Genotypic and morphological variation between ... - CSIRO Publishing

CSIRO PUBLISHING

Marine and Freshwater Research, 2015, 66, 187–194 http://dx.doi.org/10.1071/MF13289

Genotypic and morphological variation between Galaxiella nigrostriata (Galaxiidae) populations: implications for conservation David M. Galeotti A, Mark A. Castalanelli B,C,E, David M. Groth C, Clint McCullough A,D and Mark Lund A A

Mine Water and Environment Research Centre (MiWER), School of Natural Sciences, Edith Cowan University, 270 Joondalup Drive, Joondalup, WA 6027, Australia. B Department of Terrestrial Zoology, Western Australian Museum, Locked Bag 49, Welshpool DC, WA 6986, Australia. C School of Biomedical Sciences, CHIRI Biosciences Research Precinct, Faculty of Health Sciences, Curtin University, GPO Box U1987, Perth, WA 6845, Australia. D Golder Associates Pty Ltd, West Perth, WA 6005, Australia. E Corresponding author. Email: [email protected]

Abstract. Galaxiella nigrostriata is a freshwater fish that is endemic to the seasonally dry coastal wetlands of south-west Western Australia and considered by the International Union for Conservation of Nature (IUCN) as lower risk–near threatened. This small fish (maximum total length ,50 mm) aestivates in the sediment over the long, dry Mediterranean summer and its dispersal is limited by lack of habitat connectivity. The objective of this study was to identify the historical and contemporary genetic connectivity between populations of G. nigrostriata and to assess morphological variation between these populations. Results showed that all populations were genetically divergent and no mtDNA haplotypes were shared between populations. In contrast, morphological differentiation between individual populations was weak; however, pooling populations into two broad regions (Swan coastal plain and southern coast) resulted in clear morphological differentiation between these two groups. Based on these results, we postulate G. nigrostriata distribution last expanded in the early Pleistocene ,5.1 million years ago and have since been restricted to remnant wetlands in the immediate area. Galaxiella nigrostriata populations at the northern end of their range are small and are the most vulnerable to extinction. Conservation efforts are therefore required to ensure the survival of these genetically and morphologically distinctive Swan coastal plain populations. Received 4 November 2013, accepted 7 May 2014, published online 26 November 2014

Introduction The south-west of Western Australia is internationally regarded as a biodiversity hotspot, with estimates of up to 49% of flora and 22% of terrestrial vertebrate fauna being endemic (Myers et al. 2000; Hopper and Gioia 2004). Additionally, eight of the 10 native freshwater fish found in the south-west are also endemic (Morgan et al. 1998b). With the south-west of Western Australia also listed as one of the most threatened areas in the world (Myers et al. 2000; Malcolm et al. 2006; Horwitz et al. 2008), considerable efforts are required to ensure the survival of these endemic species. The focus of this study was the freshwater fish Galaxiella nigrostriata (Shipway 1953) because of its IUCN lower risk–near threatened species conservation status. This species inhabits the southern coastal peat flats in the south-west of Western Australia, between Augusta and Albany, but the majority of populations exist in the Scott coastal plain (ScCP), which is between Augusta and Walpole (Gill and Morgan 1996). It was not until 1993 that Journal compilation Ó CSIRO 2015

the first remnant population of G. nigrostriata was discovered on the Swan coastal plain (SwCP), north of Bunbury at the Kemerton Nature Reserve. Two additional small populations were discovered in 1995 and 2009, ,175 km further north, at Melaleuca Park and Lake Chandala respectively (Smith et al. 2002; McLure and Horwitz 2009). No further populations are known despite considerable surveying (.410 major watersheds) by Morgan et al. (1998b) and two other freshwater fish surveys by Jaensch (in 1992; unpubl. data) and Christensen (1982). Despite the latest range expansion, each current G. nigrostriata population remains isolated and separated by considerable physical distances. Since Galaxiella species are only found in freshwater (potamodromous; Unmack et al. 2012), dispersal of individuals in the SwCP, and southern coastal region is likely to be limited to heavy rainfall events and associated flooding forming overland connections between habitats. In contrast, dispersal between the SwCP and southern coastal region would almost certainly be impossible, except during glacial www.publish.csiro.au/journals/mfr

188

Marine and Freshwater Research

maximums. The most recent glacial maximum was Late Pleistocene (.10 000 years ago) when sea levels were .130 m below current sea levels and south-west Western Australian river deltas and estuaries were more widespread (Lambeck and Nakada 1990; Unmack 2001). Given the numerous climatic oscillations that have occurred over the past 800 000 years, at a periodicity of ,100 000 years (Byrne et al. 2008), there may have been multiple opportunities for dispersal of this species. Over time, isolated populations may undergo subtle morphological changes in response to local environmental selection pressures (Scalici and Gibertini 2009), which can hinder species identification across the geographic range, either in the field or the laboratory (Beatty et al. 2009; Galeotti et al. 2010). Species identification can be further complicated when congeneric species coexist, as occurs for G. nigrostriata and G. munda in south-west Western Australia. While the body length varies between the fish (maximum total length ,48 mm and 60 mm, G. nigrostriata and G. munda respectively), the primary characteristics used to identify adults in each species is their lateral striping and fin morphology (Galeotti et al. 2010; Unmack et al. 2012). Therefore, there is a need to understand the morphological differences between isolated populations. To conserve a species, it is important to understand the elements critical for their survival, including habitat requirements (Bonnett and Sykes 2002), physiology and reproductive behaviour (Hardie et al. 2007), and genetic structure (HaagLiautard et al. 2008). Knowledge of a species’ genetic structure is increasingly an important tool in conservation efforts, as low genetic diversity can result in decreased resilience to disease, reduced fertility, inbreeding depression and an overall lower chance of population survival (Vrijenhoek 1996). Genetic analyses can also concomitantly reveal evolutionary relationships, migratory pathways, population isolations or genetic structuring (Haag-Liautard et al. 2008; Castalanelli et al. 2013). Investigating the ecological and genetic circumstances shaping a population’s past can therefore help direct any future conservation efforts (Chen et al. 2009). The SwCP populations of G. nigrostriata are small, isolated and vulnerable to local disturbances and a drying climate (Horwitz et al. 2008). The objective of this study was to explore the historic and contemporary genetic connectivity between populations of G. nigrostriata, particularly whether there are substantive differences between SwCP and southern coast populations. Alongside genetic analysis, morphometric measurements from the populations were examined to determine whether any genetic differences were also reflected in identifiable features. These analyses will provide guidance on the significance of the SwCP populations for conservation. To achieve this, we combined meristic counts and morphometric measurements, and examined genetic diversity using two mtDNA genes – control region (CR) and cytochrome b (Cyt b) – among G. nigrostriata populations. Sample collection Thirty-one seasonal wetlands in six catchments – Melaleuca Park, Lake Chandala and Kemerton wetlands (SwCP); and Scott River, Deep River, Gardner River and Shannon River catchments (ScCP) – known to previously contain G. nigrostriata in south-west Western Australia were sampled

D. M. Galeotti et al.

HL SnL ED

TL

DL

BD P 1L

P

CD

AL

CL

2L

Fig. 1. Morphological measurements on Galaxiella nigrostriata. TL, total length; HL, head length; SnL, snout length; ED, eye diameter; P1 L, length of pectoral fin; P2 L, length of pelvic fin; DL, length of base of dorsal fin; BD, body depth; AL, length of base of anal fin; CL, length of caudal peduncle; and CD, depth of caudal peduncle. Base photo courtesy of G. Allen.

from October to November 2008 (Table S1, available as Supplementary material to this paper). Due to the presence of large quantities of humic and fulvic acids in the water creating a dark brown colour (Gilvin), visual methods, such as spotlighting or electric-fishing (McCullough and Hicks 2002), were precluded. Instead, fish were collected using a sweep net (500 mm 500 mm opening 450 mm deep with 3 mm wide mesh) over 10 m transects in water depths of 0.05–1 m. Up to 20 G. nigrostriata were collected from each wetland and killed immediately by rapid chilling in an ice slurry. Specimens were stored at 208C in small labelled air-tight plastic containers until analysed. Morphometric measurements and meristic counts All meristic counts and morphometric measurements were taken from the left side of the specimens, and conducted in Petri dishes resting on a layer of ice to reduce damage to the DNA (Nagy 2010; Rodriguez-Ezpeleta et al. 2013). Meristic counts were performed using a dissecting microscope to count the number of rays in each of the following fins: pectoral, P; pelvic, Pv; anal, A; dorsal, D; and caudal, C. Morphometric measurements were taken using digital callipers (Starrett, limit of detection 0.02 mm) of the following 11 features: total length, TL; head length, HL; snout length, SnL; eye diameter, ED; length of base of dorsal fin, DL; length of pectoral fin, P1 L; length of pelvic fin, P2 L; length of base of anal fin, AL; length of caudal peduncle, CL; depth of caudal peduncle, CD; and body depth at anus, BD (Fig. 1). The sex of each specimen was not determined during examination. The meristic counts and morphometric measurements were adapted from methods by Gill and Neira (1994), Watts et al. (1995), Ling and Gleeson (2001), Smith et al. (2002) and Tseng et al. (2009). Morphological analyses In order to compare fish of different sizes, linear regression analysis (SPSS 2008) was used to determine feature length relative to total length; for example, body depth was compared with total length. All measurements were then standardised by dividing each variable’s measurement by the total length (except snout length and eye diameter, which were divided by head length). Any sample with missing data was removed from the analysis. Individual catchment data were compared to investigate possible recent morphological changes due to population isolation. To examine longer-term morphological changes in G. nigrostriata between coastal plains, the catchment data were grouped in the

Genetic analysis of G. nigrostriata in Western Australia

SwCP or southern coast. Principal component analysis (PCA) ordinations were produced using R (R Development Core Team 2011) to give an indication of whether the data groups separated, and if so, which morphological variables most contributed to the separation. To further examine which variables most contributed to the difference between catchments or species, a similarity of percentages (SIMPER) routine was conducted using Euclidean distance (Clarke and Warwick 2001) in the Primer statistical software package version 6 (Primer-E Ltd, Plymouth, UK). The five variables with the most difference between catchments and coastal plain (determined from SIMPER and PCA analyses) were tested for statistical significance using univariate analyses. Standardised measurement data were normalised and count data underwent square root transformation (O’Hara and Kotze 2010). All data were checked for normality using the Shapiro–Wilk statistic and then Levene’s test was used to assess the homogeneity of variances (SPSS 2008). Parametric analysis of variance test (ANOVA, with a Type I error of 0.05) was used to test statistically significant differences between groups with data meeting these assumptions. Any data not normally distributed (P $ 0.05) were examined with the non-parametric Kruskal–Wallis test. Genetic methods Using a scalpel, muscle tissue was removed from each specimen immediately following morphometric measurement and placed into a 2 mL microtube for storage at 208C. Approximately 2 mm3 of muscle tissue from each specimen was used for genomic DNA extraction using XytXtract – ANDE (Castalanelli et al. 2010) (www.ande.com.au), following the manufacturer’s instructions. Polymerase chain reaction (PCR) was used to amplify a portion of the CR and Cyt b for further analysis. Control region amplification used universal fish primers H16498 50 CCTGAAG TAGGAACCAGATG 30 (Meyer et al. 1990) and 50 AACTCT CACCCCTAGCTCCCAAAG 30 (N. Philips, 2009, pers. comm.). Primers used for Cyt b were H15149 50 CCCTCAGAATGA TATTTGTCCTCA 30 from Waters et al. (2000), who reduced the length from the original primer in Kocher et al. (1989), and L14724 50 CGAAGCTTGATGAAAAACCATCGTTG 30 (Paä¨bo 1990). All amplifications were conducted in a 25 mL reaction volume, including 2.5 mL of extracted DNA (1 : 10 dilution DNA : water, which was the equivalent of 20–25 ng mL1), 1 polymerase buffer (Roche, Switzerland), 1.8 mM of MgCl2, 0.2 mM of each primer, 200 mM of each dNTP and 0.5 U of FastStart High Fidelity Taq polymerase (Roche, Switzerland). The thermocycler conditions were: initial denaturation at 958C for 10 min; 45 cycles of denaturing at 958C for 30 s, annealing at 468C (CR) or 48.88C (Cyt b) for 30 s, and 728C extension for 1 min; with a single final extension period of 728C for 7 min. Samples that were refractory to amplification were also analysed with Phusion Taq (Finnzymes, Finland) amended to the reaction mixture. The Phusion reaction mixture included: Taq buffer 1 (Finnzymes, Finland), 2.5 mM of MgCl2 (Roche, Switzerland), 0.2 mM each of forward and reverse primers (as above), 200 mM of dNTP (Roche, Switzerland), 0.1 mL of Phusion Taq (Finnzymes, Finland) and 1 mL of DNA template (concentration of 50 ng mL1) and made to a total of 25 mL per sample with PCR-grade water per reaction. The PCR protocol


189

was initial denaturation at 988C for 2 min then 45 cycles of 10 s denaturing at 988C, 20 s annealing at 608C (both CR and Cyt b), 30 s extension at 728C and a final extension at 728C for 5 min. Quality and quantity of the amplified PCR products were determined on a 1.5% agarose gel. Polymerase chain reaction products were treated before sequencing by the addition of 10 U of Exonuclease I (New England Biolabs, Ipswich, MA, USA) and 2.5 U of Antarctic Phosphatase (New England Bioscience) to the post PCR reaction, followed by incubation at 378C for 30 min and enzyme inactivated by heating to 808C for 20 min. Prepared PCR products for sequencing were stored at 208C until required. Sequencing of the amplified genes was carried out by Macrogen Corporation (Seoul, South Korea) using an Applied Biosystems ABI 3730 48-capillary DNA analyser using Big Dye Terminator Technology according to the manufacturer’s protocols (Applied Biosystems, Foster City, CA, USA). Genetic analysis The Cyt b and CR sequences (Accession numbers KJ401125– KJ401300) were edited using CodonCode Aligner 3.0.3 (CodonCode Corporation, Centerville, VA, USA) and each locus aligned using a built-in version of MUSCLE (Edgar 2004). Sequence analyses for intra- and inter-population pairwise distances were calculated using the p-distance model in MEGA5 (Tamura et al. 2011). To estimate time to most recent common ancestor (TMRCA), Bayesian evolutionary analysis by sampling trees (BEAST; Drummond and Rambaut 2007) was used. Only the Cyt b region was used so that the data from other galaxiid fish variance studies (i.e. Burridge et al. 2012; Unmack et al. 2012) could be included. Multiple trees were generated using a combination of three calibration nodes. The first node (Fig. 2a) included the root height parameters that were set to prior distribution normal, mean 55 million years (Ma; s.d. 1.5 Ma), which returned quantiles of 52.53 and 57.47 Ma, 5% and 95% respectively. The upper bounds corresponded to the split between Brachygalaxias and Galaxiella families, calculated by Burridge et al. (2012), and the lower represented the terrestrial separation of Australia and Antarctica which occurred ,52 million years ago (Lawver and Gahagan 2003), and which was also used by Unmack et al. (2012) when dating the Galaxiella species. The second node (Fig. 2c, node D), the split between G. pusilla and G. nigrostriata/G. munda, where the prior distribution was set to normal, offset 14 Ma (representing the mid-Miocene transgression and formation of the Nullarbor limestone over most of the Eucla basin (Benbow et al. 1995; mean ¼ 1, sd ¼ 1). The third node (Fig. 2c, node I) was the split between Neochanna burrowsius and Neochanna rekohua dated at 1 Ma (sd ¼ 0.1). Combinations of evolution models (generalised time reversible (GTR) and Hasegawa, Kishino and Yano (HKY)) and clock models (strict and lognormal) were evaluated with gen ¼ 10 000 000, log ¼ 1000. Hasegawa, Kishino and Yano and the clock model lognormal continuously generated higher effective samples sizes (ESS) values and was used to produce the final trees. A Yule (pure birth process) prior was employed for the tree. Tree Annotator v. 1.5.4 was used to generate the consensus tree, using the following parameters: burn-in at 1000, posterior probability 0.5 and mean heights (Drummond and Rambaut 2007).

190

(a)


114⬚30⬘0⬙E

115⬚0⬘0⬙E

115⬚30⬘0⬙E


116⬚0⬘0⬙E

116⬚30⬘0⬙E

117⬚0⬘0⬘

(c)

(b) 32⬚0⬘0⬙S

N I∗

B∗

33⬚0⬘0⬙S

Swan coastal plain

32⬚30⬘0⬙S

C

A∗

G

D 34⬚0⬘0⬙S

F

So uth er

H nc oa st

114⬚30⬘0⬙E

60.0 50.0 40.0 30.0 20.0 10.0

40 km

35⬚0⬘0⬙S 115⬚0⬘0⬙E

115⬚30⬘0⬙E

116⬚0⬘0⬙E

116⬚30⬘0⬙E

117⬚0⬘0⬙

Southern coast

E 34⬚30⬘0⬙S

Swan coastal P.

33⬚30⬘0⬙S

Lovettia sealii Retropinna tasmanica Lepidogalaxias salamandroides Brachygalaxias gothei Brachygalaxias bullocki Galaxias maculatus Neochanna cleaveri Neochanna apoda Neochanna rekohua Neochanna burrowsius Neochanna diversus Neochanna heleios Galaxias auratus Galaxias divergens Galaxias gollumoides Galaxias pullus Galaxias paucispondylus Galaxias fasciatus Paragalaxias eleotroides Paragalaxias mesotes 1 Paragalaxias mesotes 2 Paragalaxias julianus 1 Paragalaxias julianus 2 Paragalaxias dissimilis Galaxiella pusilla Mb13 Melaleuca Park LCS126 Lake Chandla 5K108 K25 Pn98 Kemerton 1K134 Pn28 5K109 Sr36 Sr1 Scott River Sr2 Sr113 Sr38 Cw8 Cw26 Gardner River Cw55 Cw51 Cp41 Cp6 Shannon River Cp45 Cw117 Galaxiella munda

0

MA

Fig. 2. (a) Distribution map of Galaxiella nigrostriata populations. (b) Map of Western Australia highlighting the area of interest. (c) Time to most recent common ancestor phylogenetic tree in millions of years, * indicates which nodes were calibrated.

Results Morphometric analysis Of the 18 morphometric measurements and fin counts, five characters were significantly different (P , 0.005) between grouped populations of the SwCP and southern coastal region (Fig. 3a; Table 1). The five characters that differed the most between the two groups were: number of dorsal ray fins, D; length of pelvic fin, P2 L; length of base of dorsal fin, DL; eye diameter, ED; and head length, HL (Table 1). On average, P2 L was smaller for the SwCP group, but D, DL, ED and HL were larger. The PCA scatterplot showed a separation between the two groups (Fig. 3b). The Melaleuca Park and Gardner populations, separated by 340 km, were found to be most dissimilar, with an average squared distance of 40.4. The most similar populations were Melaleuca Park and Kemerton, both on the SwCP and 157 km apart, with an average dissimilarity of 30.4. Both morphological results were congruent with the genetic results. Genetic data Genetic results were obtained from all populations. The CR alignment (376 bp in length) had 12 variable sites, of which 11

were parsimony informative. Thirteen haplotypes were generated from 88 samples (Table 2). In comparison, the Cyt b alignment (374 bp in length) had 30 polymorphic sites, of which 10 were parsimony informative. This region produced more haplotypes (23) from the same number of specimens. The polymorphisms observed in the Cyt b gene resulted in no nonsynonymous amino acid sequence changes and contained no stop codons. For both genetic fragments no haplotypes were shared between populations and all populations contained multiple haplotypes, except Melaleuca Park. For all populations Cyt b had higher genetic divergence and significantly more haplotypes, apart from Kemerton. Biogeography Four combinations of priors were tested to determine the effect that the three different calibration points had on node dates: A, A and D, A and I, and all three. Due to minimal difference between the four prior combinations, the mean was used to infer divergence dates (Table 3). For all parameters of interest the ESS exceeded 400. The split between G. pusilla and the sister taxa G. munda and G. nigrostriata was estimated at 28.3 Ma. The



(a)

(b) 4

2

PCA 2 (23.68%)

191

4

Melaleuca Park

2 Kemerton

0

Southern coast 0

Scott River

⫺2

Swan coastal plain

⫺2

Gardner River Shannon River

⫺4

⫺4 ⫺2

0

2

⫺2

4

0

2

4

PCA 1 (55.13%) Fig. 3. Principal components analysis scatterplot showing the differences among populations (a) and between the Swan coastal plain and southern coastal region populations (b) for the five morphological characters: number dorsal ray fins, D; length of pelvic fin, P2 L; length of base of dorsal fin, DL; body depth at anus, BD; and eye diameter, ED. Table 1. Results of similarity of percentages analyses and statistical testing of Galaxiella nigrostriata morphological differences between grouped populations in the Swan coastal plain (SwCP) and southern coast region Variables are standardised values (variable/TL) except for D (ray counts), and are arranged from highest to lowest by mean dissimilarity between regions; only variables contributing .6% are listed; contribution values show how much each variable contributed to the overall difference between coastal plains. P2L, length of pelvic fin; DL, length of base of dorsal fin; ED, eye diameter; HL, head length Variable D (n) P2L DL ED HL

Mean for SwCP (s.e.)

Mean for southern coast region (s.e.)

Mean dissimilarity % (s.d.)

Contribution (%)

Cumulative (%)

Statistic

p-value

8.1 0.1 4.7 0.4 6.7 0.1 6.8 0.1 19.8 0.2

7.3 0.1 6.6 0.2 6.2 0.1 6.3 0.1 18.8 0.3

2.79 1.00 2.49 0.81 2.35 0.97 2.28 0.74 2.25 0.75

7.65 6.83 6.45 6.26 6.18

7.65 14.48 20.93 27.19 33.37

13.58# 12.64* 10.14^ 9.10^ 7.64^

,0.01 ,0.01 ,0.01 ,0.01 ,0.01

Kruskal–Wallis #x21,57, ANOVA *F1,51, ^F1,56. Table 2. Intra- and inter-population sequence divergence (%) for the two mitochondrial fragments control region (CR) and cytochrome b (Cyt b) across five catchment areas Cyt b inter-population divergences shaded in grey; *1, CR/Cyt b Melaleuca Kemerton Scott Gardener Shannon Specimens (88) Haplotypes (13/23)*1 Max intra divergence*1 Melaleuca Park Kemerton Scott Gardner Shannon

5 1/1 0/0 0.5 1.3 2.8 3.8

54 8/7 1.1/0.8 0.6 1.8 3.3 4.3

12 1/6 0/0.5 1.7 1.6 1.9 2.9

11 2/6 0.3/0.8 1.5 1.3 1.3

5 1/3 0/0.5 1.4 1 1.4 0.7

1.9

G. nigrostriata and G. munda split was estimated at 17.9 Ma. In G. nigrostriata the oldest node was estimated at 5.1 Ma, which corresponds to the separation of the Gardener and Shannon rivers from the ScCP and SwCP clade (Fig. 2c). The divergence between Gardner River and Shannon River clades was estimated

at 0.8 Ma. The Kemerton and Scott River split was estimated at 3.4 Ma. The only difference that the prior combinations had on divergence estimates was for N. rekohua versus N. burrowsius, where divergences ranged from 1 to 4.8 Ma. Discussion This study used two mitochondrial genes to explore the historic and current connectivity of G. nigrostriata populations within and among the SwCP and southern coast region of Western Australia. The results of this study revealed distinct and isolated populations, where mtDNA haplotypes were not shared between collection sites. Based on these results we were able to: (i) show significant morphological differences between the SwCP and southern coast populations; (ii) postulate about the biogeography of G. nigrostriata; and (iii) discuss the current distribution and conservation status of G. nigrostriata. Melaleuca Park and Gardner were identified as the two catchments with the greatest morphological difference, and were also the furthest geographic distance apart. Galaxiella nigrostriata were slightly, although statistically significantly, larger in the southern coast region wetlands, which may be due

192



Table 3. Time to most recent common ancestor (TMRCA) in millions of years Calibration points: (A) Brachygalaxias and Galaxiella; (B) split between Galaxiella species; (C) split between Neochanna burrowsius and Neochanna rekohua Node

TMRCA node (sister/sister)

A B C D E F G H I

Out groups versus Galaxiid Brachygalaxias versus Galaxias and Neochanna and Paraglaxias Paraglaxias versus Galaxias and Neochanna Galaxiella pusilla versus G. munda and G. nigrostriata G. munda versus G. nigrostriata Swan and Scott coastal plains versus Gardner and Shannon rivers Swan coastal plain versus Scott coastal plain Gardner versus Shannon River N. rekohua versus N. burrowsius

to different spawning times. However, dorsal fin ray counts were higher on SwCP specimens. Latitudinal effects on fish morphology can be influenced by environmental factors such as temperature changes, decreased hydroperiod and connectivity between wetlands and prey availability (Baber et al. 2002; Munch and Conover 2002; O’Reilly and Horn 2004). Given the high dependence of this species on seasonal rainfall to break aestivation and trigger spawning, a plausible agent for morphological differentiation is hydroperiod (Gill and Neira 1994; Morgan et al. 1998a). Wetlands in the southern coast region have a longer hydroperiod than the SwCP, because of winter rainfall starting earlier and higher annual rainfall. This gives G. nigrostriata in the southern coast region an extended growing period (Smith et al. 2002; Bamford and Bamford 2003). Based on the mitochondrial data, each population showed depauperate genetic connectivity. For freshwater taxa in the south-west of Western Australia this is not an uncommon phenomena and has been well documented in decapods (Gouws et al. 2006, 2010), isopods (Gouws et al. 2010), other Galaxiella (Unmack et al. 2012) and frogs (Wardell-Johnson and Roberts 1993; Driscoll 1998). The two most similar southern populations, morphologically and genetically, Shannon and Gardener river catchments, shared a recent ancestor ,800 000 years ago despite being separated by ,14 km. Driscoll (1998) showed that for the frog Geocrinia rosea there was considerable genetic difference between populations within and between Gardner and Shannon Rivers at a scale of less than 7.5 km, with the most extreme variation found within the Shannon River. While Driscoll (1998) reported no consistent patterns that prevented dispersal of G. rosea, Wardell-Johnson and Roberts (1993) suggested hilly terrain and unsuitable habitat as potential geographical barriers. This low level of species dispersal between wetlands was also observed in decapod populations on the SwCP. Gouws and Stewart (2007) showed that populations of Paramphisopus palustris were isolated between 2.08 and 4.34 Ma, yet the populations were within 100 km. While the divergence between the SwCP populations (Kemerton and Melaleuca Park) were lower (0.6% and 0.5% for Cyt b and CR respectively), these results, as well as other studies, are consistent in that they show significant isolation between catchments and wetlands despite geographic distance in the south-west of Western Australia.

A

A–D

A–I

A–D–I

Mean

54.7 48.1 40.2 31.4 21.6 5.0 3.5 0.8 4.8

54.4 47.3 39.2 26.3 15.3 5.0 3.5 0.8 4.6

54.4 46.2 37.7 29.7 19.6 5.4 3.0 0.9 1.0

54.2 45.7 37.1 26.0 15.1 5.1 3.5 0.8 1.1

54.4 46.8 38.6 28.3 17.9 5.1 3.4 0.8 2.9

Isolation of each population may be explained by the formation of the coastal dune systems (SwCP). During the late Tertiary or early Pleistocene and before the SwCP, the Darling scarp, which is currently the SwCP eastern boundary, formed coastal cliffs (Playford et al. 1976). As the glacial cycles caused sea levels to oscillate, three main Holocene and Pleistocene coastal dune systems where formed (Quindalup, Spearwood and Bassendean, in order from the coast; McArthur and Bettenay 1960). Interestingly, all of the known G. nigrostriata distribution records from the SwCP are located between 1.4 and 8.0 km from the Darling scarp, but, more importantly, where the Bassendean dune system adjoins the Guildford formation at the base of the Darling scarp. These geographical formation dates coincide with the TMRCA for the Scott River and SwCP populations, 3.5 Ma. Furthermore, in the southern coast all known G. nigrostriata localities are inland from the Bassendean dunes. Based on these results, it seems that G. nigrostriata distribution expanded during the early Pleistocene when the shoreline was near the base of the Darling scarp. The lack of connectivity among populations that our study found is congruent with Unmack et al. (2012), who rejected their previous hypothesis that freshwater fish populations have more connectivity when sea levels are lower during glacial maximums (Unmack 2001). Based on our data, the climatic oscillations occurring for the last 800 000 years may not yet have led to significant changes in either connectivity or isolation between coastal plains. Rather, it is more plausible that G. nigrostriata populations have simply become restricted to current wetland refugia since first expanding during the early Pleistocene, and have since continued to diverge in isolation. Whether widespread draining of south-west wetlands over the past ,150 years (Morgan et al. 1998b; Smith et al. 2002) or the acidification of Australian wetlands (Byrne et al. 2008; McCullough and Horwitz 2010) has led to the demise of G. nigrostriata in the SwCP is unknown. However, it is apparent that effort needs to expended to protect this species from further decline given that each population is genetically and somewhat morphologically distinct. Further taxonomic consideration may eventually lead to several new species being identified, each requiring management and protective strategies to ensure maintenance of this biodiversity.


Acknowledgements We thank Kemerton Silica Sand Pty for funding the research and a scholarship for D. Galeotti for a MSc. In particular, Mark Gell, resident manager at the time, is thanked for his vision in initiating and supporting this project. Moreover, we would like to thank the two anonymous reviewers and Glenn Moore for their comments that vastly improved the quality of the manuscript. Fish collection and euthanasia procedures were approved by the Edith Cowan University Animal Ethics Committee (Approval 2913).

References Baber, M. J., Childers, D. L., Babbitt, K. J., and Anderson, D. H. (2002). Controls on fish distribution and abundance in temporary wetlands. Canadian Journal of Fisheries and Aquatic Sciences 59, 1441–1450. doi:10.1139/F02-116 Bamford, M. J., and Bamford, A. R. (2003). Kemerton silica sand fauna monitoring 18th December 2002: progress report. (Bamford Consulting Ecologists: Perth, Western Australia.) Beatty, S., Morgan, D., and Allen, M. (2009). Freshwater fish and crayfish communities of the Carbunup and Buayanyup rivers: conservation significance and management considerations. (Centre for Fish and Fisheries Research, Murdoch University: Perth, Western Australia.) Benbow, M. C., Alley, N. F., Callen, R. A., and Greenwood, D. R. (1995). Geological history and palaeoclimate. In ‘The Geology of South Australia, Volume 2: The Phanerozoic’. South Australian Geological Survey Bulletin 54. (Eds J. F. Drexel and W. V. Preiss.) pp. 208–217. (SARIG: Adelaide, South Australia.) Bonnett, M. L., and Sykes, J. R. E. (2002). Habitat preferences of giant kokopu, Galaxias argenteus. New Zealand Journal of Marine and Freshwater Research 36, 13–24. doi:10.1080/00288330.2002.9517067 Burridge, C. P., Mcdowall, R. M., Craw, D., Wilson, M. V. H., and Waters, J. M. (2012). Marine dispersal as a pre-requisite for Gondwanan vicariance among elements of the galaxiid fish fauna. Journal of Biogeography 39, 306–321. doi:10.1111/J.1365-2699.2011. 02600.X Byrne, M., Yeates, D. K., Joseph, L., Kearney, M., Bowler, J., Williams, M. J., Cooper, S., Donnellan, S. C., Keogh, J. S., Leys, R., Melville, J., Murphy, D. J., Porch, N., and Wyrwoll, K. H. (2008). Birth of a biome: insights into the assembly and maintenance of the Australian arid zone biota. Molecular Ecology 17, 4398–4417. doi:10.1111/J.1365-294X. 2008.03899.X Castalanelli, M. A., Severtson, D. L., Brumley, C. J., Szito, A., Foottit, R. G., Grimm, M., Munyard, K., and Groth, D. M. (2010). A rapid nondestructive DNA extraction method for insects and other arthropods. Journal of Asia-Pacific Entomology 13, 243–248. doi:10.1016/ J.ASPEN.2010.04.003 Castalanelli, M. A., Cunningham, R. J., Davis, M. B., Groth, D. M., and Grimm, M. (2013). When genes go wild: highly variable internal transcibed spacer1 and conserved mitochondrial DNA haplotypes used to examine the genetic diversity and dispersal pathways of invasive Hylotrupes bajulus in Western Australia. Agricultural and Forest Entomology 15, 236–244. doi:10.1111/AFE.12010 Chen, S. Y., Zhang, R. D., Feng, J. G., Xiao, H., Li, W. X., Zan, R. G., and Zhang, Y. P. (2009). Exploring factors shaping population genetic structure of the freshwater fish Sinocyclocheilus grahami (Teleostei, Cyprinidae). Journal of Fish Biology 74, 1774–1786. doi:10.1111/ J.1095-8649.2009.02204.X Christensen, P. (1982). The distribution of Lepidogalaxias salamandroides and other small fresh-water fishes in the lower southwest of Western Australia. Journal of the Royal Society of Western Australia 65, 131–141. Clarke, K. R., and Warwick, R. M. (2001). ‘Change in Marine Communities: an Approach to Statistical Analysis and Interpretation.’ (Plymouth Marine Laboratory: Plymouth.)


193

Driscoll, D. A. (1998). Genetic structure of the frogs Geocrinia lutea and Geocrinia rosea reflects extreme population divergence and range changes, not dispersal barriers. Evolution 52, 1147–1157. doi:10.2307/ 2411244 Drummond, A. J., and Rambaut, A. (2007). BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7, 214. doi:10.1186/1471-2148-7-214 Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32, 1792–1797. doi:10.1093/NAR/GKH340 Galeotti, D. M., McCullough, C. D., and Lund, M. A. (2010). Black-stripe minnow Galaxiella nigrostriata (Shipway 1953) (Pisces: Galaxiidae), a review and discussion. Journal of the Royal Society of Western Australia 93, 13–20. Gill, H. S., and Morgan, D. L. (1996). Threatened fishes of the world: Galaxiella nigrostriata (Shipway, 1953) (Galaxiidae). Environmental Biology of Fishes 47, 344. doi:10.1007/BF00005048 Gill, H. S., and Neira, F. J. (1994). Larval descriptions of three galaxiid fishes endemic to south-western Australia: Galaxias occidentalis, Galaxiella munda and Galaxiella nigrostriata (Salmoniformes: Galaxiidae). Marine and Freshwater Research 45, 1307–1317. doi:10.1071/MF9941307 Gouws, G., and Stewart, B. (2007). From genetic structure to wetland conservation: a freshwater isopod Paramphisopus palustris (Phreatoicidea: Amphisopidae) from the Swan coastal plain, Western Australia. Hydrobiologia 589, 249–263. doi:10.1007/S10750-007-0742-2 Gouws, G., Stewart, B. A., and Daniels, S. R. (2006). Phylogeographic structure of a freshwater crayfish (Decapoda: Parastacidae: Cherax preissii) in south-western Australia. Marine and Freshwater Research 57, 837–848. doi:10.1071/MF05248 Gouws, G., Stewart, B. A., and Daniels, S. R. (2010). Phylogeographic structure in the gilgie (Decapoda: Parastacidae: Cherax quinquecarinatus): a south-western Australian freshwater crayfish. Biological Journal of the Linnean Society. Linnean Society of London 101, 385–402. doi:10.1111/J.1095-8312.2010.01485.X Haag-Liautard, C., Coffey, N., Houle, D., Lynch, M., Charlesworth, B., and Keightley, P. (2008). Direct estimation of the mitochondrial DNA mutation rate in Drosophila melanogaster. PLoS Biology 6, e204. doi:10.1371/JOURNAL.PBIO.0060204 Hardie, S. A., White, R. W. G., and Barmuta, L. A. (2007). Reproductive biology of the threatened golden galaxias Galaxias auratus Johnston and the influence of lake hydrology. Journal of Fish Biology 71, 1820–1840. doi:10.1111/J.1095-8649.2007.01648.X Hopper, S. D., and Gioia, P. (2004). The southwest Australian floristic region: evolution and conservation of a global hot spot of biodiversity. Annual Review of Ecology Evolution and Systematics 35, 623–650. doi:10.1146/ANNUREV.ECOLSYS.35.112202.130201 Horwitz, P., Bradshaw, D., Hopper, S., Davies, P. M., Froend, R., and Bradshaw, F. (2008). Hydrological change escalates risk of ecosystem stress in Australia’s threatened biodiversity hotspot. Journal of the Royal Society of Western Australia 91, 1–11. Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Paä¨bo, S., Villablanca, F. X., and Wilson, A. C. (1989). Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences of the United States of America 86, 6196–6200. doi:10.1073/PNAS.86.16.6196 Lambeck, K., and Nakada, M. (1990). Late Pleistocene and Holocene sea-level change along the Australian coast. Palaeogeography, Palaeoclimatology, Palaeoecology 89, 143–176. doi:10.1016/0031-0182(90) 90056-D Lawver, L. A., and Gahagan, L. M. (2003). Evolution of Cenozoic seaways in the circum-Antarctic region. Palaeogeography, Palaeoclimatology, Palaeoecology 198, 11–37. doi:10.1016/S0031-0182(03)00392-4 Ling, N., and Gleeson, D. M. (2001). A new species of mudfish, Neochanna (Teleostei: Galaxiidae), from northern New Zealand. Journal of the

194



Royal Society of New Zealand 31, 385–392. doi:10.1080/03014223. 2001.9517660 Malcolm, J., Liu, C., Neilson, R., Hansen, L., and Hannah, L. (2006). Global warming and extinctions of endemic species from biodiversity hotspots. Conservation Biology 20, 538–548. doi:10.1111/J.1523-1739.2006. 00364.X McArthur, W. M., and Bettenay, E. (1960). ‘The Development and Distribution of the Soils of the Swan Coastal Plain, Western Australia.’ (CSIRO Soil Publication: Melbourne, Australia.) McCullough, C. D., and Hicks, B. J. (2002). Estimating the abundance of banded kokopu (Galaxias fasciatus Gray) in small streams by nocturnal counts under spotlight illumination. New Zealand Natural Sciences 27, 1–14. McCullough, C. D., and Horwitz, P. (2010). Vulnerability of organic acid tolerant wetland biota to the effects of inorganic acidification. Science of the Total Environment 408, 1868–1877. doi:10.1016/J.SCITOTENV. 2010.01.034 McLure, N., and Horwitz, P. (2009). ‘An Investigation of Aquatic Macroinvertebrate Occurrence and Water Quality at Lake Chandala, Western Australia.’ (Centre for Ecosystem Management, Edith Cowan University: Perth, Western Australia.) Meyer, A., Kocher, T. D., Basasibwaki, P., and Wilson, A. C. (1990). Monophyletic origin of Lake Victoria cichlid fishes suggested by mitochondrial DNA sequences. Nature 347, 550–553. doi:10.1038/ 347550A0 Morgan, D., Gill, H. S., and Potter, I. C. (1998a). Distribution, identification and biology of freshwater fishes in south-western Australia. Records of the Western Australian Museum, Supplement No. 56, 97 pp. Morgan, D. L., Gill, H. S., and Potter, I. C. (1998b). Distribution, identification and biology of freshwater fishes in south-western Australia. Records of the Western Australian Museum, Supplement No. 56, 97 pp. Munch, S., and Conover, D. (2002). Accounting for local physiological adaptation in bioenergetic models: testing hypotheses for growth rate evolution by virtual transplant experiments. Canadian Journal of Fisheries and Aquatic Sciences 59, 393–403. doi:10.1139/F02-013 Myers, N., Mittermeier, R., Mittermeier, C., Da Fonseca, G., and Kent, J. (2000). Biodiversity hotspots for conservation priorities. Nature 403, 853–858. doi:10.1038/35002501 Nagy, Z. T. (2010). A hands-on overview of tissue preservation methods for molecular genetic analyses. Organisms, Diversity & Evolution 10, 91–105. doi:10.1007/S13127-010-0012-4 O’Hara, R. B., and Kotze, D. J. (2010). Do not log-transform count data. Methods in Ecology and Evolution 1, 118–122. doi:10.1111/ J.2041-210X.2010.00021.X O’Reilly, K. M., and Horn, M. H. (2004). Phenotypic variation among populations of Atherinops affinis (Atherinopsidae) with insights from a geometric morphometric analysis. Journal of Fish Biology 64, 1117–1135. doi:10.1111/J.1095-8649.2004.00379.X Paä¨bo, S. (1990). Amplifying ancient DNA. In ‘PCR Protocols: A Guide to Methods and Applications’. (Eds M. A. Innis, D. H. Gelfand, J. J. Sninsky and T. J. White.) pp. 159–166. (Academic Press: San Diego, USA.) Playford, P. E., Cockbain, A. E., and Low, G. H. (1976). ‘Geology of the Perth Basin Western Australia.’ Geological Survey of Western Australia.

R Development Core Team (2011). R: a language and environment for statistical computing. (R Foundation for Statistical Computing: Vienna, Austria.) ´ lvarez, P., and Cotano, U. (2013). Rodriguez-Ezpeleta, N., Mendibil, I., A Effect of fish sampling and tissue storage conditions in DNA quality: considerations for genomic studies. Revista de Investigaciones Marinas 20, 77–87. Scalici, M., and Gibertini, G. (2009). Freshwater goby life history in a Mediterranean stream. Hydrobiologia 628, 177–189. doi:10.1007/ S10750-009-9755-3 Shipway, B. (1953). Additional records of fishes occurring in the freshwaters of Western Australia. The Western Australian Naturalist 3, 173–177. Smith, K. D., Knott, B., and Jasinska, E. J. (2002). Biology of the blackstripe minnow Galaxiella nigrostriata (Galaxiidae) in an acidic, blackwater lake in Melaleuca Park near Perth, Western Australia. Records of the Western Australian Museum 21, 277–284. SPSS (2008). SPSS 17.0.0. (SPSS Inc.: Chicago, IL.) Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28, 2731–2739. doi:10.1093/ MOLBEV/MSR121 Tseng, M. C., Jean, C. T., Tsai, W. L., and Chen, N. C. (2009). Distinguishing between two sympatric Acanthopagrus species from Dapeng Bay, Taiwan, using morphometric and genetic characters. Journal of Fish Biology 74, 357–376. doi:10.1111/J.1095-8649.2008.02049.X Unmack, P. J. (2001). Biogeography of Australian freshwater fishes. Journal of Biogeography 28, 1053–1089. doi:10.1046/J.1365-2699. 2001.00615.X Unmack, P. J., Bagley, J. C., Adams, M., Hammer, M. P., and Johnson, J. B. (2012). Molecular phylogeny and phylogeography of the Australian freshwater fish genus Galaxiella, with an emphasis on dwarf galaxias (G. pusilla). PLoS ONE 7, e38433. doi:10.1371/JOURNAL.PONE. 0038433 Vrijenhoek, R. C. (1996). Conservation genetics of North American desert fishes. In ‘Conservation Genetics: Case Histories From Nature’. (Eds J. C. Avise and J. L. Hamrick) pp. 394–412. (Chapman and Hall: New York, NY.) Wardell-Johnson, G., and Roberts, J. D. (1993). Biogeographic barriers in a subdued landscape: the distribution of the Geocrinia rosea (Anura: Myobatrachidae) complex in south-western Australia. Journal of Biogeography 20, 95–108. doi:10.2307/2845743 Waters, J. M., Andre´s Lo´pez, J., and Wallis, G. P. (2000). Molecular phylogenetics and biogeography of galaxiid fishes (Osteichthyes: Galaxiidae): dispersal, vicariance, and the position of Lepidogalaxias salamandroides. Systematic Biology 49, 777–795. doi:10.1080/ 106351500750049824 Watts, R. J., Storey, A. W., Hebbert, D. R., and Edward, D. H. D. (1995). Genetic and morphological differences between populations of the western minnow, Galaxias occidentalis, from two river systems in south-western Australia. Marine and Freshwater Research 46, 769–777. doi:10.1071/MF9950769

www.publish.csiro.au/journals/mfr