Glutathione and Cisplatin Resistance

3 downloads 77 Views 1MB Size Report
3) Department of Medical Oncology, Royal College of Surgeons Ireland, Dublin, IRELAND .... Two cell lines were found to be methylated A1847 and OVCAR8.
RESISTANCE RELATIONSHIPS BETWEEN PLATINUM AND PARP-INHIBITORS IN OVARIAN CANCER. Britta Stordal1, Yidong Chen2, Angela Farrelly3, Danielle Gallagher3, Steven Busschots1, Mattia Cremona3, Mark Carey4, John J. O’Leary1, Gordon B. Mills4, Alex Bishop2 and Bryan T. Hennessy3,4,5 1) Department of Histopathology, St James’ Hospital and Trinity College Dublin, IRELAND. 2) Greehey Children’s Cancer Research Institute, University of Texas Health Science Center at San Antonio, San Antonio, Texas, USA. 3) Department of Medical Oncology, Royal College of Surgeons Ireland, Dublin, IRELAND 4) Department of Systems Biology, University of Texas M. D. Anderson Cancer Center, Houston, Texas, USA. 5) Department of Medical Oncology, Beaumont Hospital, Dublin, IRELAND. .

Kinds of BRCA1/2 Mutations Wild Type

Polymorphism

UCAGGGACUUCGACCACGACCUAUCUUGCGCGUUC

Full Length Functional Protein

UCAGGGGCUUCGACCACGACCUAUCUUGCGCGUUC

Full Length Functional Protein

STOP

Deleterious Mutation

Reversion Mutation

UCAGGGACUUCGACCACGACCUAACUUGCGCGUUC

Truncated NonFunctional Protein

UCAGGGACUUCGACCACGACCUAUCUUGCGCGUUC

Full Length Functional Protein

Heterozygous or Homozygous? Cancer Development BRCA1 17q21 Germline

Tumour

Heterozygous Deleterious Mutation

Homozygous Deleterious Mutation

Functional BRCA1

Non-Functional BRCA1 STOP

Germline or Somatic? Cancer Development BRCA1 17q21 Germline

Tumour

Heterozygous Deleterious Mutation

Homozygous Deleterious Mutation

Functional BRCA1

Non-Functional BRCA1 STOP

• Test DNA from blood or other non-tumour tissue to assess germline

• Testing the tumour or cell lines made from tumors is the combined result of germline and somatic mutations

BRCA1, Cisplatin and PARP Inhibition Cisplatin

Cisplatin

A

A

C

C A C A C G C T G C BRCA1 wild type T G G DNA Repair of Cisplatin Induced Oxidative Damage

DNA Repair of Cisplatin Adducts BRCA1/2

Olaparib

Homologous Nucleotide Recombination Excision Repair





A

A

C

C A C A C G C T T G C BRCA1 mutated G or defective G DNA Repair of Cisplatin Induced Oxidative Damage

DNA Repair of Cisplatin Adducts

Olaparib

PARP

Base Excision Repair

X

Double Strand Breaks

Homologous Nucleotide Recombination Excision Repair

X



PARP

Base Excision Repair

X

Double Strand Breaks

Aims of Study • To screen a panel of 41 ovarian cancer cell lines for BRCA1/2 deleterious mutations and BRCA1 gene methylation.

• To determine if BRCA1/2 deleterious mutated and methylated cell lines are more sensitive to platinum and parp inhibitor chemotherapy. • To determine if any BRCA1/2 wild-type cells are highly sensitive or resistant to platinum and parp inhibitors. • To discover gene expression profiles of platinum and parp inhibitor resistance and sensitivity and determine any overlap between these profiles

BRCA1/2 Gene Sequencing •The full length of BRCA1 and BRCA2 genes were sequenced in a panel of 41 ovarian cancer cell lines. • Only one cell line had a functionally deleterious mutation in BRCA1 (SNU-251).

• Seven cell lines had heterozygous mutations in BRCA1 (IGROV-1) or BRCA2 but these have no functional impact on the protein.

Top: SNU-251 showing homozygous deletion W1815X (5564G>A) Bottom: BRCA1 Wild type sequence

Top: IGROV-1 showing heterozygous deletion - 2080delA Bottom: BRCA1 Wild type sequence

BRCA1/2 Gene Sequencing • Two cell lines had deleterious mutations as well as an additional reversion mutation which has restored the protein back to wild type BRCA1 (UPN-251) and BRCA2 (PEO1).

Top: UPN-251 showing homozygous deletions 1199del29 + 1246delA Reversion Mutation Bottom: BRCA1 Wild type sequence

BRCA1 Gene Methylation Gene Methylation

UCAGGGACUUCGACCACGACCUAUCUUGCGCGUUC

Decreased Expression of Full Length Functional Protein

• BRCA1 gene methylation was examined in the panel of 41 ovarian cancer cell lines. Two cell lines were found to be methylated A1847 and OVCAR8.

• The methylated cell lines have a corresponding decrease in BRCA1 mRNA expression.

Methylated

Deleterious Mutation

BRCA1 DeltaCt

5

4

3

2

1

0

Wildtype

• The SNU-251 cells have similar BRCA1 expression levels to wild type cells. This is due to the location of the QPCR primers. The SNU-251 cell line’s deleterious mutation at the very tail end of the gene sequence.

Frequency of BRCA1/2 mutations Unselected Ovarian Cancer Cell Lines from n=33 Patients

Unselected Invasive Ovarian Tumours ( Literature 1-3)

BRCA1/2 Deleterious Mutations 3%

BRCA1/2 Deleterious Mutations 8.6-13.7%

Wild Type 97%

Wild Type 91.4-86.3%

• Represents both germline and somatic mutations

• Represents germline mutations only. Studies including somatic have reported 18.3% mutated in ovarian tumours (4)

1) Pal et al 2005 Cancer; 104(12):2807-16 2) Rubin et al 1998 Am J Obstet Gynaecol; 178(4):670-7 3) Risch et al 2001 Am J Hum Genet 2001 68(3):700-10 4) Hennessy et al 2010 J Clin Oncol 28(22):3570-6.

Selective Pressure Against BRCA1/2 Mutations? • Primary culture protocols usually involve physical disruption of the tissue, enzymatic digestion and selection of attached colonies in tissue culture. • The more robust the cell the more likely it is to survive the process, cells without the full complement of DNA repair pathways, such as BRCA1/2 mutants are likely to be at a disadvantage.

• We examined the growth rate of 19 cell lines from the ovarian cell line panel and the deleterious mutant SNU-251 had the slowest growth rate.

3 2 1

5 Doubling Time (Days)

4

0

4 3 2 1

ild ty M pe et hy la te d M ut at ed

0

W

H A EY 2 O SK 780 VC O A V3 R O 43 C 3 O 31 VC 6 A 1 IG E 0 S R 2 O O VA 1 W H 42 U O PN C - 1 D 251 O OV VC 1 O A 3 O VC 420 VC A A R-8 R C 43 A 2 O A V3 18 4 SN PE 7 O U 1 -2 51

Doubling Time (Days)

5

Selective Pressure Against BRCA1/2 Mutations? STOP

Deleterious Mutation

Reversion Mutation

UCAGGGACUUCGACCACGACCUAACUUGCGCGUUC

Truncated NonFunctional Protein

UCAGGGACUUCGACCACGACCUAUCUUGCGCGUUC

Full Length Functional Protein

• Two cell lines in the cell panel had deleterious mutations and an additional reversion mutation (UPN-251) and (PEO1), also suggesting that there is a selective pressure against BRCA1/2 mutations in culture.

• This effect has been observed in drug resistant cell lines, as well as in cancer patients post chemotherapy.

Capan-1 Pancreatic Cancer BRCA2 mutated

Resistance Developed with Cisplatin

7/14 Resistant Clones BRCA2 Restored Sakai et al 2008 Nature 451(7182):1116-1120

Heterozygous Mutations Unselected Ovarian Cancer Cell Lines from n=33 Patients

Unselected Invasive Ovarian Tumours

BRCA1/2 Heterozygous Deleterious Mutations 12.4%

BRCA1/2 Heterozygous Deleterious Mutations 1%

BRCA1/2 Homozygous Deleterious Mutations 3.0%

BRCA1/2 Homozygous Deleterious Mutations 8.6-13.7%

Wildtype 84.8%

Wild Type 90.4-85.3%

• The high rate of heterozygous mutations was unexpected, these have no functional impact on the BRCA1/2 protein. No LOH was observed at the BRCA1/2 locus in these cells. • This is a much higher rate than observed in clinical ovarian cancer. These may represent heterogeneity within a BRCA1/2 tumour with the heterozygous cells selected for in culture.

Cytotoxicity of Cisplatin

4 2 1 0.5 0.25

0.125

P O EO A 1 IG W4 SN R 2 U C OV -2 A -1 51 O 1 V3 w FU eek O V O A18 1 VC 4 O A 7 VC 42 A 0 SK R 8 O O V3 C 31 H 6 O C 1 U ES PN -2 -2 A 51 27 D 8 O O 0 VC V1 O A 3 VC R A 10 R 43 O VC H 2 A EY R 43 3

0.0625

8 6 4 2 0 ut at ed M et hy la te d W ild ty pe

Cisplatin IC50 (uM)

8

BRCA1 Methylated Relatively Resistant Wildtype Relatively Sensitive Wildtype

M

16

Average Cisplatin IC50 (uM)

• A smaller panel of 20 cell lines were chosen to investigate the impact of BRCA1/2 dysfunction on sensitivity to platinum. Seventeen wild-type cell lines were compared to the methylated cell lines (A1847 and OVCAR8) and the deleterious mutant (SNU-251).

Biomarkers of Cisplatin Resistance • Affymetrix whole genome arrays were performed on the panel of cell lines. Gene expression was compared between:• Relatively Cisplatin Sensitive OAW42, CAOV3 and IGROV-1 • Relatively Cisplatin Resistant HEY, OVCAR432 and OVCAR433 • When comparing the relatively cisplatin resistant or sensitive cell lines on a whole genome basis they do not cluster together distinct from the other cell lines.

Biomarkers of Cisplatin Resistance • 305 genes were significantly different between the two groups of cell lines. These were analysed by Ingenuity Pathway Analysis. Pathways with a significant number of altered genes were:• Integrin Signalling

• Ephrin Receptor Signalling • IL8 Signalling • Glutathione Pathway

Biomarkers of Cisplatin Resistance • 305 genes were significantly different between the two groups of cell lines. These were analysed by Ingenuity Pathway Analysis. Pathways with a significant number of altered genes were:• Integrin Signalling - ↑ITGA6 (alpha integrin) → ↑AKT3

• Ephrin Receptor Signalling - ↑ EPHA4 → ↑ AKT3 • IL8 Signalling - ↑IL8 → ↑AKT3 Integrin Signalling Ephrin (Receptor Tyrosine Kinases) IL8 (Chemokine Receptors) Cytokine Receptors PI3K



AKT3

Proliferation Protein Synthesis Survival Glucose Metabolism

Activation of the Akt/mTOR pathway prevents cisplatin-induced apoptosis in ovarian cancer cells Peng et al (2010) BBRC 394(3) 600-605.

Absence of “Usual Suspects”

RAD51

Copper Transport

MRP2

Apoptosis

BRCA1



However, this may be due to us comparing untreated cell lines rather than genes responsive to cisplatin treatment

Glutathione and Cisplatin Resistance •The platinum-glutathione conjugate can no longer bind to DNA hence removing the toxic effect of the drug

Reduced Glutathione Cisplatin Glutathione-S-Transferase Glutathione-Platinum Conjugate Water

• Any increase in activity the glutathione pathway, synthesis, recycling or conjugation to cisplatin can potentially mediate cisplatin resistance. • However, we see no change in glutathione reductase or synthetase

Glutathione and Cisplatin Resistance • Glutathione functions to detoxify xenobiotics such as cisplatin by a conjugation reaction. The platinum-glutathione conjugate can no longer bind to DNA hence removing the toxic effect of the drug

Reduced Glutathione Cisplatin Glutathione-S-Transferase

Glutathione-Platinum Conjugate Water

• In contrast we see a decrease in GSTM1, GSTM2 and GSTM3 associated with cisplatin resistance.

Glutathione and Cisplatin Resistance • Glutathione is a tri-peptide which is synthesised within the cell from the amino acids glutamate, cysteine and glycine -Glutamyl Cysteine Synthetase

Glutathione Synthetase

Glutamate -GlutamylCysteine

Cysteine

Glutathione

Glycine

Aminopeptidase

• We see an increase in aminopeptidase associated with cisplatin resistance which may increase the available building blocks for glutathione synthesis.

Cytotoxicity of Olaparib

5

0 W

et

2 ut at ed M

U

A C 278 A 0 -2 51 OV 2 ES 3 w O ee -2 VC k A s H R8 O POC VC E 1 A O1 R 4 S O K 33 VC O A V3 D R1 O 0 O V1 C O 31 3 A 6 W A 4 O 18 2 V 4 U CA 7 O PN R VC - 5 A 251 R SN 4 U IG H 32 -2 R E 51 O Y O 1 VVC w 1 A eek R 42 0

0

10

ee hy ks la M t ut Wi ed at ld ed ty pe 1 W ee k

10

SN

15

M

20

BRCA1 Mutated BRCA1 Methylated Relatively Resistant Wildtype Relatively Sensitive Wildtype

Average Olaparib IC50 (uM)

Olaparib IC50 (uM)

30

• Unexpectedly, the SNU-251 cell line with the deleterious mutation in BRCA1 was one of the most resistant cell lines to olaparib of the panel. • On average the BRCA1 methylated cell lines A1847 and OVCAR8 were relatively sensitive to Olaparib.

Cytotoxicity of Veliparib • A similar trend was observed for Veliparib, SNU-251 was relatively resistant, and in a one week assay but not in a 2 week assay. • The methylated cell lines tended to be sensitive to Veliparib.

40 20

80 60 40 20 0

M

ut at ed

2

A

27 VC E 80 A S O R4 -2 VC 3 SN A 3 C U A -2 O OR8 51 V V C 3 O 2 W A1 VC e 0 A eks R D 43 O 2 V1 O HO 3 VC C A 1 A R5 IG 18 SN R 47 U O -2 51 P V-1 1 EO w 1 ee k O HE C Y O 31 A 6 SKW4 U O 2 P O N- V3 VC 2 A 51 42 0

0

100

W e e t ek hy s la M t ut Wi ed at ld e d ty pe 1 W ee k

60

120

M

80

BRCA1 Mutated BRCA1 Methylated Relatively Resistant Wildtype Relatively Sensitive Wildtype

Average Veliparib IC50 (uM)

100

O

Veliparib IC50 (uM)

120

Cytotoxicity of Olaparib vs Veliparib Olaparib vs Veliparib Correlation R = 0.5324 p = 0.01

100

Veliparib IC50 (uM)

Relatively Veliparib Resistant SKOV3, UPN-251, OVCAR420

80 60

Relatively Olaparib Resistant OVCAR432, HEY, IGROV-1, OVCAR420

40 20

Relatively Veliparib Sensitive A2780, ES-2, OVCA433

0 0

2

4

6

8

1020

25

Olaparib IC50 (uM)

Relatively Olaparib Sensitive A2780, CAOV3, ES-2, HOC1

• This suggests a similar but slightly divergent mechanism of resistance where a cell line specialises more in resistance to one agent over the other.

Biomarkers of Olaparib Resistance • Affymetrix whole genome arrays were performed on the panel of cell lines. Gene expression was compared between:• Relatively Olaparib Sensitive A2780, CAOV3, ES-2, HOC-1 • Relatively Olaparib Resistant HEY, IGROV-1, OVCAR420 OVCAR432 • When comparing the relatively olaparib resistant or sensitive cell lines on a whole genome basis they do not cluster together distinct from the other cell lines.

Biomarkers of Veliparib Resistance • Affymetrix whole genome arrays were performed on the panel of cell lines. Gene expression was compared between:• Relatively Veliparib Sensitive A2780, ES-2, OVCAR433 • Relatively Veliparib Resistant OVCAR420, SKOV3, UPN-251 • When comparing the relatively veliparib resistant or sensitive cell lines on a whole genome basis they do not cluster together distinct from the other cell lines.

Biomarkers of Parp Inhibitor Cross Resistance • 25 genes were significantly different between the olaparib resistant and sensitive cell lines. •151 genes were significantly different between the veliparib resistant and sensitive cell lines. • These were analysed by Ingenuity Pathway Analysis. The top pathways were different for Olaparib and Veliparib, most were general cancer pathways. Of interest:Olaparib – G2/M DNA Damage Checkpoint Regulation Veliparib - Pyrimidine De Novo Biosynthesis

Biomarkers of Parp Inhibitor Cross Resistance Veliparib Differentially Expressed Genes 150

1

Olaparib Differentially Expressed Genes 24

• Only 1 gene was significantly differentially expressed in both Olaparib and Veliparib resistant cell lines PLCL2 - phospholipase C-like 2 • Phosphodiesterases that cleave the polar head groups from inositol lipids

• Thought to activate the Src pathway. • PLCL2 was increased in the sensitive cell lines. Also found in the NCI-60 panel as a general marker of drug potency. • However, the overall gene expression profiles are similar suggesting a common mechanism of resistance between the two agents but some specificity in a different subset of genes.

Cytotoxicity of Cisplatin vs Olaparib Relatively Olaparib Resistant OVCAR432, HEY, IGROV-1, OVCAR420

Cisplatin vs Olaparib Correlation R = -0.0977 p = 0.690

↓AKT3

Relatively Olaparib Sensitive A2780, CAOV3, ES-2, HOC1

Olaparib IC50 (uM)

25 20 10

↑AKT3 5

0 0

5

10

15

Cisplatin IC50 (uM)

Relatively Cisplatin Sensitive PEO1, OAW42, CAOV3, IGROV-1

Relatively Cisplatin Resistant OVCAR432, HEY, OVCAR433

Cytotoxicity of Cisplatin vs Veliparib Cisplatin vs Veliparib

Relatively Veliparib Resistant SKOV3, UPN-251, OVCAR420 Veliparib IC50 (uM)

Relatively Veliparib Sensitive A2780, ES-2, OVCA433

Correlation R = -0.3310 p = 0.1663

100 80 60 40 20 0 0

5

10

15

Cisplatin IC50 (uM)

Relatively Cisplatin Sensitive PEO1, OAW42, CAOV3, IGROV-1

Relatively Cisplatin Resistant OVCAR432, HEY, OVCAR433

• Cisplatin appears active in veliparib-resistant cell lines.

• Veliparib somewhat active in cisplatin-resistant cell lines. • Potential for combination treatments of these agents for ovarian cancer (toxicity permitting).

Conclusions • Deleterious BRCA1/2 mutations are rare in the panel of ovarian cancer cell lines we have studied 2.6%. There appears to be selective pressure against BRCA1/2 mutations in cell culture.

8 6 4 2

pe

d

ty

at e yl

W ild

• BRCA1 mutated and methylated cell lines are sensitive to platinum and parp inhibitor chemotherapy. There are cohorts of BRCA1/2 wild-type cell lines that are sensitive to platinum and parp inhibitors.

M

et h

ut at ed

0

M

Average Cisplatin IC50 (uM)

STOP

• The AKT pathway may be a ‘global’ pathway suitable for use as a broad platinum resistance biomarker at the gene level. Rather than using the ‘usual suspects’

Acknowledgements Funding – Britta Stordal

Funding – Bryan Hennessey

Thanks To:Kirsten Timms

Please come and see poster presentations



Developing platinum and taxane resistant ovarian cancer cell lines: Investigating the role of BRCA1.



Collateral sensitivity to cisplatin in KB-8-5-11 is confluence dependant.