Glucagon Gene Expression Is Negatively Regulated by Hepatocyte ...

MOLECULAR AND CELLULAR BIOLOGY, May 1994, p. 3514-3523

Vol. 14, No. 5

0270-7306/94/$04.00+0

Copyright C 1994, American Society for Microbiology

Glucagon Gene Expression Is Negatively Regulated by Hepatocyte Nuclear Factor 31 JACQUES PHILIPPE,1* CORINNE MOREL,' AND VINCENT R. PREZIOSO2 Departments of Genetics & Microbiology and Medicine, Centre Medical Universitaire, 1211 Geneva 4,

Switzerland,' and Laboratory of Molecular Cell Biology, Rockefeller University, New York, New York 100212 Received 29 November 1993/Returned for modification 16 December 1993/Accepted 27 January 1994

Pancreatic expression of the glucagon gene depends on multiple transcription factors interacting with at least three DNA control elements: G,, the upstream promoter element, and G2 and G3, two enhancer-like sequences. We report here that the major enhancer of the rat glucagon gene, G2, interacts with three protein complexes, Al, A2, and A3. A2 is detected only in islet cells, and impairment of its binding to mutant G2 causes a marked decrease in transcriptional activity. We identify Al as hepatocyte nuclear factor 30 (HNF-30), a member of the HNF-3 DNA-binding protein family found in abundance in the liver which has been proposed to play a role in the formation of gut-related organs. HNF-3, binds G2 on a site which overlaps A2 and acts as a repressor of glucagon gene expression, as demonstrated by mutational analyses of G2 and by cotransfection of HNF-3I cDNA along with reporter genes containing G2 into glucagon-producing cells. Our data implicate HNF-3p in the control of glucagon gene expression and strengthen the idea of endodermal origin of the islet cells.

Expression of the glucagon gene is restricted to the ot cells of the endocrine pancreas, the L cells of the intestine, and certain areas of the brain (18). We previously demonstrated in transient-transfection studies that 300 bp of the 5'-flanking region of the rat glucagon gene were sufficient to confer pancreas-specific expression (4). In more detailed studies, we localized an upstream promoter element, GI, and two enhancer-like sequences, G2 and G3 (21). GI was shown to be critical for ox cell-specific expression, whereas G2 and G3, when placed upstream of a heterologous promoter, could function in phenotypically different endocrine islet cells, e.g., insulin- and somatostatin-producing cells, but not in nonislet cells. G2 is a 20-bp DNA control element acting as a potent activator of glucagon gene expression. Although G2 is unable to activate transcription in nonislet cells, it can interact with nuclear proteins present in a limited number of cell types (21). We observed, in particular, similar DNase I footprint patterns for nuclear extracts from glucagon-producing cells and from the hepatoma cell line HepG2. This suggested that liver and pancreatic endocrine islet cells might have common DNA-binding proteins that have a limited cell type distribution. We now report that at least three nuclear complexes interact with G2. Two of them, A1 and A2, bind overlapping sequences within G2 and appear to act in opposite directions on transcription. Whereas A2 is islet specific, Al represents hepatocyte nuclear factor 3p (HNF-3,3), a DNA-binding protein found in abundance in the liver (12). HNF-3,B is indeed present in pancreatic endocrine cells, binds G2, and functions as a repressor of glucagon gene expression. HNF-3r belongs to a gene family which includes two other members, HNF-3oL and

HNF-3-y (13). These genes are expressed in organs (lung, liver, and intestine) that derive from the embryonic gut after the outpouching of endodermal cells. This family of genes is thought to play a role in forming gut-related organs and to have maintained this function from early in evolution, inasmuch as the Drosophila protein homolog of the HNF-3 family, fork head, is required for proper development of the salivary glands, foregut, and hindgut (10, 31). Our observations implicate HNF-31 in the expression of the glucagon gene and strengthen the idea of endodermal origin of the endocrine pancreas. MATERIALS AND METHODS

Plasmids. Oligonucleotides containing the wild-type and mutated G2 (nucleotides [nt] - 201 to - 165) with BamHIcompatible ends were inserted into a BamHI site 5' of the glucagon promoter (nt - 136 to +51 or - 31 to +51) or 5' of the thymidine kinase promoter linked to the chloramphenicol acetyltransferase (CAT) gene (21, 23). The oligonucleotides were synthesized on a Gene Assembler by the phosphoramidite method (Pharmacia) and are listed in Fig. 1. All constructs were sequenced to confirm identity and orientation by the enzymatic method. HNF-3ot, -,, and -,y cDNAs, inserted into an expression vector (12), were generously provided by E. Lai (Memorial Sloan-Kettering Cancer Center, New York, N.Y.) and R. H. Costa (University of Illinois College of Medicine, Chicago). The mutant HNF-3, cDNA was constructed by adding 8 nt (EcoRI linkers) to the blunt-ended BgIII site located at bp 740 within the sequence encoding the DNA-binding domain, resulting in the addition of four amino acids (two isoleucines, one glycine, and one proline) in HNF3,B. Oligonucleotides containing the HNF-1 and the HNF-3 binding sites of the L-type pyruvate kinase (2) and transthyretin (1) gene promoters, respectively, were given by M. Raymondjean (H6pital Cochin, Paris, France). The HNF-3 binding site was inserted into a Hincll site 5' of the glucagon

* Corresponding author. Mailing address: Dept. of Genetics & Microbiology, Centre Medical Universitaire, 9, Avenue de Champel, 1211 Geneva 4, Switzerland. Phone: (41 22) 702.56.66. Fax: (41 22) 346.72.37.

3514

GLUCAGON GENE EXPRESSION

VOL. 14, 1994 -200

-190

-180

3515

-170

G2

AGGCACAAGAGTAAATAAAAAGTTTCCGGGCCTCT

62M1

AGGCACAAGAGTCCCAT6CA6C TTTCCGGGCCTCT

G2M2

AGGCACCCA6C TAAATAAAAATCC66TTAACCTCT

G2M3

AGGCACAAGAGTAAATACGCAGTTTCCGGGCCTCT

G2M4

AGGCACAAGAGT CCC TAAAAAGTTTCCGGGCCTCT

G2M5

AGGCATTAGAGTAAATAAAAAGTTTCCGGGCCTCT

G2M6

AGGCACATTAGTAAATAAAAAGTTTCCGGGCCTCT

G2M7

AGGCACAAGAGTAAACCAAAAGTTTCCGGGCCTCT

FIG. 1. Coding strands of the wild-type and mutant G, oligonucleotides used in the gel retardation assays. Not shown are BamHI ends on both sides. The same oligonucleotides were subcloned into the BamHI site 5' of the glucagon promoter (nt - 136 to +51 or nt -31 to +51) or 5' of the thymidine kinase promoter linked to the CAT gene (see Materials and Methods).

promoter (nt - 136 to +51) linked to the CAT gene. The plasmid containing four HNF-3 binding sites 5' of the cytomegalovirus promoter and the CAT gene was generously provided by R. H. Costa (16). Cell culture and transfection studies. Islet cell lines InRlG9 (28), ocTC1 (24), fTC1 (5), and RINB2 (20) and nonislet cell lines (rat pheochromocytoma PC,2, mouse Ltk- fibroblasts, Syrian baby hamster kidney BHK-21, human hepatoma HepG2, human epidermoid laryngeal carcinoma HEp-2, rat epithelial ileum IEC, Epstein-Barr virus-transformed B lymphocyte Mann, and chronic lymphocytic leukemia Cohen cells) were cultured in RPMI 1640 medium containing 5% fetal calf serum and 5% newborn calf serum. InR1G9 cells were transfected in suspension by the DEAE-dextran method (21) with 1 [Lg of reporter plasmid; 1, 2.5, or 5 jig of effector plasmid (expression vector alone or vector containing either the wild-type or the mutant HNF-30 cDNA); and 1 jig of the plasmid PSV2Apap to monitor transfection efficiency. pSV,Apap is a plasmid containing the human placental alkaline phosphatase gene driven by the simian virus 40 long terminal repeat (8). pRSVCAT and poCAT were used as positive and negative controls, respectively (25). Cell extracts were prepared 48 h after transfection and analyzed for CAT and alkaline phosphatase activities as described before (19). Protein concentrations were determined with a Bio-Rad protein assay kit. Cell extracts and gel retardation assays. Nuclear extracts were prepared by the method of Dignam et al. (3) and Schreiber et al. (27). Gel retardation assays were performed as described before (19). Oligonucleotides were labeled by bluntending the BamHI ends with Klenow enzyme and using both 32P-labeled and unlabeled nucleotides. Antibodies to HNF-3a,

were raised as described previously (13) and incubated for 20 min with nuclear extracts before adding labeled DNA. Northern (RNA blot) analysis. Total RNA was extracted from InR1G9 cells by the guanidine-cesium chloride method. Polyadenylated mRNA was isolated by the Poly A Tract mRNA isolation kit (Promega, Madison, Wis.). Northern blot analysis was performed as described previously (22) with HNF-3o, -13, and -y cDNAs or an HNF-303-specific DNA fragment corresponding to the first 340 bp of the HNF-31 cDNA (13). The cDNAs were labeled by the random-primed method. Methylation interference assay. The methylation interference assay was performed essentially as described previously by Staudt et al. (29). The 32P-end-labeled coding or noncoding strand of the G2 oligonucleotide probe was partially methylated with dimethyl sulfate. DNA-protein complexes were separated from the free probe by gel retardation assays. The A2 complex was separated from Al after addition of the HNF-33-specific antibody to the reaction mixture. Transfer to DEAE membranes and elution of the methylated DNA fragments were done by the method of Singh et al. (28). The fragments were then cleaved with piperidine and electrophoresed on sequencing gels.

-P, and -y

RESULTS To characterize the factors which interact with the control element G2, we examined whether we could detect proteinDNA complexes by gel retardation assays. Using nuclear extracts from the glucagon-producing cell line InRIG9, we

3516

A :omp

PHILIPPE ET AL.

MOL. CELL. BIOL. 1 2

B 1 -

2 G2

4 3 HNFi

3

4

comp

G 2

-

t.. X

Al,

A2 D> A1

6

7

A

1

2

3

4

1 2

B

3

4

5

6

7

8

9

H NF3

%-

,,A 3 b>

A3 F

5

5 6 HNF3

:*

+

:

A3lo A2 >

A1 Al

A3

1

t

A .'`~

Al

'

.

I

W At

W-W.

n, s,

M

;;.:

1:1

.;,-

,.Ri;

AAih, ij FIG. 2. Binding of nuclear proteins from InRIG9 cells to G2 control elements. Gel retardation assays were performed by incubating 32P-labeled G2 with nuclear extracts. The mixture was then electrophoresed on a nondenaturing, low-ionic-strength polyacrylamide gel. (A) Binding of InRlG9 nuclear extracts to G2 and effects of competitor DNA. Nuclear extracts (4 pg) were incubated with 32P-labeled G,. Lane 1, no competitor; lane 2, 50-fold excess of unlabeled G2; lanes 3 and 4, 50- and 100-fold excess of unlabeled HNF-1 binding site, respectively; lanes 5 and 6, 50- and 100-fold excess of unlabeled HNF-3 binding site, respectively. (B) Differential competition by the G2 and HNF-3 binding sites. Nuclear extracts (4 ,ug) were used in all lanes. Lane 1, no competitor; lanes 2 to 4, 10-, 25-, and 50-fold excess of unlabeled G2, respectively; lanes 5 to 7, 10-, 25-, and 50-fold excess of unlabeled HNF-3 binding site, respectively. The positions of A,, A2, and A3 are marked. Dots indicate either nonspecific or nonreproducibly observed protein-DNA complexes.

identified two different complexes, A1 and A3 which specifically competed with an excess of unlabeled G2 (Fig. 2A) but not by GI, G3, or the octamer recognition sequence (26) (data not shown). A, was later shown to mask a third complex, A2, which could only be separated from A, by differential competition or mutational analysis. Since we previously reported the presence of nuclear proteins interacting with G2 in islet and HepG2 cells (21), we attempted to inhibit the observed complexes by using oligonucleotides containing the binding sites for the DNA-binding proteins HNF-1 and HNF-3, found in the L-type pyruvate kinase (2) and the transthyretin (1) gene promoters, respectively. Whereas the TABLE 1. HNF-3 binding sites Gene

Sequence

Location

Rat aldolase B Human t,-antitrypsin

TATTGAATAAA TATTGACTTTG CATTGATTTAG TATTGACTTAG TATTTGTGTAG TGTTTGTTTTA TATTTACTCT

- 120 to - 110 - 376 to - 366 - 195 to - 185 - 96 to - 106 - 140 to - 130 - 93 to -85 - 184 to - 193

Mouse transthyretin Rat HNF-3 3 Rat glucagon

FIG. 3. Cell type distribution of the A1, A2, and A3 complexes. Gel retardation assays were performed as described in the legend to Fig. 1 with 32P-labeled G2. Nuclear extracts (4 Fig) were used in all experiments. (A) Profiles obtained from nuclear proteins extracted from phenotypically different islet cell lines, including glucagon-producing cells (lane 1, InRIG9 cells; lane 2, oxTCI cells), and cells synthesizing insulin (lane 3, 3TC1 cells) or somatostatin (lane 4, RINB2 cells). (B) Comparison of InRIG9 profile with those of nuclear extracts from nonislet cells. Lane 1, InRIG9 cells; lanes 2 to 9, rat pheochromocytoma PC12, Syrian baby hamster kidney BHK-21, rat epithelial ileum IEC, mouse fibroblast Ltk -, Epstein-Barr virus-transformed human B lymphocyte Mann, human chronic lymphocytic leukemia Cohen, human epidermoid laryngeal carcinoma HEp-2, and human hepatoma HepG2 cells, respectively. The positions of the A,, A2, and A3 complexes are marked. Dots indicate either nonspecific or nonreproducibly observed protein-DNA complexes.

HNF-1 oligonucleotide was unable to compete for any of the complexes (Fig. 2A, lanes 3 and 4), the HNF-3 binding site competed for A1 but not A2 or A3 (lanes 5 and 6). This result was not totally unexpected, since we identified a sequence within G2 that had significant homology with several previously described binding sites for HNF-3 (Table 1). Complex A1 displayed a higher affinity for the HNF-3 site than G2, as it was displaced by relatively lower amounts of HNF-3 competitor (Fig. 2B). We then examined the cell type distribution of the three complexes interacting with G2 in phenotypically different islet cell types (Fig. 3A). Both the A1 and A3 complexes were observed in glucagon- (InRlG9 and oxTCI, lanes I and 2), insulin- (,BTCI, lane 3), and somatostatin-producing cells (RINB2, lane 4) in similar amounts. The presence of A2 in these islet cell lines was later confirmed by both differential competition with HNF-3 and G2 sites and the presence of a residual complex after the addition of an HNF-33-specific antibody (data not shown). This finding was consistent with previous observations showing the transactivating properties of G, in these different islet cell phenotypes. In nonislet cells, a complex migrating with the same mobility as A, was detected in the intestinal cell line IEC (Fig. 3B, lane 4), the laryngeal carcinoma cell line Hep2 (lane 8), and HepG2 cells (lane 9). The formation of these complexes

GLUCAGON GENE EXPRESSION

VOL. 14, 1994 1 2

3

4

5

6

7

8

9 10 11 12 13 14

InR1Gs comp

G2

A

B

1

2

3

3517

4

HepG2 HNF3

G2

HNF3

FIG. 5. Northern blot analysis of HNF-3,B mRNA. (A) Polyadenylated mRNA from glucagon-producing cells (InRlG9) was electrophoresed, transferred to a nylon membrane, and hybridized with a 32P-labeled HNF-3,B-specific probe (see text). Arrowheads point to the two separate bands detected. (B) The same cDNA probe was used to hybridize total RNA obtained from glucagon-producing (lanes 1 and 2, InRlG9 and otTC1, respectively), insulin-producing (lane 3, 3TCI), and somatostatin-producing (lane 4, RINB2) cells. > and *, 28S and 18S rRNA, respectively.

Our results on the tissue-specific distribution of A1, A2,

FIG. 4. Binding of nuclear proteins from InR1G9 and HepG2 cells to the HNF-3 binding site of the transthyretin gene promoter. Gel retardation assays were done as described in the legend to Fig. 1 except that the 32P-labeled HNF-3 binding site was used. Nuclear extracts (4 jig) were assessed for all conditions. Lanes 1 to 7, nuclear extracts from InRlG9 cells; lanes 8 to 14, nuclear extracts from HepG2 cells. Lanes 1 and 8, no competitor DNA; lanes 2 to 4 and 9 to 11, 10-, 25-, and 50-fold excess of unlabeled G2, respectively; lanes 5 to 7 and 12 to 14, 10-, 25-, and 50-fold excess of unlabeled HNF-3 binding site, respectively. The arrowhead points to the different specific complexes binding to G2 and HNF-3 sites. Dots indicate either nonspecific or nonreproducibly observed protein-DNA complexes.

was specifically inhibited by an excess of G2 (data not shown); addition of specific antibodies to HNF-3ot, -P, and -y to the reaction mix later revealed these complexes to represent HNF-31 in IEC and HEp2 cells and HNF-3ot and -,B in HepG2 cells (data not shown). A2 was not detected in any of the cell lines tested, as addition of HNF-3-specific antibodies (ox, I, and -y forms) to IEC, Hep2, and HepG2 cell extracts completely removed the complexes migrating with the mobility of A1-A2 (data not shown). A2 thus appears to be islet cell specific. By contrast, complexes migrating close to A3 were present in most cells after prolonged film exposure; whether the A3 complexes are identical in islet and nonislet cells remains to be established. Additional protein complexes not present in islet cells were observed in nonislet cells, particularly Ltk- and Mann cells. The nature of these complexes is unknown, although they were specifically inhibited by G2 (data not shown). We also investigated whether nuclear proteins extracted from InRlG9 cells could bind the labeled HNF-3 site (Fig. 4). Two complexes, corresponding to HNF-3a and HNF-3P (as assessed by the addition of antibodies against the different forms of HNF-3), were observed with HepG2 nuclear extracts (Fig. 4, lanes 8 to 14). A specific complex migrating with the same mobility as the HNF-31 complex of HepG2 nuclear extracts was detected in InRlG9 extracts (Fig. 4, lanes 1 to 7). Both InR1G9 and HepG2 complexes displayed a higher affinity for the HNF-3 site than G2, as assessed by competition analysis. As expected, the A2 complex was unable to interact with the HNF-3 site.

and A3 indicate that A2 is the only islet-specific protein complex. This information, combined with our previous observation that G2 cannot function in nonislet cells, suggests that A2 is necessary for the positive transactivating properties of G2.

To confirm the expression of the HNF-3 gene family in islet cells and to determine whether one or multiple forms of HNF-3 proteins are present, we first performed Northern blot analysis with the HNF-3ox, HNF-31, and HNF-3y cDNAs. Irrespective of the cDNA probe used, we found two mRNA species of 2.4 and 2.2 kb in InR1G9 cells (data not shown). The detection of both mRNAs with all three probes was attributed to the highly homologous DNA sequence encoding the DNA-binding domain of the three HNF-3 proteins (13). These two mRNA species were detected in similar amounts in all the different islet cell types that we examined (data not shown). Since similar mRNAs were previously shown to correspond to HNF-31 (2.4 kb) and HNF-3-y (2.2 kb) with specific probes (13), we used an HNF-3p3-specific DNA fragment corresponding to the 5'-most end of the HNF-31 cDNA. With this probe, both mRNAs were still detected in all islet cell types, suggesting that they were generated from the HNF-31 gene (Fig. 5A and B). We recently cloned additional HNF-3r cDNAs from an InRlG9 cDNA library; their sizes correspond to that observed by Northern analysis (19a). We then analyzed which HNF-3 protein was interacting with G2 by adding specific antibodies to HNF-3x, -I, and -,y in the reaction mix for the gel retardation assay (Fig. 6A). The A, complex but not A2 was specifically shifted upward by the HNF-3,B antiserum (Fig. 6A, lane 3) but not by antiserum to HNF-3ot or HNF-3-y (lanes 2 and 4). The same result was obtained when, in addition to the anti-HNF-3,B antibody, the unlabeled HNF-3 binding site was added as a competitor (no displacement of A2), whereas competition by G2 removed the A2 complex (Fig. 6B). Our data thus indicate that HNF-31 is expressed in islet cells, interacts with G2, and can be separated from the A2 complex, in the gel retardation assay, by competition with the G2 and HNF-3 sites. To test the transactivating properties of HNF-3,B on glucagon gene expression, we cotransfected an expression vector containing the HNF-31 cDNA and a reporter construct in which we fused G2 (nt -201 to 165) and the first 136 bp of the glucagon gene promoter to the CAT gene. Figure 7 shows that cotransfection of HNF-3P cDNA into InR1G9 -

3518

PHILIPPE ET AL.

A

MOL. CELL. BIOL.

1

2

3

4

5

6

1 2

B

7

3

4

P

Ab Cl

;3

d

3

i

Y

HNF3

G2

'4

A 3.0 -j

.-

5

...L

I

A3 I'

., -:.I k6 -

yr.I;i, -'-

MI

ft

I

ii r

"

I

-,

J.l-.,I.-

0

FIG. 6. Detection of different HNF-3 proteins by specific antibodies. Gel retardation assays were performed with 4 jig of nuclear extracts from InR1G9 cells and 32P-labeled G2. (A) Lane 1, no antiserum; lanes 2 and 5, HNF-3a immune (i) and preimmune (p) antisera, respectively; lanes 3 and 6, HNF-3, immune (i) and preimmune (p) antisera, respectively; lanes 4 and 7, HNF-3-y immune (i) and preimmune (p) antisera, respectively. The positions of the A,, A2, and A3 complexes are marked. The A3 complex was barely detectable. (B) Lane 1, no antiserum; lanes 2 to 5, HNF-313 immune (i) antiserum; lanes 3 and 5, 50-fold excess of unlabeled G2 and HNF-3 oligonucleotide, respectively. Dots indicate either nonspecific or nonreproducibly observed protein-DNA complexes.

cells inhibited expression of the reporter gene in a dosedependent manner compared with the control expression plasmid, whereas cotransfection of an HNF-3P cDNA mutated in the sequences encoding the DNA-binding domain had no effect. HNF-313 appeared to be overexpressed in these experiments, as nuclear extracts prepared from transfected cells showed a relative increase in the Al complex level (data not shown). The effect of HNF-31 was specific to the G2 binding site, as overexpression of HNF-31 did not modify the activity of a reporter construct containing G3 linked to the first 136 bp of the glucagon gene promoter (Fig. 7) or of pSV40CAT (data not shown). Cotransfection of HNF-3ot and -,y gave quantitatively and qualitatively similar results (data not

shown).

We also examined the effects of HNF-31 overexpression on additional plasmids containing G2 or an HNF-3 binding site (Fig. 7B). Cotransfection of the HNF-3,B cDNA with 292 bp of the rat glucagon gene 5' region (containing G2 and G3) or with plasmids containing G2 in one or two copies, linked either to the TATA box of the rat glucagon gene (G2G,-31) or to the herpesvirus thymidine kinase promoter (G2put) gave results that were qualitatively and quantitatively similar to those obtained with G2-136. By contrast, overexpression of HNF-31 had no effect on the construct containing an HNF-3 binding site linked to the first 136 bp of the rat glucagon gene or on four HNF-3 binding sites linked to the cytomegalovirus

promoter. Of note, the basal expression of the plasmid HNF3136 was at least as high as that observed with G2-136, while the plasmid containing four HNF-3 binding sites 5' of a heterologous promoter (4-HNF-3) displayed no basal activity and could not be activated by overexpression of HNF-3p. These results suggest that overexpression of HNF-3,B leads to a decrease in the transcriptional activity conferred by G2 whether G2 is placed upstream of its promoter or of a heterologous promoter or even directly 5' of its own TATA box. Repression of transcription by HNF-3,B does not occur on an HNF-3 binding site, indicating that it is relatively specific for G2. The high basal activity observed with HNF3-136 suggests that factors other than the form of HNF-3P used in our cotransfection studies and present in InR1G9 cells can interact with HNF-3 binding sites and activate transcription. This activation requires the upstream promoter element of the glucagon gene, as four HNF-3 binding sites upstream of the TATA box have no basal activity. Since preliminary experiments indicate that different HNF-31 forms are present in InR1G9 cells, it will be of interest to examine their transactivating properties. To localize the binding sites of A, and A2, we performed methylation interference assays (Fig. 8). We observed partial protection of nt - 190, - 191, and - 192 on the coding strand and of nt - 185 and - 189 on the noncoding strand for A,. A hypermethylated A nucleotide was noted on the coding

GLUCAGON GENE EXPRESSION

VOL. 14, 1994 63-136

62-136

A

G3

-292

G2

QO

_

G2

e3

G2

U H 2.5/1

U

H Hm

U

5/1

5/1

_ I

.

j

ISV TI

I

O

G2puL H 1/1

136

0

G2-136

e;

U

3519

-

G2 G2 31 G2G2-31

I

E133

4xHNF3

00H 4H3F3

-136

I

I

.

l

l~~~~~~~~~~~~~

cmv

== 25

so

75

100

125

0SO

RELATIVE CAT ACTIVITY FIG. 7. Transcriptional repression by cotransfection of HNF-31 in InRlG9 cells. (A) InR1G9 cells were cotransfected with an indicator plasmid containing G2 or G3 and the glucagon gene promoter linked to the CAT gene (G2-136 and G3-136, respectively), the HNF-3,3 cDNA subcloned into an expression vector, and a control plasmid, pSV2Apap (7). V, cotransfection of the expression vector; H, cotransfection of the HNF-3,B cDNA; Hm, cotransfection of a mutant HNF-3,B cDNA (see Materials and Methods). The increasing amounts of expression vector or HNF-3,B cDNA cotransfected with the reporter plasmids are indicated as molar ratios (1:1, 2.5:1, and 5:1). CAT activities were measured 48 h later and expressed as a percentage of the activity obtained in cells cotransfected with the indicator and control plasmids and the expression vector alone. Results represent the mean ± standard error of the mean for six experiments. (B) InR1G9 cells were cotransfected with the indicator plasmid and a fivefold excess of vector or vector containing the HNF-313 cDNA. CAT activities were expressed as described above. Results represent the mean ± standard error of the mean for four different experiments. HSV TK, herpesvirus thymidine kinase promoter; CMV, cytomegalovirus promoter.

strand at the 3' end of the presumed HNF-3 binding site (Table 1). By contrast, nt - 179 (coding strand) and nt - 185 (noncoding strand) were found to be weakly protected by A2. These data indicate that A1 and A2 interact with G2 with different specificities. We then examined the effects of specific mutations within G2 (Fig. 1) to better delineate the recognition sequence of the A1, A2, and A3 complexes and to correlate changes in protein binding with G2 function. The binding capacity of G2 mutants for the three complexes was first assessed by competition with labeled wild-type G2 (Fig. 9A). G2 Ml, G2 M2, and G2 M4 (Fig. 9A, lanes 3, 4, and 6, respectively) at a 100-fold molar excess were unable to inhibit the formation of A1 and A2 (both complexes were present, as assessed by differential competition with the HNF-3 binding site), whereas competition was observed to different degrees with mutants G2 M7 (lane 9), G2 M6 (lane 8), G2 M3 (lane 5), and G2 M5 (lane 7) (in order of increasing efficiency). A3 was inhibited by all the mutants except G2 M2, although competition with G2 M1 was less efficient than with the other mutants (data not

shown). Binding of A1, A2, and A3 was also evaluated with the labeled G2 mutants. As expected, G2 M1, G2 M2, and G2 M4 were unable to bind A1 and A2 (data not shown), whereas the pattern obtained with G2 M5 was indistinguishable from the wild-type G2 pattern (Fig. 9B, lane 3). Decreased intensity of the band representing A1 and A2 complexes was observed with mutants G2 M3 (Fig. 9C, lanes 4 to 6) and G2 M6 (Fig. 9B, lanes 4 to 6).

To assess whether the formation of one or both complexes concerned, the HNF-31 antibody was added to binding reaction mixes containing nuclear extracts and labeled G2 M3 or G2 M6. Removal of A1 by the HNF-3,3 antibody allowed us to evaluate the A2 complex, which was comparable in intensity to that observed with wild-type G2 for both G2 M3 (data not shown) and G2 M6 (Fig. 9B, lane 5). G2 M7 displayed markedly decreased binding of A1 and A2 (data not shown). Decreased or absent binding of A3 was noted with mutations on the 3' side of G2 (G2 M1, G2 M2, and G2 M3), whereas mutations on the 5' side had no effect (G2 M4, G2 M5, G2 M6, and G2 M7). The results of binding and competition studies obtained with labeled wild-type and mutant G2 were in good was

agreement.

The functional consequences of these mutations were assessed by transfection of constructs containing wild-type or mutant G2 and the first 136 bp of the glucagon gene promoter fused to the CAT gene (Fig. 10). Mutants which did not bind Al or A2 (G2 M1 and G2 M4) had completely lost G2 function. The M7 mutation also led to a decrease in activity. By contrast, G2 M3 and G2 M6, which affected A, binding more than A2 binding, induced a 50 and 70% increase in transcription, respectively. Mutant G2 M. behaved like wild-type G2 for both binding and activity. Overall, these results indicate that a relatively more selective impairment of A1 formation (G2 M3 and G2 M6) correlates with an increase in the transcriptional ability of G2, whereas changes in both A1 and A2 result in decreased activity. Our data also suggest that A3 does not play a major role in the basal

3520

''."sh::.;9,-e^

PHILIPPE ET AL.

A

G G G C C T

:s..e

s.e

_

T

BF

glucagon gene is under stringent control for its expression. Moreover, the mechanisms by which the glucagon gene is expressed in these three cell types might differ, as the DNA sequences necessary for islet cx cell expression are not sufficient for the activation of the gene in the L cells of the intestine

(6). By transient-transfection studies, we previously defined three DNA control elements, G,, G2, and G3, that are critical for regulated expression of the glucagon gene in pan-

*ftw:*WAW- .:*P*.: G T T

aft,

C

T c

T T

_ ;s

T A A A

:::

:.

*:

*

.:,

A A

sjjS

,.,

"''.''

},

nucleotides

partially protected by

A1

and

A2,

respectively; hypermethylation. (B) Noncoding strand of G2. The sequence is indicated alongside the lanes, and the arrows indicate partially protected nucleotides as in panel A. (C) Summary of methylation changes found on the coding and noncoding strands of G2. Partially protected nucleotides are indicated byOL (A,) and* (A2). -, hypermethylated nucleotide.

transcriptional properties of G2, although it is possible that protein-protein interactions between A3, Al, A2, and potentially other factors may have an impact on transcription that we have been unable to detect by our limited mutational studies.

DISCUSSION Glucagon gene expression is limited to specific cell types present in three different organs: the pancreas, the intestine, and the brain (18). This cell specificity indicates that the

creatic islet cells (21, 30). All three elements were shown to function only in islet cells (21). Whereas G2 and G3 could activate transcription in all the different islet cell phenotypes when linked to a heterologous promoter, Gl, the upstream promoter element, was silent in nonislet and islet cells except for glucagon-producing cells. The conclusion from these studies was that tissue-specific glucagon gene transcription depends on the interaction of a variety of transcription factors interacting with at least three cis-acting DNA elements. G2 is the major enhancer of the glucagon gene; it is placed in tandem with G3, although this arrangement does not confer any synergistic or additive transcriptional properties (21, 23). G2 can function in both orientations, but its activity is distance dependent. Deletion of G2 leads to a major loss of activity, close to that obtained with a promoterless plasmid (21). In these studies, we have investigated the factors which modulate glucagon gene expression by binding to G2. We show that nuclear extracts from different islet cell phenotypes contain three protein complexes, A1, A2, and A3, which interact specifically with G2. As determined by mutational analysis, A3 binds to G2 on its 3' side independently of Al and A2 and may be present in a wide variety of cell types. Functionally, A3 does not appear to have major effects on glucagon gene transcription. However, we certainly cannot exclude the possibility that A3 influences, through proteinprotein interactions, the transactivating properties of A1 and A2 or of any additional factors involved in regulation of the glucagon gene. By contrast to A3, A2 may have a limited tissue distribution, since we detected it only in islet cells. This result, when interpreted along with the fact that G2 can function only in islet cells, strongly suggests that the positive effects of G2 are dependent on the binding of A2. We thus propose that A2 is an islet cell-restricted transactivating factor critical for expression of the glucagon gene. We have identified Al as a member of the HNF-3 gene family. This family is composed of three different genes encoding the HNF-3a, HNF-3r, and HNF-3,y proteins, which are important transcriptional activators, in association with other factors found in abundance in the liver, of several liver-specific genes (12). Several lines of evidence indicate that HNF-3, corresponds to A1. A1 is detected in the liver and in bronchial and intestinal cells, an organ-specific distribution which was reported previously for HNF-3,B (12). In addition, a 10-bp sequence within G2 bears strong homology to the human ao1-antitrypsin HNF-3 binding site (Table 1). More importantly, the A1 complex is specifically supershifted by antiHNF-3,B antibodies. We thus conclude that HNF-3,B is present in islet cells and binds G2. The functional consequences of the interactions between HNF-31 and G2 indicate that HNF-3,B is a repressor of glucagon gene expression; this is in agreement with our previous observations on the inability of G2 to transactivate in HepG2 cells (21). The physiological implications of HNF-31 in the regulation of the glucagon gene remain to be elucidated. Preliminary results indicate that HNF-3p mRNA is more abundant in transformed islet cells than in adult islet cells (data not shown).

GLUCAGON GENE EXPRESSION

VOL. 14, 1994

A

1

2

3

4

5

6

7

8

9

comp - G 2 MI M2 M3 M4 M5 M6 M7

B 1 G2 2 -

3 4

5

G2M5 -

6

G2M6

p

-

A3

A2

64

A,

1

comp

-

2

3

G2M3

G2

G2

4

5

6

G2M3

G2

G2M3

Ab

.A3

'

C

3521



A1-

i

fi

A.

FIG. 9. Binding of Al, A2, and A3 complexes to mutant G2 oligonucleotides. Gel retardation assays were performed with 4 ,ug of nuclear extracts from InRlG9 cells and 32P-labeled wild-type or mutant G,. (A) Inhibition of formation of the A,, A2, and A3 complexes bound to 32P-labeled G2 (lane 1) by wild-type G, (lane 2, 25-fold molar excess) and G2 mutants Ml, M2, M3, M4, M5, M6, and M7 (lanes 3 to 9, respectively) in 100-fold molar excess). (B) Lanes I and 2, 32P-labeled G2; lane 3, 32P-labeled G2 M5; lanes 4 to 6, 32P-labeled G2 M6. HNF-3 immune (i) and preimmune (p) antisera were added to the binding reactions shown in lanes 2 and 5 (immune) and 6 (preimmune). (C) Lanes 1 to 3, labeled G2; lanes 4 to 6, labeled G2 M3. Competition was performed with a 50-fold excess of unlabeled Go M3 (lanes 2 and 5) or Go (lanes 3 and 6). The positions of complexes Al, A2, and A3 are marked. Dots indicate either nonspecific or nonreproducibly observed DNA-protein complexes.

It may thus be hypothesized that HNF-31 plays a role in the developmental expression of the glucagon gene. In that regard, in the gel retardation assay, the A, complex is perplexingly more intense than A2. At least two explanations can be offered: (i) A, may have a higher affinity for G2 or be more abundant than A2 and (ii) Al may be composed of multiple HNF-3,B forms. The latter possibility appears to be highly likely, as at least three different HNF-3r forms with the same DNA-binding domain are present in InRlG9 cells (19a). Whether these forms have different functional consequences and vary during development needs to be investigated further. More detailed studies on the characterization of the different HNF-3f3 mRNAs and the presence and the relative abundance of these forms during islet cell differentiation will help to better understand the role of HNF-3r. Although HNF-3, has been shown to be a positive transactivator of liver-specific genes (12, 17), it acts as a repressor of the glucagon gene. The mechanisms by which the same protein can act as both a positive and a negative regulator are not fully elucidated; however, most of the transcriptional repressors described to date also function as activators (14). We hypothesize that HNF-3,B and the A2 complex bind on overlapping sites and propose that HNF-3,B inhibits glucagon gene expression by competition with A2; in addition, it is likely that the DNA-binding site, G2 as opposed to HNF-3, and interactions

with other proteins must change the activator HNF-3,B into a repressor (9). The presence of a liver-specific DNA-binding protein such as HNF-3,B in islet cells goes beyond the regulation of the glucagon gene. HNF-3 proteins are in an early position in the hierarchy of activators implicated in hepatocyte differentiation, since they regulate the promoter activity, along with HNF-4, of the DNA-binding protein HNF-1 (11). Furthermore, HNF-3r binds its own gene promoter and is involved in a positive autofeedback loop of synthesis, which is a property of many factors involved in cellular determination (17). HNF-313 is expressed in cell types that derive from the endoderm (lung, liver, and intestine) (12, 13) and displays 90% homology in the DNA-binding domain with fork head, a Drosophila melanogaster homeotic gene that promotes terminal development of the salivary glands, foregut, and hindgut (10, 31). Overall, the presence of HNF-3r in all islet cell phenotypes strengthens the hypothesis that these cells derive from the endoderm and suggests additional roles for HNF-3P in the control of islet gene expression. HNF-31 is not the only liver-specific DNA-binding protein present in islet cells. HNF-1 has recently been reported to be expressed in islet cells (7, 15) and proposed to participate in regulation of the insulin gene. The role of liver-specific proteins in islet cell function should shed some light on the development of the endocrine pancreas.

3522

PHILIPPE ET AL.

MOL. CESLL. BIOL.

G2

1-H

0G2MI

00G2M4 0G2MS 0>G2M3

1-

G2M6

02-

i

71

G2M7

0)-

9

25

50

75

100

125

150

% RELATIVE CAT ACTIVrrY InR1G9 cells were transfected with an indicator plasmid containing wild-type or on transcription. 10. of G2 mutations Consequences FIG. mutant G2 and 136 bp of the rat glucagon gene promoter linked to the CAT gene along with a control plasmid, pSV,Apap (7). CAT activities were assessed 48 h after transfection as described in the text and are expressed as a percentage of the activity obtained with wild-type G. Results represent the mean ± standard error of the mean for eight experiments.

ACKNOWLEDGMENTS We thank Isabelle Pacheco for expert technical help and Marie de Peyer for typing the manuscript. This work was supported by the Swiss National Science Foundation and the Sir Jules Thorn Foundation. REFERENCES 1. Costa, R. H., D. R. Grayson, and J. E. Darnell. 1989. Multiple hepatocyte-enriched nuclear factors function in the regulation of transthyretin and cx,-antitrypsin genes. Mol. Cell. Biol. 9:14151425. 2. Decaux, J. F., B. Antoine, and A. Kahn. 1989. Regulation of the expression of the L-type pyruvate kinase gene in adult rat hepatocytes in primary cultures. J. Biol. Chem. 264:11584-11590. 3. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:14751489. 4. Drucker, D. J., J. Philippe, L. Jepeal, and J. F. Habener. 1987. Glucagon gene 5'-flanking sequences promote islet cell-specific glucagon gene transcription. J. Biol. Chem. 262:15659-15665. 5. Efrat, S., S. Linde, H. Kofod, D. Spector, M. Delannoy, S. Grant, D. Hanahan, and S. Baekkeskov. 1988. Beta cell lines derived from transgenic mice expressing a hybrid insulin gene-oncogene. Proc. Natl. Acad. Sci. USA 85:9037-9041. 6. Efrat, S., G. Teitelman, M. Anwar, D. Ruggiero, and D. Hanahan. 1988. Glucagon gene regulatory region directs oncoprotein expression to neurons and pancreatic alpha cells. Neuron 1:605-613. 7. Emens, L. A., D. W. Landers, and L. G. Moss. 1992. Hepatocyte nuclear factor lox is expressed in a hamster insulinoma line and transactivates the rat insulin I gene. Proc. Natl. Acad. Sci. USA 89:7300-7304. 8. Henthorn, P., P. Zervos, M. Raducha, H. Harris, and T. Kadesh. 1988. Expression of a human placental alkaline phosphatase gene in transfected cells: use as a reporter for studies of gene expression. Proc. NatI. Acad. Sci. USA 85:6342-6346. 9. Johnson, F. B., and M. A. Krasnow. 1992. Differential regulation of transcription preinitiation complex assembly by activator and repressor homeo domain protein. Genes Dev. 6:2177-2189.

10. Jiirgens, G., and D. Weigel. 1988. Terminal versus segmental development in the Drosophila embryo: the role of the homeotic gene fork head. Wilhelm Roux's Arch. Dev. Biol. 197:345-354. 11. Kuo, C. J., P. B. Conley, L. Chen, F. M. Sladek, J. E. Darnell, and G. R. Crabtree. 1990. Transcriptional hierarchy involved in mammalian cell type specification. Nature (London) 355:457-461. 12. Lai, E., and J. E. Darnell. 1991. Transcriptional control in hepatocytes: a window on development. Trends Biochem. Sci. 16:427-430. 13. Lai, E., V. R. Prezioso, W. Tao, W. S. Chen, and J. E. Darnell. 1991. Hepatocyte nuclear factor 3x belongs to a gene family in mammals that is homologous to the Drosophila homeotic gene fork head. Genes Dev. 5:416-427. 14. Levine, M., and J. L. Manley. 1989. Transcriptional repression of eukaryotic promoters. Cell 59:405-408. 15. Noguchi, T., K. Yamada, K. Yamagata, M. Taneka, H. Nakijama, E. Imai, Z. Wang, and T. Tanaka. 1991. Expression of liver type pyruvate kinase in insulinoma cells: involvement of LF-B, (HNF,). Biochem. Biophys. Res. Commun. 181:259-264. 16. Pani, L., D. G. Overdier, A. Porcella, X. Qian, E. Lai, and R. H. Costa. 1992. Hepatocyte nuclear factor 3, contains two transcriptional activation domains, one of which is novel and conserved with the Drosophila fork head protein. Mol. Cell. Biol. 12:37233732. 17. Pani, L., X. Qian, D. Clevidence, and R. H. Costa. 1992. The restricted promoter activity of the liver transcription factor hepatocyte nuclear factor 3,B involves a cell-specific factor and positive autoactivation. Mol. Cell. Biol. 12:552-562. 18. Philippe, J. 1991. Structure and pancreatic expression of the insulin and glucagon genes. Endocr. Rev. 12:252-271. 19. Philippe, J. 1991. Insulin regulation of the glucagon gene is mediated by an insulin-responsive DNA element. Proc. Natl. Acad. Sci. USA 88:7224-7227. 19a.Philippe, J. Unpublished data. 20. Philippe, J., W. L. Chick, and J. F. Habener. 1987. Multipotential phenotypic expression of genes encoding peptide hormones in clonal rat insulinoma cell lines. J. Clin. Invest. 79:351-358. 21. Philippe, J., D. J. Drucker, W. Knepel, L. Jepeal, Z. Misulovin, and J. F. Habener. 1988. Alpha cell-specific expression of the

VOL. 14, 1994

22. 23. 24.

25. 26. 27.

glucagon gene is conferred to the glucagon promoter element by the interactions of DNA-binding proteins. Mol. Cell. Biol. 8:48774888. Philippe, J., and M. Missotten. 1990. Functional characterization of a cAMP-responsive element of the rat insulin gene. J. Biol. Chem. 265:1465-1469. Philippe, J., and S. Rochat. 1991. Strict distance requirements for transcriptional activation by two regulatory elements of the glucagon gene. DNA Cell Biol. 10:119-124. Powers, A. C., S. Efrat, S. Mojsov, D. Spector, J. F. Habener, and D. Hanahan. 1990. Proglucagon processing similar to normal islets in pancreatic ot-like cell line derived from transgenic mouse tumor. Diabetes 39:406-414. Prost, E., and D. D. Moore. 1986. CAT expression vectors for analysis of eukaryotic promoters and enhancers. Gene 45:107-111. Rosenfeld, M. G. 1991. POU-domain transcription factors: pouer-ful developmental regulators. Genes Dev. 5:897-907. Schreiber, E., P. Mathias, M. M. Muller, and W. Schaffner. 1988. Identification of a novel lymphoid specific octamer binding protein

GLUCAGON GENE EXPRESSION

28.

29.

30.

31.

3523

(OTF-2B) by proteolytic clipping bandshift assay. EMBO J. 7:4221-4229. Singh, M., J. H. Lebowitz, A. S. Baldwin, and P. A. Sharp. 1988. Molecular cloning of an enhancer binding protein: isolation by screening of an expression library with a recognition site DNA. Cell 52:415-423. Staudt, L. M., M. Singh, R. Sen, T. Wirth, P. A. Sharp, and D. Baltimore. 1986. A lymphoid-specific protein binding to the octamer motif of immunoglobulin genes. Nature (London) 323: 640-643. Takaki, R., J. Ono, M. Nakamura, M. Yokogama, S. Kumae, T. Hiraoka, K. Yamaguchi, K. Hamaguchi, and S. Uchida. 1986. Isolation of glucagon-secreting cell lines by cloning insulinoma cells. In Vivo Cell Dev. Biol. 22:120-126. Weigel, D., G. Jurgens, F. Kuttner, E. Seifert, and H. Jackle. 1989. The homeotic gene fork head encodes a nuclear protein and is expressed in the terminal regions of the Drosophila embryo. Cell 57:645-658.