ SEM. *, P ⬍ 0.05; **, P ⬍ 0.01 vs. control, n ⫽ 3. Genistein mimics estrogen in the up-regulation of IGF-IR and IRS-1 protein expression in a time-dependent manner.

Results Low concentration of genistein mimics the effect of E2 on cell proliferation and cell cycle kinetics

The proliferative effects of low concentration of genistein on human breast cancer (MCF-7) cells are shown in Fig. 1A. Treatment of MCF-7 cells with 1 ␮m genistein for 48 h resulted in a 1.2-fold increase in cell number (P ⬍ 0.01 vs. vehicle-treated cells). Similarly, treatment with 10 nm E2 also resulted in a 1.3-fold increase in cell number (P ⬍ 0.001 vs. vehicle-treated cells) in MCF-7 cells. The effects of low concentration of genistein on cell cycle in MCF-7 cells were determined using flow cytometry (Fig. 1B). Similar to the effect of 10 nm E2, treatment of MCF-7 cells with 1 ␮m genistein resulted in a significant increase in the proliferative phase (percentage S phase, P ⬍ 0.05, vs. vehicle-treated cells) and a significant decrease in the resting phase (G0/G1 phase, P ⬍ 0.05, vs. vehicle-treated cells) of the cell cycle. The results suggest that the mitogenic effect of genistein is accomplished by the stimulation of G1/S transition in hormone-dependent breast cancer cells.

Genistein decreases the ER␣ protein, but not mRNA, expression in MCF-7 cells

ER␣ plays a critical role in mediating the action of E2 as well as in the cross-talk and synergism between IGF-IR and ER signaling in MCF-7 cells. In this study, we determined whether a low concentration of genistein altered ER␣ protein and mRNA expression in MCF-7 cells. As reported by others (29), both genistein (1 ␮m) and E2 (10 nm) down-regulated ER␣ protein expression in a time-dependent fashion (Fig. 2A) (P ⬍ 0.05). In contrast, only E2 (10 nm), but not genistein (1 ␮m), down-regulated the expression of ER␣ mRNA expression (Fig. 2, B and D) (P ⬍ 0.05). It is apparent that genistein suppressed ER␣ protein expression, but not mRNA expression, in MCF-7 cells (Fig. 2, C and D), suggesting that it regulates ER␣ via a posttranscriptional mechanism. In contrast, E2 down-regulated both ER␣ protein and mRNA expression throughout the 72 h of treatment in MCF-7 cells (Fig. 2, C and D). The result indicates that different mechanisms are involved in the regulation of ER␣ by genistein and E2.


Genistein increases protein expression of IGF-IR and IRS-1, but not Shc, in MCF-7 cells

IGF-IR, IRS-1, and Shc are previously shown to be involved in the cross-talk between ER and IGF-IR signaling in human breast cancer cells (13–15). We therefore studied their expression in MCF-7 cells in response to treatment with 1 ␮m genistein for 6, 24, 48, and 72 h. Both genistein (Fig. 3A) and E2 (Fig. 3B) increased IGF-IR and IRS-1, but not Shc, protein levels in a time-dependent manner in MCF-7 cells. In response to genistein treatment, IGF-IR protein expression significantly increased, by 1.7-fold, at 24 h (Fig. 3C, P ⬍ 0.05), whereas IRS-1 protein expression increased by more than 2-fold (Fig. 3D, P ⬍ 0.05) at 48 h in MCF-7 cells. Their expressions remained elevated at 72 h of treatment with genistein. In the case of E2 (10 nm), the expression of IGF-IR and IRS-1 proteins were significantly increased, by 2-fold, in MCF-7 cells by 48 h of treatment (Fig. 3, C and D, P ⬍ 0.05); whereas, the expression of Shc proteins (46 and 52 kDa) (Fig. 3, E and F) in MCF-7 cells remained unchanged in response to treatment with 1 ␮m genistein or 10 nm E2. Thus, our results indicate that a low concentration of genistein mimics E2 in up-regulating the expression of IGF-IR and IRS-1 protein in MCF-7 cells. Genistein increases expression of IGF-IR and IRS-1 mRNA in MCF-7 cells

To determine whether genistein regulates expression of IGF-IR and IRS-1 transcriptionally, MCF-7 cells were treated with either genistein (1 ␮m) or E2 (10 nm) for 6, 24, 48, and 72 h. Total RNA was isolated, and mRNA expression was examined by RT-PCR. Both genistein (Fig. 4A) and E2 (Fig. 4B) induced mRNA expression of both IGF-IR and IRS-1 in a time-dependent manner. The mRNA expression levels of each gene were expressed as a ratio to the mRNA expression level of GAPDH to control for loading error. At 48 h, E2 and genistein increased IGF-IR mRNA expression in MCF-7 cells by 2.1- (P ⬍ 0.01) and 1.9-fold (P ⬍ 0.05) (Fig. 4C),

FIG. 4. RT-PCR analysis of IGF-IR and IRS-1 mRNA in MCF-7 cells. MCF-7 cells were cultured and treated with 1 ␮M genistein (A) or 10 nM E2 (B) for 6, 24, 48, and 72 h; and total RNA was isolated and subjected to semiquantitative RT-PCR analysis. C and D, The graphical representation of IGF-IR and IRS-1 mRNA expression after densitometry and correction for GAPDH. *, P ⬍ 0.05; **, P ⬍ 0.01 vs. control, n ⫽ 3. Both genistein and estrogen up-regulated IGF-IR and IRS-1 mRNA expression in a time-dependent manner.


2355

respectively; whereas the IRS-1 mRNA expression level was increased by 1.6- and 1.3-fold (P ⬍ 0.05) (Fig. 4D), respectively. The stimulatory actions of genistein on IGF-IR and IRS-1 expression require ER

To determine whether the observed effects of genistein on IGF-IR and IRS-1 depend on the activity of ER, MCF-7 cells treated with genistein were coincubated with or without E2 antagonist. We first used ICI 182,780, a pure ER antagonist, to block the stimulatory effects of genistein on IGF-IR protein and mRNA expression in MCF-7 cells. ICI 182,780 (1 ␮m) completely abolished the up-regulation of IGFR-IR by genistein (1 ␮m) and E2 (10 nm) at both protein (Fig. 5A) and mRNA (Fig. 5B) levels. Because ICI 182,780 was previously demonstrated to have direct effects on IGF-IR and IRS-1 expression (15, 30) (also see Refs. 35 and 43), we have used a second ER antagonist, TAM, to confirm the role of ER in our studies. Figure 5, C and D, clearly shows that TAM (0.1 ␮m) also completely abolished the effects of genistein (1 ␮m) and E2 (10 nm) on IGF-IR expression at both protein and mRNA levels. Similarly, the up-regulation of IRS-1 expression by genistein and E2 could be completely abolished in MCF-7 cells by cotreatment with either ICI (Fig. 6, A and B) or TAM (Fig. 6, C and D). Our result was similar to those reported by others (30), that ICI alone down-regulated IRS-1 protein (Fig. 6A) and mRNA (Fig. 6B) expression in MCF-7 cells. In contrast, the dosage of TAM used in our study did not result in a significant decrease of IRS-1 expression in MCF-7 cells to below its basal level but prevented the up-regulation of IRS-1 expression induced by genistein as well as E2 (Fig. 6, C and D). Genistein potentiates the effect of IGF-I on IGF-IR signaling cascade in MCF-7 cells

To further investigate the effects of genistein on IGF-IR signaling cascade, we assessed the responses of IGF-IR au-

2356



FIG. 5. Effect of ICI 182,780 and TAM on the regulation of IGF-IR expression by genistein or E2. MCF-7 cells were cultured and treated with 1 ␮M genistein or 10 nM E2 in the presence and absence of 1 ␮M ICI 182,780 (A and B) or 0.1 ␮M TAM (C and D) for 48 h. Proteins were isolated and fractionated using 10% SDS-PAGE and immunoblotted with antibody against IGF-IR and ␤-actin (A and C). Total RNA was isolated and subjected to RT-PCR analysis for IGF-IR mRNA (B and D). Results shown were obtained from three independent experiments. Columns with different letters are significantly different from one another (P ⬍ 0.05). Both ICI and TAM completely abolished the induction of IGF-IR protein and mRNA expression by genistein.

tophosphorylation, as well as tyrosine phosphorylation of IRS-1, in MCF-7 cells to IGF-I in the presence or absence of genistein. MCF-7 cells were stimulated with either IGF-I (5 min) or genistein (48 h) separately or sequentially (genistein for 48 h followed by IGF-I for 5 min). The levels of protein as well as tyrosine phosphorylation of both IGF-IR ␤-subunit and IRS-1 were then determined (Fig. 7). The results indicate that the basal tyrosine phosphorylation levels of IGF-IR and IRS-1 were low and undetectable in MCF-7 cells (Fig. 7, lane 1). Genistein alone did not cause an induction of tyrosine phosphorylation of both proteins (Fig. 7, lane 2). Treatment with IGF-I for 5 min alone resulted in an increase in the tyrosine phosphorylation level of IGF-IR (Fig. 7B, lane 3) and IRS-1 (Fig. 7D, lane 3). Most important, IGF-I stimulation of MCF-7 cells pretreated with genistein resulted in enhanced tyrosine phosphorylation of the IGF-IR (Fig. 7B, lane 4) and IRS-1 (Fig. 7D, lane 4). Fig. 7, A and C, indicated that the observed effects on tyrosine phosphorylation of IGF-IR and

IRS-1 was not due to unequal loading of proteins for immunoprecipitation as well as Western blotting (Fig. 7 A, and C). These results indicate that genistein not only stimulates IGF-IR and IRS-1 expression but also enhances IGF-IR autophosphorylation as well as tyrosine phosphorylation of downstream signaling protein, such as IRS-1, in MCF-7 cells. Discussion

The association between lower risk of breast cancer and consumption of soy products has led to the widespread interest in consumption of soy products, isoflavone supplements, and foods to which isoflavones have been added (31). Genistein, the major isoflavone isolated in soy, has demonstrated biphasic effects on the growth of ER-positive human breast cancer (MCF-7) cells, in which high concentration (⬎10 ␮m) inhibits (7, 32) and low concentration (0.01–1 ␮m) stimulates (8, 9) breast cancer cell proliferation. In two recent



2357

FIG. 6. Effect of ICI 182,780 and TAM on the regulation of IRS-1 expressions by genistein or E2. MCF-7 cells were cultured and treated with 1 ␮M genistein or 10 nM E2 in the presence and absence of 1 ␮M ICI 182,780 (A and B) or 0.1 ␮M TAM (C and D) for 48 h. Proteins were isolated and fractionated using 10% SDS-PAGE and immunoblotted with antibody against IRS-1 and the control actin (A and C). Total RNA was isolated and subjected to RT-PCR analysis for IRS-1 mRNA (B and D). Results shown were obtained from three independent experiments. Columns with different letters are significantly different from one another (P ⬍ 0.05). Both ICI and TAM completely abolished the induction of IRS-1 protein and mRNA expression by genistein.

studies that investigated the bioavailability of soy isoflavones among American women (33, 34), it was found that peak serum genistein concentration (0.5–2.2 ␮mol/liter) was attained at 4 – 8 h after ingestion (14 –105 mg genistein). In the present study, our results demonstrate that physiological concentration of genistein (1 ␮m) causes the induction of IGF-IR and IRS-1 expression in MCF-7 cells in a timedependent manner in a fashion similar to that of E2. Because the enhancement of IGF signaling in human breast cancer cells by E2 is implicated in the E2-mediated growth and development of breast cancer (14, 15, 19, 35), our results suggest that physiological concentration of genistein mimics the action of E2 and stimulates human breast cancer cell growth, possibly via its enhancement of cross-talk between IGF-IR and ER. Thus, caution is warranted for the consumption of soy products containing genistein among pre- and postmenopausal women who suffer from ER-positive breast cancer.

There is increasing evidence that E2 and IGF-I act together to stimulate proliferation in normal mammary epithelium and increase the risk of breast cancer (36). Studies clearly demonstrate the presence of independent, but interacting, mitogenic pathways in ER-positive breast cancer cells, including ER pathway and IGF-IR pathway (13). Ligand-binding ER␣, but not ER␤, can activate IGF-I signal transduction via a nongenomic effect mediated by direct interaction of ER␣ with the IGF-IR (37). In the present study, our data confirmed that both genistein and E2 had estrogenic activity by regulating the ER␣ expression. However, even though both of them suppressed ER␣ expression in MCF-7 cells, their actions in regulating ER␣ expression appears to be different. Genistein regulated ER␣ expression in MCF-7 cells posttranscriptionally; whereas E2 down-regulated ER␣ expression at the transcriptional level. The posttranscriptional regulation of ER␣ by genistein resulted in a transient suppression of ER␣ protein expression, because the level of ER␣ appears to return to basal level by 72 h of treatment

2358


FIG. 7. Effects of genistein on the phosphorylation of IGF-IR and IRS-1 in MCF-7 cells. MCF-7 cells were stimulated with IGF-I (50 ng/ml) for 5 min, genistein (1 ␮M) for 48 h, or with both agents. Cell lysates were immunoprecipitated with anti-IGF-IR (A and B) and anti-IRS-1 (C and D) antibodies. After SDS-PAGE, blots were incubated with anti-IGF-IR (A) and anti-IRS-1 (C) or antiphosphotyrosine of IGF-IR (B) and IRS-1 (D). IP, Immunoprecipitation; WB, Western blotting; PY, tyrosine phosphorylation. Results shown were obtained from two independent experiments. Genistein enhanced IGF-I stimulation of IGF-IR autophosphorylation as well as tyrosine phosphorylation of IRS-1.

(Fig. 2, A and B). In contrast, the transcriptional regulation of ER␣ by E2 appears to last longer and remained suppressed throughout the duration of treatment (Fig. 2, A and B). Despite the fact that both genistein and E2 down-regulated ER expression in a different mode of regulation in MCF-7 cells, our results indicated that ER was likely to be required for their stimulatory effects on IGF-IR and IRS-1 expression, because their actions could be completely abolished by cotreatment with ER antagonists, ICI 182,780 or TAM. The antiestrogens ICI 182,780 and TAM are clinically useful in the treatment of ERpositive breast tumors (38, 39). ERs activate transcription of target genes via two activation functions (AF): AF-1 (in the N-terminal domain) is ligand-independent and is regulated by phosphorylation in response to growth factors, whereas AF-2 is located within the C-terminal ligand-binding domain and depends on ligand binding for its transcriptional activity (40). ICI 182,780, as a pure antiestrogen (38), was recently shown to induce altered protein-protein interactions among ERs that might affect subsequent coactivator recruitment and thus provide a mechanistic basis for the full (AF-1 ⫹ AF-2) antagonist properties of the ICI compounds (41); whereas TAM, another estrogen antagonist, exerts its antiestrogenic activity by specific suppression of AF-2 transcriptional activity, in which H12 is being repositioned to block coactivator binding and promote corepressor recruitment (42). Our data demonstrated that both ICI and TAM can down-regulate the induction of IGF-IR and IRS-1 by genistein, suggesting that the AF-2 domain of ER is likely to be involved in mediating the action of genistein in MCF-7 cells. It should be noted that both ICI 182,780 and TAM could interfere with the IGF-I signaling system in breast cancer cells. ICI 182,780 was previously reported to down-regulate both IGF-IR and IRS-1 expressions in MCF-7 cells (15, 30, 35, 43). Although earlier studies reported that TAM inhibited IGF-IR expression in human breast cancer cells (44), recent


studies showed that TAM did not alter IGF-IR (45) and IRS-1 (35) expressions in MCF-7 cells. In the present study, our results indicated that treatment of MCF-7 cells with ICI 182,780 alone for 48 h resulted in a dramatic reduction in the level of IRS-1, but not IGF-IR, suggesting that the complete abolishment of the effects of genistein on these proteins might not be due to the antagonistic effects of ICI 182,780 on ER. In our studies, we intended to use a second ER antagonist, TAM, to resolve this possibility. Using a selected dosage of TAM (0.1 ␮m, 48 h), our results indicate that treatment of MCF-7 cells with TAM alone did not result in significant changes in the basal levels of both IRS-1 and IGF-IR. However, slight inhibitory effects of TAM on both IGF-IR and IRS-1 expression were still observed. These effects either could be due to the remnant levels of E2 present in the stripped serum used for culturing MCF-7 cells or could indicate that indeed TAM has modest inhibitory effects on these proteins. Future studies will be needed to clarify the detailed actions of TAM on the IGF-I axis in MCF-7 cells. Activation of the IGF system plays a critical role in the development and progression of human breast cancer (19). Activation of the IGF-IR regulates several cellular functions that can impact on the metastatic potential of the cells, including cellular proliferation, anchorage-independent growth, cell migration, and invasion (47). As reported by others (14, 15), E2 can sensitize MCF-7 cells to the mitogenic effect of IGF-I by up-regulating gene expression and protein levels of IGF-IR and IRS-1. The induction of IGF-IR and IRS-1 by E2 in MCF-7 cells results in enhanced tyrosine phosphorylation of IRS-1 as well as enhanced mitogen-activated protein kinase activation in response to IGF-I stimulation. Although previous studies by others (5, 7) indicated that high concentrations of genistein (⬎10 ␮m) inhibit MCF-7 cell growth by competing with ATP for binding to tyrosine kinase, our present study clearly demonstrates that low concentration of genistein potentiates the effects of IGF-I on IGF-IR autophosphorylation as well as tyrosine phosphorylation of IRS-1 in MCF-7 cells. Thus, our results suggest that low concentration of genistein promotes human breast cancer cell growth, not only by induction of IGF-IR and IRS-1 overexpression but also by the enhancement of the effects of IGF-I on IGF-IR signaling cascade. In conclusion, we have provided evidence that phytoestrogen genistein regulates IGF-IR and IRS-1 protein and mRNA expression in human breast cancer cells (MCF-7). The increase in expression of these key proteins in MCF-7 cells by genistein was accompanied by an enhancement of IGF-I-mediated signaling. These effects of genistein may play an important role in the proliferation of human breast cancer cells in a limited estrogen environment, similar to those found in the circulation of postmenopausal women. Thus, for the subgroup of postmenopausal women who are suffering from, or are at high risk of, developing breast cancer, consumption of pure isoflavone genistein or genistein-enriched food products is not an alternative means to estrogen-replacement therapy in treatment or prevention of postmenopausal symptoms. Acknowledgments Received December 2, 2003. Accepted February 11, 2004.


Address all correspondence and requests for reprints to: Dr. Man-Sau Wong, Central Laboratory of the Institute of Molecular Technology for Drug Discovery and Synthesis, Department of Applied Biology and Chemical Technology, The Hong Kong Polytechnic University, Hung Hom, Kowloon, Hong Kong Special Administrative Region, People’s Republic of China. E-mail: [email protected]. This work was supported by the Areas of Excellence Scheme established under the University Grants Committee of the Hong Kong Special Administrative Region, China (AOE/P-10/01), the Area of Strategic Development Grant of the Hong Kong Polytechnic University (A014), and the Central Allocation Grant from the Research Committee of the Hong Kong Polytechnic University (G-W105, G-YC81).

References 1. Makiewicz L, Garey J, Adlercreutz H, Gurpide E 1993 In vitro bioassays of non-steroidal phytoestrogens. J Steroid Biochem Mol Biol 45:399 – 405 2. Ju YH, Allred CD, Allred KF, Karko KL, Doerge DR, Helferich WG 2001 Physiological concentrations of dietary genistein dose-dependently stimulate growth of estrogen-dependent human breast cancer (MCF-7) tumors implanted in athymic nude mice. J Nutr 131:2957–2962 3. Zava DT, Duwe G 1997 Estrogenic and antiproliferative properties of genistein and other flavonoids in human breast cancer cells in vitro. Nutr Cancer 27:31– 40 4. Allred CD, Allred KF, Ju YH, Virant SM, Helferich WG 2001 Soy diets containing varying amounts of genistein stimulate growth of estrogen-dependent (MCF-7) tumors in a dose-dependent manner. Cancer Res 61:5045–5050 5. Shao ZM, Wu J, Shen ZZ, Barsky SH 1998 Genistein exerts multiple suppressive effects on human breast carcinoma cells. Cancer Res 58:4851– 4857 6. Baird DD, Umbach DM, Lansdell L, Hughes CL, Setchell KD, Weinberg CR, Haney AF, Wilcox AJ, Mclachlan JA 1995 Dietary intervention study to assess estrogenicity of dietary soy among postmenopausal women. J Clin Endocrinol Metab 80:1685–1690 7. Pagliacci MC, Smacchia M, Migliorati G, Grignani F, Riccardi C, Nicoletti I 1994 Growth-inhibitory effects of the natural phyto-oestrogen genistein in MCF-7 human breast cancer cells. Eur J Cancer 30A:1675–1682 8. Hsieh CY, Santell RC, Haslam SZ, Helferich WG 1998 Estrogenic effects of genistein on the growth of estrogen receptor-positive human breast cancer (MCF-7) cells in vitro and in vivo. Cancer Res 58:3833–3838 9. Dees C, Foster JS, Ahamed S, Wimalasena J 1997 Dietary estrogens stimulate human breast cells to enter the cell cycle. Environ Health Perspect 105(Suppl 3):633– 666 10. Santell RC, Kieu N, Helferich WG 2000 Genistein inhibits growth of estrogenindependent human breast cancer cells in culture but not in athymic mice. J Nutr 130:1665–1669 11. King RA, Bursill DB 1998 Plasma and urinary kinetics of the isoflavones daidzein and genistein after a single soy meal in human. Am J Clin Nutr 67:867– 872 12. Prall OW, Sarcevic B, Musgrove EA, Watts CK, Sutherland RL 1997 Estrogeninduced activation of cdk4 and cdk2 during G1-S phase progression is accompanied by increased cyclin D1 expression and decreased cyclin-dependent kinase inhibitor association with cyclin E-cdk2. J Biol Chem 272:10882–10894 13. Kato S, Masuhiro Y, Watamabe M, Kobayashi Y, Takeyama KI, Endoh H, Yanagisawa J 2000 Molecular mechanism of a cross-talk between oestrogen and growth factor signaling pathways. Genes Cells 5:593– 601 14. Stewart AJ, Johnson MD, May FE, Westley BR 1990 Role of insulin-like growth factors and the type I insulin-like growth factor receptor in the estrogen-stimulated proliferation of human breast cancer cells. J Biol Chem 265:21172–21178 15. Lee AV, Jackson JG, Gooch JL, Hilsenbeck SG, Coronado-Heinsohn E, Osborne CK, Yee D 1999 Enhancement of insulin-like growth factor signaling in human breast cancer: estrogen regulation of insulin receptor substrate-1 expression in vitro and in vivo. Mol Endocrinol 13:787–796 16. Huynh H, Yang X, Pollak M 1996 Estradiol and antiestrogens regulate a growth inhibitory insulin-like growth factor binding protein 3 autocrine loop in human breast cancer cells. J Biol Chem 271:1016 –1021 17. Valentinis B, Baserga R 2001 IGF-I receptor signaling in transformation and differentiation. Mol Pathol 54:133–137 18. LeRoith D, Roberts Jr CT 2003 The insulin-like growth factor system and cancer. Cancer Lett 195:127–137 19. Surmacz E 2000 Function of the IGF-I receptor in breast cancer. J Mammary Gland Biol Neoplasia 5:95–105 20. Turner BC, Haffty BG, Narayanann L, Yuan J, Havre PA, Gumbs AA, Kaplan L, Burgaud JL, Carter D, Baserga R, Glazer PM 1997 Insulin-like growth factor-I receptor overexpression mediates cellular radioresistance and local breast cancer recurrence after lumpectomy and radiation. Cancer Res 57:3079 –3083 21. Jackon JG, White MF, Yee D 1998 Insulin receptor substrate-1 is the predominant signaling molecule activated by insulin-like growth factor-I, insulin, and


22. 23.

24. 25.

26. 27. 28. 29. 30. 31. 32. 33. 34.

35. 36. 37.

38. 39. 40. 41. 42.

43. 44. 45. 46. 47.

2359

interleukin-4 in estrogen receptor-positive human breast cancer cells. J Biol Chem 273:9994 –10003 Surmacz E, Burgaud JL 1995 Overexpression of insulin receptor substrate 1 (IRS-1) in the human breast cancer cell line MCF-7 induces loss of estrogen requirements for growth and transformation. Clin Cancer Res 1:1429 –1436 Rocha RL, Hilsenbeck SG, Jackson JG, VanDenBerg CL, Weng C, Lee AV, Yee D 1997 Insulin-like growth factor binding protein 3 and insulin receptor substrate 1 in breast cancer: correlation with clinical parameters and disease free survival. Clin Cancer Res 3:103–109 Denizot F, Kang R 1986 Rapid colorimetric assay for cell growth and survival. Modifications to the tetrazolium dye procedure giving improved sensitivity and reliability. J Immunol Methods 89:271–277 Brunner N, Bronzert D, Vindelov LL, Rygaard K, Spang-Thomsen M, Lippman ME 1989 Effect of growth and cell cycle kinetics of estradiol and tamoxifen on MCF-7 human breast cancer cells growth in vitro and in nude mice. Cancer Res 49:1515–1520 Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248 –252 Sriussadaporn S, Wong MS, Pike WJ, Favus MJ 1995 Tissue specificity and mechanism of vitamin D receptor up-regulation during dietary phosphorus restriction in the rat. J Bone Miner Res 10:271–280 Mattson DL, Bellehumeur TG 1996 Comparison of three chemiluminescent horseradish peroxidase substrates for immunoblotting. Anal Biochem 240: 306 –308 Diel P, Olff S, Schmidt S, Michna H 2001 Molecular identification of potential selective estrogen receptor modulator (SERM) like properties of phytoestrogens in the human breast cancer cell line MCF-7. Planta Med 67:510 –514 Salerno M, Sisci D, Mauro L, Guvakova MA, Ando S, Surmacz E 1999 Insulin receptor substrate 1 is a target for the pure antiestrogen ICI 182,780 in breast cancer cells. Int J Cancer 81:299 –304 Messina MJ, Loprinzi CL 2001 Soy for breast cancer survivors: a critical review of the literature. J Nutr 131(Suppl 11):3095S–3108S Chen WF, Huang MH, Tzang CH, Yang M, Wong MS 2003 Inhibitory actions of genistein in human breast cancer (MCF-7) cells. Biochim Biophys Acta 1683:187–196 Zubik L, Meydani M 2003 Bioavailability of soybean isoflavones from aglycone and glucoside forms in American women. Am J Clin Nutr 77:1459 –1465 Setchell KD, Brown NM, Desai PB, Zimmer-Nechimias L, Wolfe B, Jakate AS, Creutzinger V, Heubi JE 2003 Bioavailability, disposition, and doseresponse effects of soy isoflavones when consumed by healthy women at physiologically typical dietary intakes. J Nutr 133:1027–1035 Molloy CA, May FEB, Westley BR 2000 Insulin receptor substrate-1 expression is regulated by estrogen in the MCF-7 human breast cancer cell line. J Biol Chem 275:12565–12571 Martin MB, Stoica A 2002 Insulin-like growth factor-I and estrogen interactions in breast cancer. J Nutr 132:3799S–3801S Mendez P, Azcoitia I, Garcia-Segura LM 2003 Estrogen receptor ␣ forms estrogen-dependent multimolecular complexes with insulin-like growth factor receptor and phosphatidylinositol 3-kinase in the adult rat brain. Brain Res Mol Brain Res 112:170 –176 Wakeling AE, Dukes M, Bowler J 1991 A potent specific pure antiestrogen with clinical potential. Cancer Res. 51:3867–3873 Jordan VC 1994 Molecular mechanisms of antiestrogen action in breast cancer. Breast Cancer Res Treat 31:41–52 Feng W, Webb P, Nguyen P, Liu X, Li J, Karin M, Kushner PJ 2001 Potentiation of estrogen receptor activation function 1 (AF-1) by Src/JNK through a serine 118-independent pathway. Mol Endocrinol 15:32– 45 Margeat E, Bourdoncle A, Margueron R, Poujol N, Cavailles V, Royer C 2003 Ligand differentially modulate the protein interactions of the human estrogen receptor ␣ and ␤. J Mol Biol 326:77–92 Yamamoto Y, Wada O, Suzawa M, Yogiashi Y, Yano T, Kato S, Yanagisawa J 2001 The Tamoxifen-responsive estrogen receptor a mutant D351Y shows reduced tamoxifen-dependent interaction with corepressor complexes. J Biol Chem 276:42684 – 42691 Huynh H, Nickerson T, Pollak M, Yang X 1996 Regulation of insulin-like growth factor I receptor expression by the pure antiestrogen ICI 182780. Clin Cancer Res 2:2037–2042 Helle SI, Lonning PE 1996 Insulin-like growth factors in breast cancer. Acta Oncol 35(Suppl 5):19 –22 Guvakova MA, Surmacz E 1997 Tamoxifen interferes with the insulin-like growth factor I receptor (IGF-IR) signaling pathway in breast cancer cells. Cancer Res 57:2606 –2610 Deleted in proof. Brodt P, Samani A, Navab R 2000 Inhibition of the type I insulin-like growth factor receptor expression and signaling: novel strategies for antimetastatic therapy. Biochem Pharmacol 60:1101–1107

JCEM is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.