Genomic Profiling Identifies Discrete Deletions Associated with ...

[Cell Cycle 5:7, 783-791, 1 April 2006]; ©2006 Landes Bioscience

Genomic Profiling Identifies Discrete Deletions Associated with Translocations in Glioblastoma Multiforme Report

ABSTRACT

Paul J. Mulholland1 Heike Fiegler2 Chiara Mazzanti1 Patricia Gorman3 Peter Sasieni4 Joanna Adams4 Tania A. Jones1 Jane W. Babbage1 Radost Vatcheva1 Koichi Ichimura5 Philip East6 Chrysanthos Poullikas1 V. Peter Collins5 Nigel P. Carter2 Ian P.M. Tomlinson3 Denise Sheer1,*

ON

INTRODUCTION

OT D

IST

RIB

UT E

.

Glioblastoma multiforme is the most common tumor arising in the central nervous system. Patients with these tumors have limited treatment options and their disease is invariably fatal. Molecularly targeted agents offer the potential to improve patient treatment, however the use of these will require a fuller understanding of the genetic changes in these complex tumors. In this study, we identify copy number changes in a series of glioblastoma multiforme tumors and cell lines by applying high-resolution microarray comparative genomic hybridization. Molecular cytogenetic characterization of the cell lines revealed that copy number changes define translocation breakpoints. We focused on chromosome 6 and further characterized three regions of copy number change associated with translocations including a discrete deletion involving IGF2R, PARK2, PACRG and QKI and an unbalanced translocation involving POLH, GTPBP2 and PTPRZ1.

Cytogenetics Laboratory; 3Molecular & Population Genetics Laboratory; Cancer Research UK; 6Computational Genome Analysis Laboratory; London Research Institute, London, UK

IEN

1Human

CE

.D

Astrocytic gliomas have been classified by the World Health Organization into four grades of malignancy, based on histopathological features, with glioblastoma multiforme (GBM) (grade IV) being the most malignant. The standard care for GBM patients is surgical resection followed by radiotherapy in combination with temozolomide, but even with optimal therapy the median survival is only a year.1 New therapeutic modalities are being explored in these patients and one promising approach is the use of molecularly targeted agents.2 However the use of these new agents will require a fuller understanding of the genetic changes in these complex tumors. The majority of GBMs show disruption of the p53 and retinoblastoma (RB) pathways arising from aberrations of genes such as p53, MDM2, RB, CDK4 or CDKN2A/INK4A.3 Many GBMs have no wild-type PTEN, or they have aberrations involving other components of the AKT signal transduction pathway.4 In addition, about a third of GBMs have amplification and/or rearrangements of EGFR.5 PDGF and its receptor, PDGFRA are often overexpressed but not amplified.6 The search for tumor-suppressor genes continues with the identification of regions of loss heterozygosity and copy number loss including recently described deletions at 6q26.7 The established sub-classification of GBM is into two groups based on clinical and genetic features. Clinically GBM can arise de novo or by progression from the lower grade astrocytic tumors.8 Both forms are indistinguishable to the pathologist and patient prognosis is similar, but patients with de novo GBMs have a mean age of fifty-five years while those arising by progression tend to occur in patients less than forty-five years old.9,10 Both forms have aberrations of the p53 and the RB pathways, however they differ in the targeted genes encoding components of these pathways.11,12 Secondary GBMs also have a lower incidence of PTEN mutation and amplification of EGFR.13 Rudimentary associations of genetic changes and prognosis have been made, with loss of 6q and 10q, gain of 19q, and abnormalities in the RB pathway (CDKN2A, CDKN2B, CDK4 and RB) in combination with loss of both wild-type PTEN alleles being associated with shorter patient survival.14 Furthermore, an improved response to temozolomide is associated with loss of MGMT.15 Genomic profiling in GBM has revealed regions and genes of interest, as well as tumor subgroups based on genetic changes.16-18 It has been suggested that critical genes at translocation breakpoints may be involved in development of GBM. Chernova et al. described a translocation, t(10;19)(q25-26;q13) in cell line CRL1620 involving two genes, WDR11 located at 10q25-26 and ZNF320 at 19q13, which generated a transcript encoding

Wellcome Trust Sanger Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge, UK

SC

2The

of Mathematics, Statistics & Epidemiology; Cancer Research UK; Wolfson Institute for Preventive Medicine; London, UK

BIO

4Department

5Department of Histopathology; Addenbrooke's Hospital; Cambridge, UK

ND

ES

*Correspondence to: Denise Sheer; Human Cytogenetics Laboratory; Cancer Research UK, London Research Institute; London WC2A 3PX UK; Tel: +44.20.7269.3220; Fax: +44.20.7269.3655; Email: [email protected]

LA

Original manuscript submitted: 02/03/06 Manuscript accepted: 02/24/06

Previously published as a Cell Cycle E-publication: http://www.landesbioscience.com/journals/cc/abstract.php?id=2631

20

06

KEY WORDS

©

glioblastoma multiforme, 6q26, IGF2R, PARK2, PACRG, QKI, POLH, GTPBP2, PTPRZ1, array CGH, FISH, deletions, translocations

NOTE

Supplementary material can be found at: http://www.landesbioscience.com/journals/cc/ supplement/mulhollandCC5-7-sup.pdf.

www.landesbioscience.com

Cell Cycle

783

Translocations in GBM

a truncated WDR11.19 In this study, we set out to improve our understanding of genetic aberrations in GBM and to explore the relationship between copy number change and translocations. GBM patient samples and cell lines were examined by array comparative genomic hybridization (CGH) followed by the application of an objective analytical method. M-FISH karyotyping of the cell lines was then performed, and FISH used to confirm and further define translocation breakpoints. Novel, recurrent DNA copy number aberrations were identified and three regions of copy number change involving chromosome 6 associated with translocations were characterized.

Table 1 Patient ID

Sex

Age

Cell line

Sex

Age

T1

F

59

CRL1620

M

53

T2

F

78

CRL2020

F

59

T3

F

55

CRL2365

M

33

T4

M

71

CRL2366

M

33

T5

M

59

CRL2610

M

65

T6

M

60

CRL2611

F

60

T7

M

68

Htb138

M

76

T8

F

56

U87

F

44

T9

M

62

U118

M

50

T10

M

56

U251

M

75

MATERIALS AND METHODS

Patient samples and cell lines. DNA from ten GBM samples (T1-T10) was obtained from patients treated in Stockholm, Sweden. Ethics approval for use of these samples was obtained from the Ethics Committee of Karolinska Hospital, Stockholm, Sweden (No. 91:16) and Cambridge Local Research Ethics Committee, Cambridge, UK (Ref. LREC 03/115). The tumor cell lines were obtained from the American tissue culture collection (ATCC) and from Cancer Research UK Cell Production Laboratory (U87 and U251). Array CGH. The method for array CGH is as previously described.20 Briefly, three thousand selected BAC and PAC clones were amplified and spotted in duplicate onto glass slides with Drosophila control DNA. Test DNA from the tumors and cell lines was labeled with Cy5, and normal male DNA was labeled with Cy3 using a Bioprime array CGH kit (Invitrogen). The arrays were prepared for hybridization by blocking repetitive sequences with Cot1 and Herring sperm DNA. Equal amounts of labeled test and control DNA were then cohybridized onto the glass slide with Cot1 DNA. After forty-eight hours the slides were washed and scanned using a confocal scanner (GSI Lumonics). The relative intensities of Cy5 and Cy3 were extracted from the array image using Spot.21 Ratios of these values were calculated for each clone on the array after normalization. The clone ratios were then plotted against genomic location mapped against the July 2003 freeze of the human genome sequence (NCBI133) within Ensembl to generate the representations of copy number in Microsoft Excel for each chromosome. Array CGH data analysis. Control experiments were first performed with differentially labeled DNA from normal male and female cells. This enabled clones that were assessed to give consistently high or low signal intensities to be excluded from the analysis. An automated, objective method was developed to assess the experimental findings. Briefly, we firstly excluded markers that gave inconsistent results in the control hybridizations. To take account of variable variability we rescaled all the data in each experiment using the inter-quartile range. Following this a further rescaling was made using a chromosome specific factor. The threshold for a single marker was taken so as to have a theoretical false positive rate of 2 false gains and 2 false losses per 10,000 and as most regions of gain/loss are longer than one mega-base, less stringent thresholds were used for consecutive markers. Molecular cytogenetic analysis. Standard FISH techniques were used.22 Probes were selected from the Sanger Institute website (http://www.ensembl.org/ Homo_sapiens) and requested from the Sanger Clone Library (http:// www.sanger.ac.uk/cgi-bin/humace/CloneRequest). Probes used for analysis of CRL1620: 6q25-27—RP11-13P5 (159.5 Mb), RP3-428L16 (161.4 Mb), RP11155H6 (161.5 Mb), RP11-421L20 (161.8 Mb), RP1-119H20 (162.1 Mb), RP11-292F10 (162.8 Mb), RP11-211O7 (163.1 Mb), RP1-257A15 (163.5 Mb), RP1-301L19 (163.6 Mb), RP3-495O10 (163.7 Mb), RP1-51J12 (163.9 Mb) and RP11-471L1 (168.1 Mb). Probes used for analysis of CRL2020: 6q25-27—RP11-13P5 (159.5 Mb), RP3-495O10 (163.7 Mb), RP1-51J12 (163.9 Mb) and RP11-471L1 (168.1 Mb).

784

Demographics of patients used in the study

Probes used for analysis of CRL2610: 6q25-27—RP1-51J12 (163.9 Mb) and RP11-471L1 (168.1 Mb). 9p21-22—RP11-513M16 (19.4 Mb), RP11-149I2 (22.0 Mb), RP11-495L19 (23.5 Mb) and RP11-5P15 (26.6 Mb). Probes used for analysis of U87: 6p21.1—RP3-337H4 (43.6 Mb), RP11-22I24 (43.7 Mb), RP1-261G23 (43.8 Mb), RP11-344J7 (43.9 Mb) and RP11-227E22 (44.0 Mb). 6q23-24—RP11-557H15 (134.9 Mb), RP11-94K8 (135.9 Mb), RP11-371H1 (136.3 Mb), RP1-4K15 (136.9 Mb), RP11-448D5 (137.2 Mb), RP11-368P1 (142.3 Mb), RP11-137J7 (142.4 Mb), RP11-753B14 (142.6 Mb), RP11-440G9 (142.9 Mb), RP11-452E5 (143.0 Mb) and RP11-86O4 (143.6 Mb). 7q31—RP11-384A20 (121.2 Mb), RP11-367M11 (121.2 Mb), RP11179C1 (121.4 Mb), RP11-95F04 (121.5 Mb) and RP11-560I19 (121.5 Mb). Additional probes for chromosomes 6, 7 and 9 centromeres, chromosome paints for 6p, 6q, 7p and 7q, and a dual probe to detect EGFR and the chromosome 7 centromere were all obtained from Vysis. cDNA synthesis and real time PCR assay. cDNA was synthesized from total RNA extracted from each cell line using the First Strand cDNA Synthesis Kit supplied by (Amersham Biosciences UK limited). Real Time PCR was performed by using the TaqMan assay (Applied Biosystems). For each gene tested two primers and one probe were designed on exon junctions using Primer Express software 2.0 and following standard protocols from Applied Biosystems. Real time reactions were run and analyzed on an ABI 7700 sequence detector. Expression was normalized using GAPDH. Reaction sequences are given in Table 3.

RESULTS Array CGH. Ten tumor samples and ten cell lines were used in the study (Table 1). Array CGH revealed complex genetic changes in these tumors. The overview of copy number changes shows predominant gain of chromosomes 7 and 20, and loss of chromosomes 6, 9p, 10, 13 and 14 (Fig. 1). The detailed profiles of each chromosome are presented in the supplementary data. Minimal regions of deletion and gain/amplification are highlighted in Table 2. For example cell line CRL1620 has a discrete deletion involving PTEN. A homozygous deletion involving the coding sequence of PTEN has previously been identified in this cell line.23 Examples of individual array profiles are shown in Figure 2. The array profile of chromosome 7 in tumor T5 shows gain of the whole chromosome and there is also amplification of two clones RP5-1091E12 and RP11-339F13, containing EGFR (Fig. 2A). A discrete region of gain was seen on chromosome 4 in tumors T3 and T4 and in cell lines CRL2020 and U118 (Fig. 2B). The individual array profile of chromosome 4 in tumor T3 shows amplification of two clones, RP11-12J3 and RP11-231C18 containing PDGFRA, KIT and VEGFR2.24 The array profile of chromosome 9 in cell line U118 shows loss of the whole chromosome but there is also a homozygous

Cell Cycle

2006; Vol. 5 Issue 7


Figure 1. Composite array CGH profiles. The results for the 22 autosomes are presented with red lines indicating loss and green lines indicating gain.

deletion encompassing CDKN2A and CDKN2B (Fig. 2C). The array profile of chromosome 6 in cell line U118 shows a deletion at 6q22.1 (Fig. 2D). This 240 kb deletion has been well characterized previously, and occurs between intron 7 of Fused in Glioma (FIG) and intron 35 of ROS resulting in a FIG-ROS fusion protein with constitutive kinase activity.25 Molecular cytogenetic and expression analysis. FISH experiments were performed to confirm copy number changes identified by array CGH. These included the homozygous deletion of CDKN2A at band 9p21.3 in cell line CRL2610, amplification of EGFR at band 7p11.2 in CRL1620, and deletion of EPHA7 at band 6q16 in cell line CRL2365. For each of these, the FISH analysis confirmed findings from array CGH. We postulated that breakpoints of regions of copy number change identified by array CGH might be associated with observed chromosome


rearrangements. Therefore, we matched regions of copy number change to translocation breakpoints as identified by Multitarget-FISH and DAPI banding (Supplementary Data, Figs. S1–S8) in the cell lines. Two interstitial deletions associated with translocations and one unbalanced translocation were further characterized with FISH as described below. Deletion of 6q25-27. Loss of 6q involving 6q25-27 was seen in two tumors and four cell lines, the minimal region of deletion being defined by cell line CRL2020, which had a discrete deletion between 160 and 167 Mb (Fig. 3A). M-FISH analysis revealed an apparently normal copy of chromosome 6, two copies of a marker chromosome 6 with a deleted long arm, del(6)(q25-27) and a marker chromosome 7 translocated to material from chromosome 6, der(7)t(6;7)(q25-27;p?). FISH analysis confirmed the deletion between probes RP11-13P5 (159.4 Mb) and RP11-471L1 (168 Mb), and revealed

Cell Cycle

785


Table 2

Minimal regions of copy number change identified in the study

Minimal region

Sample defining region

1p36 (2–6 Mb) 1p36 (5–11 Mb) 2q37-qter (233–245 Mb) 3p25 (13 Mb) 3q13 (117 Mb) 5q21 (82–86 Mb) 6p22 (17–19 Mb) 6q13-14 (75–77 Mb) 6q16 (89–94 Mb) 6q16 (96–97 Mb) 6q16 (99–104 Mb) 6q22 (115–120 Mb) 6q22 (117–118 Mb) 6q23-24 (135–143 Mb) 6q25-27 (160–167 Mb) 6q27 (167–170 Mb) 8p12 (34 Mb) 8q21 (87–90 Mb) 8q24 (141–145 Mb) 9p21 (21–24 Mb) 10q11 (48–49 Mb) 10q22 (75–77 Mb) 10q23 (89 Mb) 10q26-qter (122–135 Mb) 13q14-21 (47–62 Mb) 13q31 (87–91 Mb) 14q11 (18–23 Mb) 15q13 (25–27 Mb) 15q13 (29–30 Mb) 16q21-22 (63–64 Mb) 16q23 (77–78 Mb) 17p13 (6–7 Mb) 19q13 (52–55 Mb) 22q12-13 (39–42 Mb)

U87 T5 T5 CRL1620 CRL2611 T2 T2 T10 CRL2365, CRL2366 U251 U87 CRL2365, CRL2366 U118 U87 CRL2020 T7 CRL1620 U87 CRL2610 CRL2020, U87 U251 CRL1620 CRL1620 U87 U251 T3 U251 Htb138 CRL1620 U251 Htb138 U87 CRL2610

MMP16 PTP4A3 CDKN2A, CDKN2B, MTAP, DMRTA1, ELAV2 MAPK8 ADK PTEN *WDR11, MGMT RB1 SLITRK5 TEP1, PARP2, CCNB1IP1, PIP5K3, MYH6, MYH7, RIPK3 HERC2, APBA2, MAGG1, KLF13, TRPM1 CHRNA7, ARHGAP11A, SGNE1, GREM1 CDH11 WWOX p53 MEIS3 MCM5, EP300, MYH9, SRY GTPBP1, MAP3K7IP1

1q32 (200–203 Mb) 1q43-44 (238–240 Mb) 4q12 (54–55 Mb) 7p11 (55 Mb)

CRL2020 T5 T3 T5

MDM4, PIK3C2B AKT3 CHIC2, PDGFRA, KIT, VEGFR2 EGFR

Deletions

Gain/Amplification

Selected genes in region

CHD5 NGEF, NPPC WNT7A LSAMP HPSE, CDS1, HNRPD, PRKG2 SCA1 EPHA7 CCNC, SIM1 FIG, ROS1 MAP3K5, TNFAIP3, MAP7 IGF2R, PARK2, PACRG, QKI

*WDR11 (10q25–26) located at the breakpoint.19

that it was at the breakpoint of the translocation between chromosomes 6 and 7 (Fig. 3B–D). This deletion includes IGF2R, PARK2, PACRG and QKI. In cell line CRL1620, array CGH showed loss of chromosome 6 material from RP11-320C15 at 6.7 Mb to the end of the long arm, with a more accentuated region of loss between clones RP11-288H12 (160.3 Mb) and RP3-470B24 (168.2 Mb). M-FISH analysis revealed two apparently normal copies of chromosome 6, a marker chromosome 6 with a deleted long arm, del(6)(q14?), and a marker chromosome 7, der(7)t(6;7)(q14;q11). FISH analysis revealed three copies of probes on chromosome 6 from RP11-13P5 (159.5 Mb) to RP11-211O7 (163.1 Mb), and only two copies of probes from RP1-257A15 (163.5 Mb) to RP1-51J12 (163.9 Mb). Three copies of probe RP11-471L1 (168.1 Mb) were present. These results confirm the presence of an interstitial deletion between RP11-211O7 and RP11-471L1 again involving IGF2R, PARK2, PACRG and QKI. However, the FISH profile showed that the deletion was a distance away from the translocation breakpoint in this cell line.

786

Expression of IGF2R and QKI was reduced in those cell lines showing a deletion. PARK2 and PACRG were not expressed in any of the cell lines (data not shown). Deletion of 6q23-24. In cell line U87, array CGH showed a discrete deletion on the long arm of chromosome 6 between probes RP11-94K8 (135.9 Mb) and RP11-86O4 (143.6 Mb) (Fig. 4A). M-FISH analysis revealed chromosome 6 to be translocated to chromosome 12 to give an apparently balanced reciprocal translocation der(12)t(6;12)(q23-24;q?) and der(6)t(6;12)(q23-24;q?) (Fig. 4C). FISH analysis confirmed the presence of the deletion on 6q and showed it to be at the breakpoint between chromosomes 6 and 12. Gene expression was compared in cell lines U87, CRL2611, CRL2020 and CRL1620, showing a deletion of 6q23-24, with CRL2365, CRL2366, CRL2610, Htb138, U118 and U251, which do not show this deletion. Cell lines showing a deletion of this region had a marked reduction in expression of MAP3K5, MAP7 and CITED2 (data not shown).

Cell Cycle



Figure 2. Examples of expected copy number changes identified by array CGH. The profiles show copy number changes on individual chromosomes from four samples. The X-axis shows the position on the chromosome in Mb in order from the telomere of the p arm to the telomere of the q arm. (A) Chromosome 7 in tumor T5. Amplification of clones RP5-1091E12 (54.8 Mb) and RP11-339F13 (55.0 Mb) containing EGFR (7p12) is seen. This region was gained or amplified in all the patient samples and in seven cell lines. Other genes are coamplified along with EGFR. (B) Chromosome 4 in tumor T3. Amplification of clones RP11-12J3 (54.7 Mb) and RP11-231C18 (55 Mb) is seen. (C) Chromosome 9 in cell line CRL2610. Loss of one copy of chromosome 9 with a homozygous deletion involving RP11-15P13 (20.2 Mb), RP11-113D19 (21.0 Mb) and RP11-495l19 (23.4 Mb). (D) Chromosome 6 in cell line U118. Deletion of clone RP1-94G16 is seen. The tyrosine kinase receptor ROS is fused with FIG at 6q22 in U118 through this interstitial deletion.

Unbalanced translocation der(6)t(6;7)(p21;q31). Also in cell line U87, array CGH demonstrated a deletion of the short arm of chromosome 6 (Fig. 4A) and a region of gain at the distal end of chromosome 7 (Fig. 4B). M-FISH showed an unbalanced translocation between chromosomes 6 and 7 to give a derivative chromosome der(6)t(6;7)(p21;q31) (Fig. 4C). FISH confirmed the chromosome 6 translocation breakpoint to be within probe RP11-22I24 (43.7 Mb), containing POLH and GTPBP2 and thus does not involve VEGF. The translocation breakpoint on 7q can be deduced from the array CGH profile to be in band 7q31, since genetic material is gained from probe RP11-106F1 (122.4 Mb) to 7qter. FISH analysis showed the translocation breakpoint on chromosome 7 to be within overlapping probes RP11-384A20 and RP11-367M11 (121.2 Mb) (Fig. 4D). Probe RP11384A20 spans 72 kb of the PTPRZ1 gene, and RP11-367M11 spans 239 kb over the entire PTPRZ1 gene and part of the adjacent AASS gene (Fig. 4E). These data show that the breakpoint on chromosome 7q is within PTPRZ1. Since PTPRZ1 and GTPBP2 are transcribed in the same direction, and at least some or all of POLH appears to be deleted, it is possible that the translocation generates a fusion between GTPBP2 and PTPRZ1.

DISCUSSION

Array CGH has three significant characteristics that distinguish it from previous CGH studies performed on chromosomes. Firstly, the greatly increased sensitivity facilitates the detection of small copy www.landesbioscience.com

number changes, secondly, there is increased precision in defining discrete regions of copy number changes, and thirdly, copy number can be more accurately assessed. The key value of this study is the precise localization of deletions and translocation breakpoints that contain candidate tumor suppressor genes and oncogenes in GBM. We focused on copy number changes on chromosome 6 as this chromosome has previously been reported to have frequent LOH and reduced copy number in GBM but no tumor suppressor gene has been identified. Also we have recently reported two minimal regions of deletion within 6q26 in a large series of GBM.7 Since we noted there were translocations involving chromosome 6 in several cell lines, we investigated the relationship between the regions of copy number change and the translocation breakpoints. The copy number aberrations selected for further characterization by FISH were a deletion in bands 6q25-27 in cell line CRL2020 involved in a translocation t(6;7)(q25-27;p?), a deletion in the same bands in cell line CRL1620 which was shown not to be directly at a translocation breakpoint, a deletion at 6q23-24 in cell line U87 involved in a reciprocal translocation, t(6;12)(q23;q?), and a large deletion from 6pter to 6p21 and a gain of 7q31-qter, also in cell line U87, resulting in an unbalanced translocation t(6;7)(p21;q31). These translocations had different features, in that the chromosome 6 components in the

Cell Cycle

787


t(6;12)(q23;q?) in U87 and in the t(6;7)(q25-27;p?) in cell line CRL2020 appeared to be balanced using cytogenetic analysis. However, we clearly demonstrated that they are not balanced, as they are associated with interstitial deletions. The third translocation is a classical unbalanced translocation. What can be considered is whether a translocation breakpoint is the critical change in the tumor or if it is the deletion of a tumor suppressor gene? We focused on the genes in the interstitial deletions as we considered that these might contain candidate tumor suppressor genes. With the unbalanced translocation we focused on the genes at the translocation breakpoints. Genes involved in the deletion 6q25-27 include IGF2R, PARK2, PACRG and QKI. IGF2R activates the potent growth inhibitor TGFβ and is involved in the degradation of the mitogen IGF2.26 Mutation in IGF2R has been identified in hepatocellular carcinoma and non-small cell lung cancer.27,28 Parkinson’s disease is a neurodegenerative illness where there is loss of a cell population in the mid-brain, the substantia nigra. PARK2 is involved in protein degradation as an E3 ubiquitin ligase.29 Mutations in PARK2 are associated with autosomal recessive juvenile parkinsonism, ovarian cancer, hepatocellular carcinoma and non-small cell lung cancer.30-33 PACRG shares the same promoter as PARK2 and is also thought to be involved in protein degradation.34,35 PARK2 and PACRG were not expressed in any of the cell lines. Mutations in QKI were assumed to be responsible for the ‘Quaking’ phenotype in mice, which is characterized by an abnormal gait and defects in myelination. However, this conclusion has recently been complicated by the finding that mice with Quaking phenotype, have both mutation of QKI and absent PARK2 expression.36 788

Figure 3. Discrete deletion in band 6q25-27. (A) Individual array CGH profiles of chromosome 6 where there are genetic changes present. Note that a more pronounced region of loss was present between 160 and 167 Mb in cell lines CRL1620 and CRL2020. (B) FISH analysis of CRL2020 with probe RP1-51J12 (green) and 6q paint (red). Three copies of 6q are present in this tetraploid cell line and only one has RP1-51J12, confirming the deletion of this probe from 6q. (C) FISH analysis of CRL2020 with probe RP11-471L1 (green) showing this distal 6q probe to be present on the long arm of one chromosome 6 and on the terminal short arm of the der(7)t(6;7). (D) Summary of FISH analysis of the chromosome 6 deletion in CRL2020. Chromosome 6 is shown in green and chromosome 7 in red. The M-FISH profile of the der(7)t(6;7) is shown on the left.

Cell Cycle



Figure 4. Discrete deletion in band 6q23-24 associated with reciprocal translocation t(6;12) and unbalanced translocation t(6;7) in cell line U87. (A) Array CGH profile of Chromosome 6. There are four deletions demonstrated on this array profile, the breakpoints at 6p21, 6q23 and 6q24 are annotated with arrows. (B) Array CGH profile of Chromosome 7. The breakpoint at 7q31 is annotated with an arrow. (C) Summary of FISH analysis of chromosome 6 aberrations. Chromosome 6 is shown in green, chromosome 7 in red, and chromosome 12 in yellow. RP11-22I24 had a smaller signal for this probe on the der(6)t(6;7) than on the suggesting that the breakpoint intersects this probe. The M-FISH profiles of the der(6)t(6;7), der(6)t(6;12), der(12)t(6;12) are shown on the left. (D) FISH analysis of U87 with probes RP11-384A20 (green) and RP11-179C1 (red). The second image shows only the RP11384A20 (green). Both probes are present on two normal copies of chromosome 7 and a red arrow points to a weaker signal of RP11384A20 (green) on der(6)t(6;7). (E) Map showing the position of probes used for analysis of chromosome 7 in the t(6;7) in U87. All five probes were present on two normal copies of chromosome 7. Probes RP11-384A20 and RP11367M11 also showed very faint signals on the der(6)t(6;7) and probes RP11-179C1, RP11-95F04 and RP11-560I19 showed strong signals on this chromosome.

6q25-27 is a fragile site (FRA6E), raising the question whether translocations at fragile sites may facilitate deletion of certain tumor suppressor genes. Since radiation is the only known environmental risk factor in gliomas, exposure to DNA damaging agents such as radiation coupled with loss of function of caretaker genes such as p53 could be a mechanism of gliomagenesis. The der(6)t(6;7) in cell line U87 has a deletion from the telomere of the short arm of chromosome 6 to the breakpoint at 43.6 Mb. www.landesbioscience.com

The question raised here is whether one or more relevant tumor suppressor genes is included in the deletion. Alternatively, or possibly in addition, the translocation itself may be important, with a fusion gene being generated between GTPBP2 and PTPRZ1. POLH, which is very close to the chromosome 6 breakpoint, is a low fidelity polymerase involved in post-replicative DNA repair. Defects in this gene are responsible for the Xeroderma Pigmentosum Variant.37 GTPBP2 is a novel member of the G protein family, but its function is yet to be characterized. Increased expression of protein tyrosine-phosphatases in gastric cancer is associated with gastric cancer invasion and metastasis.38 PTPRZ1 is involved in oligodendrocyte differentiation, survival and recovery and is overexpressed in GBM where it promotes cell migration.39-41

Cell Cycle

789


This study examined the relationship between copy number changes and translocations. This forms only part of a wider view of what a region of copy number change may signify. Does a region of copy number change indicate the presence of an underlying mutation? Is the copy number change itself contributing to the tumor? Is it possible that the change contributed to the tumor at one time but is now redundant? How can the patterns of change seen be related to mechanisms of genetic change? And why are there so many and varied genetic changes in these tumors? The information in this study can now be used to investigate further the relationship between genetics and disease through molecular characterization of the candidate tumor suppressor genes and oncogenes that have been identified. In particular, the role of translocations in GBM warrants further investigation. Acknowledgements We would like to thank the Microarray Facility of the Wellcome Trust Sanger Institute for printing the arrays and Philippa Carr for technical assistance.

Table 3

Oligonucleotide sequences used in real-time PCR analysis

Oligo

Sequence

Exon Junction

MAP3K5 (ENSG00000197442) MAP3K5F

TTGCTATTAAGGAAATCCCAGAGAG

15-16

MAP3K5R

TCAGGTGTTTATGCAATGCTATTTCT

15-16

MAP3K5p

ACAGCAGATACTCTCAGCCCCTGCATG

15-16

MAP7 (ENSG00000135525) MAP7F

CGGCTCTCCTCTTCATCTGC

6-7

MAP7R

CCATGGGCTGAGCTGCA

6-7

MAP7p

ACTTTACTAAATTCTCCAGATAGAGCTCGCCGC

6-7

CITED2 (ENSG00000164442)

1-2

CITED2f

GCCCGCCCTCGGTCT

1-2

CITED2r

TGGTCTGCCATTTCCAGTCC

1-2

CITED2p

CGGAGCAGAAATCGCAAAAACGGA

IGF2R (ENSG00000197081) IGF2Rf

CTGCCGACTGCCAGTACCTC

45-46

IGF2Rr

CTGTCAAAGCCCACCCCC

45-46

IGF2Rp

TCTCTTGGTACACCTCAGCCGTGTGTCC

45-46

PARK2 (ENSG00000185345) PARK2f

GAGGAAAGTCACCTGCGAAGG

9-10

PARK2r

TTCTTTACATTCCCGGCAGAA

9-10

PARK2p

CAATGGCCTGGGCTGTGGGTTTG

9-10

PACGR (ENSG00000112530) PACGRf

TCAAAGCCATGATGAAAAACTCA

1-2

PACGRr

TTGGTCTTTCTTTAAATGCCCC

1-2

PACGRp-

TCGTGAGAGGCCCTCCAGCTGC

1-2

QKI (ENSG00000112531) QKIf

TGAATGGCACCTACAGATGC

5-6

QKIr

CCTGGGCTGTTGCTGCA

5-6

QKIp

ACATTAAATCACCAGCCCTTGCCTTTTCTC

5-6

References 1. Stupp R, Mason WP, van den Bent MJ, Weller M, Fisher B, Taphoorn MJ, Belanger K, Brandes AA, Marosi C, Bogdahn U, Curschmann J, Janzer RC, Ludwin SK, Gorlia T, Allgeier A, Lacombe D, Cairncross JG, Eisenhauer E, Mirimanoff RO. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 2005; 352:987-96. 2. Mulholland PJ, Thirlwell C, Brock CS, Newlands ES. Emerging targeted treatments for malignant glioma. Expert Opin Emerg Drugs 2005; 10:845-54. 3. Ichimura K, Bolin MB, Goike HM, Schmidt EE, Moshref A, Collins VP. Deregulation of the p14ARF/MDM2/p53 pathway is a prerequisite for human astrocytic gliomas with G1-S transition control gene abnormalities. Cancer Res 2000; 60:417-24. 4. Knobbe CB, Reifenberger G. Genetic alterations and aberrant expression of genes related to the phosphatidyl-inositol-3'-kinase/protein kinase B (Akt) signal transduction pathway in glioblastomas. Brain Pathol 2003; 13:507-18. 5. Liu L, Ichimura K, Pettersson EH, Goike HM, Collins VP. The complexity of the 7p12 amplicon in human astrocytic gliomas: detailed mapping of 246 tumors. J Neuropathol Exp Neurol 2000; 59; :1087-93. 6. Hermanson M, Funa K, Hartman M, Claesson-Welsh L, Heldin CH, Westermark B, Nister M. Platelet-derived growth factor and its receptors in human glioma tissue: expression of messenger RNA and protein suggests the presence of autocrine and paracrine loops. Cancer Res 1992; 52:3213-9. 7. Ichimura K, Mungall AJ, Fiegler H, Pearson DM, Dunham I, Carter NP, Collins VP. Small regions of overlapping deletions on 6q26 in human astrocytic tumours identified using chromosome 6 tile path array-CGH. Oncogene 2005. 8. Kleihues P, Ohgaki H. Primary and secondary glioblastomas: from concept to clinical diagnosis. Neuro-oncol 1999; 1:44-51. 9. Kleihues P, Cavenee WK. Pathology and Genetics of Tumours of the Nervous System: International Agency for Research on Cancer, World Health Organization, Lyon, France. 2000.

790

10. Maher EA, Furnari FB, Bachoo RM, Rowitch DH, Louis DN, Cavenee WK, DePinho RA. Malignant glioma: genetics and biology of a grave matter. Genes Dev 2001; 15; :1311-33. 11. Watanabe K, Tachibana O, Sata K, Yonekawa Y, Kleihues P, Ohgaki H. Overexpression of the EGF receptor and p53 mutations are mutually exclusive in the evolution of primary and secondary glioblastomas. Brain Pathol 1996; 6:217-23. 12. Biernat W, Aguzzi A, Sure U, Grant JW, Kleihues P, Hegi ME. Identical mutations of the p53 tumor suppressor gene in the gliomatous and the sarcomatous components of gliosarcomas suggest a common origin from glial cells. J Neuropathol Exp Neurol 1995; 54:651-6. 13. Tohma Y, Gratas C, Biernat W, Peraud A, Fukuda M, Yonekawa Y, Kleihues P, Ohgaki H. PTEN (MMAC1) mutations are frequent in primary glioblastomas (de novo) but not in secondary glioblastomas. J Neuropathol Exp Neurol 1998; 57:684-9. 14. Backlund LM, Nilsson BR, Goike HM, Schmidt EE, Liu L, Ichimura K, Collins VP. Short postoperative survival for glioblastoma patients with a dysfunctional Rb1 pathway in combination with no wild-type PTEN. Clin Cancer Res 2003; 9:4151-8. 15. Hegi ME, Diserens AC, Gorlia T, Hamou MF, de Tribolet N, Weller M, Kros JM, Hainfellner JA, Mason W, Mariani L, Bromberg JE, Hau P, Mirimanoff RO, Cairncross JG, Janzer RC, Stupp R. MGMT gene silencing and benefit from temozolomide in glioblastoma. N Engl J Med 2005; 352:997-1003. 16. Misra A, Pellarin M, Nigro J, Smirnov I, Moore D, Lamborn KR, Pinkel D, Albertson DG, Feuerstein BG. Array comparative genomic hybridization identifies genetic subgroups in grade 4 human astrocytoma. Clin Cancer Res 2005; 11:2907-18. 17. Bredel M, Bredel C, Juric D, Harsh GR, Vogel H, Recht LD, Sikic BI. High-resolution genome-wide mapping of genetic alterations in human glial brain tumors. Cancer Res 2005; 65:4088-96. 18. Nigro JM, Misra A, Zhang L, Smirnov I, Colman H, Griffin C, Ozburn N, Chen M, Pan E, Koul D, Yung WK, Feuerstein BG, Aldape KD. Integrated array-comparative genomic hybridization and expression array profiles identify clinically relevant molecular subtypes of glioblastoma. Cancer Res 2005; 65:1678-86.

Cell Cycle



19. Chernova OB, Hunyadi A, Malaj E, Pan H, Crooks C, Roe B, Cowell JK. A novel member of the WD-repeat gene family, WDR11, maps to the 10q26 region and is disrupted by a chromosome translocation in human glioblastoma cells. Oncogene 2001; 20:5378-92. 20. Fiegler H, Carr P, Douglas EJ, Burford DC, Hunt S, Smith J, Vetrie D, Gorman P, Tomlinson IP, Carter NP. DNA microarrays for comparative genomic hybridization based on DOP-PCR amplification of BAC and PAC clones. Genes Chromosomes Cancer 2003; 36:361-74. 21. Jain AN, Tokuyasu TA, Snijders AM, Segraves R, Albertson DG, Pinkel D. Fully automatic quantification of microarray image data. Genome Res 2002; 12:325-32. 22. Senger G, Ragoussis J, Trowsdale J, Sheer D. Fine mapping of the human MHC class II region within chromosome band 6p21 and evaluation of probe ordering using interphase fluorescence in situ hybridization. Cytogenet Cell Genet 1993; 64:49-53. 23. Fan X, Aalto Y, Sanko SG, Knuutila S, Klatzmann D, Castresana JS. Genetic profile, PTEN mutation and therapeutic role of PTEN in glioblastomas. Int J Oncol 2002; 21:1141-50. 24. Joensuu H, Puputti M, Sihto H, Tynninen O, Nupponen NN. Amplification of genes encoding KIT, PDGFRalpha and VEGFR2 receptor tyrosine kinases is frequent in glioblastoma multiforme. J Pathol 2005; 207:224-31. 25. Charest A, Kheifets V, Park J, Lane K, McMahon K, Nutt CL, Housman D. Oncogenic targeting of an activated tyrosine kinase to the Golgi apparatus in a glioblastoma. Proc Natl Acad Sci U S A 2003; 100:916-21. 26. Kornfeld S. Structure and function of the mannose 6-phosphate/insulinlike growth factor II receptors. Annu Rev Biochem 1992; 61:307-30. 27. De Souza AT, Hankins GR, Washington MK, Orton TC, Jirtle RL. M6P/IGF2R gene is mutated in human hepatocellular carcinomas with loss of heterozygosity. Nat Genet 1995; 11:447-9. 28. Kong FM, Anscher MS, Washington MK, Killian JK, Jirtle RL. M6P/IGF2R is mutated in squamous cell carcinoma of the lung. Oncogene 2000; 19:1572-8. 29. Zhang Y, Gao J, Chung KK, Huang H, Dawson VL, Dawson TM. Parkin functions as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proc Natl Acad Sci U S A 2000; 97; :13354-9. 30. Giasson BI, Lee VM. Parkin and the molecular pathways of Parkinson's disease. Neuron 2001; 31:885-8. 31. Cesari R, Martin ES, Calin GA, Pentimalli F, Bichi R, McAdams H, Trapasso F, Drusco A, Shimizu M, Masciullo V, D'Andrilli G, Scambia G, Picchio MC, Alder H, Godwin AK, Croce CM. Parkin, a gene implicated in autosomal recessive juvenile parkinsonism, is a candidate tumor suppressor gene on chromosome 6q25-q27. Proc Natl Acad Sci U S A 2003; 100:5956-61. 32. Picchio MC, Martin ES, Cesari R, Calin GA, Yendamuri S, Kuroki T, Pentimalli F, Sarti M, Yoder K, Kaiser LR, Fishel R, Croce CM. Alterations of the tumor suppressor gene Parkin in non-small cell lung cancer. Clin Cancer Res 2004; 10:2720-4. 33. Wang F, Denison S, Lai JP, Philips LA, Montoya D, Kock N, Schule B, Klein C, Shridhar V, Roberts LR, Smith DI. Parkin gene alterations in hepatocellular carcinoma. Genes Chromosomes Cancer 2004; 40:85-96. 34. West AB, Lockhart PJ, O'Farell C, Farrer MJ. Identification of a novel gene linked to parkin via a bi-directional promoter. J Mol Biol 2003; 326:11-9. 35. Imai Y, Soda M, Murakami T, Shoji M, Abe K, Takahashi R. A product of the human gene adjacent to parkin is a component of Lewy bodies and suppresses Pael receptor-induced cell death. J Biol Chem 2003; 278:51901-10. 36. Lorenzetti D, Antalffy B, Vogel H, Noveroske J, Armstrong D, Justice M. The neurological mutant quaking(viable) is Parkin deficient. Mamm Genome 2004; 15:210-7. 37. Kusumoto R, Masutani C, Shimmyo S, Iwai S, Hanaoka F. DNA binding properties of human DNA polymerase eta: implications for fidelity and polymerase switching of translesion synthesis. Genes Cells 2004; 9:1139-50. 38. Wu CW, Kao HL, Li AF, Chi CW, Lin WC. Protein tyrosine-phosphatase expression profiling in gastric cancer tissues. Cancer Lett 2005. 39. Lu KV, Jong KA, Kim GY, Singh J, Dia EQ, Yoshimoto K, Wang MY, Cloughesy TF, Nelson SF, Mischel PS. Differential induction of glioblastoma migration and growth by two forms of pleiotrophin. J Biol Chem 2005; 280:26953-64. 40. Ranjan M, Hudson LD. Regulation of tyrosine phosphorylation and protein tyrosine phosphatases during oligodendrocyte differentiation. Mol Cell Neurosci 1996; 7:404-18. 41. Harroch S, Furtado GC, Brueck W, Rosenbluth J, Lafaille J, Chao M, Buxbaum JD, Schlessinger J. A critical role for the protein tyrosine phosphatase receptor type Z in functional recovery from demyelinating lesions. Nat Genet 2002; 32:411-4.


Cell Cycle

791