glycosylphosphatidylinositol-anchored VCAM protein

Proc. Natl. Acad. Sci. USA Vol. 90, pp. 5919-5923, July 1993 Medical Sciences

Cytokine induction of an alternatively spliced murine vascular cell adhesion molecule (VCAM) mRNA encoding a glycosylphosphatidylinositol-anchored VCAM protein ROBERT W. TERRY, LIA KWEE, JOSEPH F. LEVINE, AND MARK A. LABOW* Molecular Sciences Group, Hoffmann-La Roche Inc., 340 Kingsland Street, Nutley, NJ 07110-1199

Communicated by Sidney Udenfriend, March 8, 1993

message in cytokine-treated human umbilical vein endothelial cells. Rabbit VCAM cDNAs have been described that contain an additional immunoglobulin domain. Although various cDNAs have been identified, no differences in expression patterns have been observed for these cDNAs, nor is there any biochemical evidence for alternative functions or ligand specificities of proteins encoded by these cDNAs. In this paper, the organization and expression of the murine VCAM gene is described.t These data demonstrate that, in the mouse, an alternative glycosylphosphatidylinositol (GPI)-anchored form of VCAM is induced under inflammatory conditions, suggesting that biochemically distinct forms of VCAM may mediate unique functions.

VCAM-1 is an immunoglobulin superfamily ABSTRACT member that mediates adhesion of a variety of leukocytes to endothelial cells. VCAM expression has been associated with a variety of disease states and has been implicated in a number of normal processes. The predominant form of VCAM produced in human endothelial cells is a transmembrane protein containing seven immunoglobulin domains. In this study the murine VCAM gene has been characterized to allow the function(s) of VCAM to be studied in a small genetically accessible animal. While expression of an mRNA encoding a seven-immunoglobulin-domain transmembrane VCAM protein was seen in most tissues, the predominant change in VCAM expression upon interleukin 113 treatment was the induction of an alternatively spliced VCAM mRNA containing only the first three immunoglobulin domains. This message encodes a glycosylphosphatidylinositol (GPI)-anchored form of VCAM, VCAMGPI. VCAMGPI was efficiently cleaved from the cell surface by phosphatidylnositol-specific phospholipase C, mediated adhesion to leukocytes in a very late antigen 4-dependent manner, and was produced by mouse endothelial cell lines in culture. These data demonstrate that alternate forms of VCAM are produced under different physiological conditions and suggest that VCAMGPI may have a distinct role in inflammatory processes.

MATERIALS AND METHODS Isolation of Murine VCAM cDNA and Genomic Clones. A murine lung cDNA library in the A ZAPII vector (Stratagene) was screened at low stringency with a human VCAM cDNA probe (a generous gift of Dan Burns and Wei Chu, Department of Inflammation and Autoimmunity, Hoffmann-La Roche) by using standard methodology (22). Multiple 3.7-kb cDNA clones were isolated that contained a long open reading frame identical to that of a partial murine VCAM cDNA reported while this work was in progress (21). A 1-kb HindIII-Sac I fragment of the cDNA was used to screen a A FIXII 129/SV library (Stratagene) and a A Gem-129/SV library (a generous gift of Anton Berns, Netherlands Cancer Institute). Rapid amplification of cDNA ends (3'RACE system, Life Technologies, Grand Island, NY) was used to isolate partial cDNA clones representing the 1.6-kb VCAM message observed in Northern blots (see below), encompassing domain 2 (nt 423) and the 3' end of murine VCAM messages using protocols provided by the manufacturer. Total or poly(A)+ RNA (1 pg) from interleukin 1(3 (IL-113)-induced kidney tissue was used as template in the first-strand cDNA reaction using an oligo(dT) adapter primer (GGAATTCTCGAGTCTAGA-T17). A PCR (1 min at 940C, 2 min at 55°C, 3 min at 72°C for 34 cycles, and a final 10 min at 72°C) was then carried out using a 5' domain 2 primer (GGATCCAGAGATTCAATTCCA) and a 3'RACE adapter primer (GGAATTCTCGAGTCTAGA). The 1-kb PCR product was cloned using the TA cloning kit (Invitrogen, San Diego). All clones contained the same insert and a representative (pCRII/ mVCAM1.6) was used in all subsequent experiments. A full-length 1.6-kb cDNA (pmVCAM1.6) was reconstructed by combining this 3' clone with 5' sequences contained in the 3.7-kb cDNA as described below. All clones were sequenced

VCAM was originally identified as an adhesion molecule expressed on cytokine-induced human umbilical vein endothelial cells that mediates binding to a variety of leukocytes, including B cells, T cells, basophils, eosinophils, and monocytes (1-3). VCAM is a counterreceptor for the integrin very late antigen 4 (VLA-4) (4) and has been shown to act as a T-cell costimulatory molecule (5, 6). Vascular expression of VCAM has been associated with a number of disease states including rheumatoid arthritis, appendicitis, dermatitis, and atherosclerosis (7-9). A recent study has suggested a direct role of vascular VCAM expression in allograft rejection (10). VCAM also mediates the adhesion of melanoma cells to cultured endothelial cells, indicating that VCAM may play a role in metastasis (11). Nonvascular expression ofVCAM has been observed in hyperplastic synovial lining cells in rheumatoid arthritis, in kidney proximal tubule cells, and in some neuronal cell lines induced by cytokines in culture (10, 12, 13). Several reports have also indicated a role of VCAM in a number of normal processes including lymphopoieses and muscle development (14-17). The predominant form of VCAM observed in humans, mice, rabbits, and rats appears to be a 100- to 110-kDa protein containing seven immunoglobulin domains, a single transmembrane region, and a short cytoplasmic domain (18-21). A variant human VCAM cDNA lacking the fourth immunoglobulin domain has also been found that represents a minor

Abbreviations: VCAM, vascular cell adhesion molecule; GPI, glycosylphosphatidylinositol; IL-1,3, interleukin 1,B; VLA-4, very late antigen 4; PI, phosphatidylinositol; PLC, phospholipase C. *To whom reprint requests should be addressed. tThe sequence reported in this paper has been deposited in the GenBank data base (accession no. L12541).

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

5919

Proc. NatL Acad Sci. USA 90 (1993)

Medical Sciences: Terry et al.

5920

from both strands. Sequencing was carried out using an Applied Biosystems automated DNA sequencer as suggested by the manufacturer. For expression in mammalian cells, murine VCAM cDNAs were placed under control of the cytomegalovirus immediate early promoter in pRC/CMV (Invitrogen, San Diego). Briefly, pmVCAM3.7 was created by insertion of the 3.7-kb VCAM cDNA into HindIII/Not I-digested pRC/CMV. A complete 1.6-kb cDNA was created in the pRC/CMV vector by insertion of an Xba I fragment from the partial 1.6-kb cDNA from pCRII/mVCAM1.6 into Xba I-digested pmVCAM3.7. Purifi'cation and Analysis of Tissue RNA. Mice (4- to 6-week-old FVB/Ns) received i.p. injections of phosphatebuffered saline (PBS) or PBS containing 2 ,ug of recombinant IL-1l3 (Hoffmann-La Roche), and tissues were harvested 5 h after injection. RNAs were isolated using RNAzol B (Biotex Laboratories, Houston). RNA (10 ,ug) was analyzed by electrophoresis on 1% agarose/formaldehyde gels as described (22) and transferred to nylon membranes. Murine VCAM probes used for hybridization were prepared by the random-priming method (23) using a 1-kb HindIII-Sac I fragment as shown in Fig. 1A. All filters were washed for several hours at 65°C in 0.2x standard saline citrate/0.5% SDS and exposed to Kodak XAR-5 film at -80°C. Expression of Murine VCAM Proteins. COS-7 cells were transfected using DEAE-dextran as described in Larigan et al. (24). Transfected cells were incubated 42-48 h before metabolic labeling. Transformed murine endothelial cells

A

IErl SD1 D2 D3

IJ

D4 D5 D6 D7 TmCyt

1 kb Hindill-Sac I probe

B

sp

Kid Hrt Brn

I-5 + -+-

3.5kb

1.6kb-

-

4-

_

*

28S

+-18S

(SVEC cells) were grown in Dulbecco's modified Eagle's medium (DMEM) with 10% (vol/vol) fetal calf serum and treated with medium containing IL-1p3 4 h prior to labeling. For [35S]cysteine labeling, cells were washed twice with PBS, and incubated for 30 min in 1 ml of cysteine-free DMEM containing 2% dialyzed fetal calf serum. Fresh medium containing 200 ,Ci of [35S]cysteine (1 Ci = 37 GBq) was added and the cultures were incubated for 2 h at 37°C. For [3H]ethanolamine labeling, cells were washed, then medium containing 100 uCi of [3H]ethanolamine (Amersham) was added, and cells were incubated for 16-24 h at 37°C. Supernatants were removed and protease inhibitors leupeptin and phenylmethylsulfonyl fluoride were added. Cell lysates were made by scraping cells in 250 ul of lysis buffer [50 mM Tris HCl, pH 8/150 mM NaCl/100 ,ug/ml of phenylmethylsulfonyl fluoride/aprotinin (1 ug/ml)/1% Triton X-100]. Lysates were cleared and brought to 500 ,lA with wash buffer (50 mM Tris HCl, pH 7.5/150 mM NaCl/0.1% Nonidet P-40/1 mM EDTA/0.25% gelatin). A hybridoma supernatant (10-25 ,ul) containing the M/K-2 antibody specific for murine VCAM (refs. 14 and 15; the M/K-2 antibody was a generous gift of Paul Kincade, Oklahoma Medical Research Foundation) was rotated at 4°C overnight. 'Immunoprecipitations were carried out with protein G-agarose and analyzed by SDS/PAGE (25) on a 10% polyacrylamide gel. Gels were treated with Amplify (Amersham) and dried for autoradiography. Phosphatidylinositol-Specific Phospholipase C (PI-PLC) Treatment. Immediately after labeling, monolayers were washed with PLC buffer (25 mM Tris, pH 8.0/10 mM glucose/250 mM sucrose/2% dialyzed fetal calf serum). PLC buffer (1 ml) containing protease inhibitors and 75 units of PI-PLC (a generous gift of S. Udenfriend, Roche Institute of Molecular Biology) was added and cells were incubated for 1 h at 370C. U937 Cell Adhesion Assays. U937 cells were suspended at 4 x 106 cells per ml of DMEM and 1 ml of cells was added per 35-mm dish of transfected COS-7 cells. The dishes were incubated at room temperature for 30 min, supernatants were aspirated, the dishes were washed several times in PBS, and rosettes were photographed under a microscope. In some experiments the U937 cells were washed and incubated with an anti-VLA-4 antibody (AMAC, Westbrook, ME) at 5 ,ug/ml for 20 min at room temperature prior to addition to transfected COS-7 cells.

RESULTS

FIG. 1. Structure and expression of the murine VCAM gene. (A) The structure of an isolated murine VCAM cDNA is shown. The entire cDNA has been sequenced, consists of 3680 bp, and contains a single long open reading frame (shown in boxes). The solid box encodes the signal sequence (S) and the open boxes indicate the immunoglobulin-like domains (D1-D7) corresponding to those present in the human VCAM gene. The transmembrane and cytoplasmic domains are shown as hatched boxes. Untranslated regions are shown as lines. The location of two poly(A) addition sites are indicated by arrows. (B) Expression of the murine VCAM gene was examined by Northern blot analysis of total RNA isolated from tissues of animals injected with PBS alone (-) or PBS containing 2 pg of recombinant human IL-1,B (+). The blot was probed with a labeled 1-kb fragment as shown in A. The positions of 28S and 18S RNAs are shown on the right and the position and approximate size of the two predominant VCAM RNAs are shown on the left. The blots were reprobed with a labeled portion of a murine ribosomal protein L32 cDNA to control for RNA levels and integrity (rpL32).

Isolation of Murine VCAM cDNAs. Murine VCAM cDNAs were isolated from a murine lung cDNA library by using a human VCAM cDNA as probe. The largest clones contained identical 3.7-kb cDNA inserts. The structure of the cDNA is diagrammed in Fig. 1A. The cDNA contained a long open reading frame with 80%o amino acid identity with human VCAM. While this work was in progress, the sequence of a 2-kb partial cDNA encoding the murine VCAM protein was reported (21) that had an open reading frame identical to that contained in the 3.7-kb cDNAs. The cDNAs isolated in this study contain an additional long 3' untranslated region with little homology to that of the human gene. Two poly(A) addition sequences (AATAAA) were found; the first located 29 bp from the 3' end of the cDNA (nt 3652) and a second located 240 bp upstream of the first (nt 3407). Expression of the Murine VCAM-1 Gene. The sites of expression of the murine VCAM gene were determined by Northern blot analysis of RNA from tissues of mice that were injected with PBS or PBS plus IL-1,B. As show n Fig. 1B, an RNA of -3.5 kb was detected in tissues from untreated animals at high levels in spleen and at lower levels in a variety of tissues including kidney, heart, and brain. The apparent

Medical Sciences: Terry et al. size of this RNA was smaller than that predicted from the 3.7-kb VCAM cDNA clones but was the approximate size predicted for an RNA utilizing the poly(A) addition site at nt 3407 of the cDNA. Hybridization and PCR experiments (data not shown) indicate that the 3.5-kb RNA contains all coding regions within the 3.7-kb cDNA and the only additional sequences within the 3.7-kb cDNA are in the 3' noncoding region. It is unclear why all the cDNAs isolated in this study utilized the most 3' poly(A) site. The most striking change in VCAM RNA levels mediated by IL-1,8 was the induction of a small RNA of 41.6 kb (Fig. 1B). Although this message was present in small amounts in uninduced spleen RNA, it was the most abundant message seen in IL-1,-induced kidney and heart. Additional experiments indicated that this message was also strongly induced in lung and liver and was induced by tumor necrosis factor a or lipopolysaccharide (data not shown). These findings indicate that a major change in VCAM expression in response to cytokines is the induction of an alternative-size RNA. A 1.6-kb RNA hybridizing to VCAM cDNA probes was observed previously in RNA from murine endothelial cells and lipopolysaccharide-induced lung. This RNA was present in relatively low amounts and was not characterized (15, 21). The 1.6-kb RNA Is an Alternatively Spliced VCAM RNA. To determine the structure of the 1.6-kb mRNA, several types of analysis were carried out. Initially, Northern blots of tissue RNA were hybridized with probes specific for each immunoglobulin domain (data not shown). While the 3.5-kb RNA hybridized to all probes derived from the 3.7-kb cDNA, the 1.6-kb RNA hybridized only with probes from the first three immunoglobulin domains. To define the exact structure of the 1.6-kb RNA reverse transcription-PCR was used to isolate cDNA clones for the small message. Northern blot experiments described above suggested that the 1.6-kb RNA was collinear with the 3.5-kb RNA up to the end of domain 3; thus PCR experiments were designed to amplify a portion of VCAM RNAs encompassing everything downstream of domain 2 by utilizing an oligo(dT) adapter primer and a domain 2 upstream primer. By using RNA from IL-1,& induced kidney, multiple VCAM cDNA clones were isolated that encode the 3' end of the 1.6-kb mRNA. This conclusion was based on several observations. (i) The PCR-generated clones were precisely the size predicted for the 1.6-kb mRNA. (ii) Sequence analysis (see below) indicated that the cDNAs diverged from the 3.7-kb cDNA sequence precisely after domain 3 as indicated in Northern blot experiments described above. (iii) The unique region of the cDNAs hybridized exclusively to the 1.6-kb VCAM mRNA when used as probe on Northern blots (data not shown). The sequence of the unique region of the 1.6-kb cDNAs is shown in Fig. 2A along with the structure of the 3.7- and 1.6-kb cDNAs. The 3' end of the 1.6-kb cDNAs encodes a unique 36-aa tail attached to immunoglobulin domain 3. The 3' untranslated region contains a single canonical AATAAA poly(A) addition site 28 bp upstream of the poly(A) tail. No evidence was found for additional VCAM RNAs by using PCR. Based on these data, we conclude that the 1.6-kb RNA is an authentic VCAM RNA that encodes the first three immunoglobulin domains and a unique 3' end. To determine the origin of 1.6-kb RNA, overlapping A clones encoding the murine VCAM genomic locus were isolated and analyzed as shown in Fig. 2B. The sequence of the intron-exon borders and promoter region have been completed and will be presented in detail elsewhere. The structure of the gene is highly similar to that of the human VCAM-1 gene (18). Each domain is encoded by a separate exon with the signal sequence and transmembrane/cytoplasmic domains encoded on separate exons. All of the unique sequence contained in the 1.6-kb cDNAs is encoded in a single separate exon that we have denoted as exon A5, as it appears to be an

w

Proc. Natl. Acad. Sci. USA 90 (1993) A

5921

S D1 D2 D3 D4 D5 D6 D7 TmCyt

I I I kbi_ I SD1 D2 D3A5 1.6kb I I

3.7

Domain 3 GTA V

A5

T GTTCAA G T GGG AGA ATG AAG TCT CAG AT ACT AAT GOC CAT CAA 17G ACT GTA V O D G R M K S a I T N G H O L T V

CAC CTA ATG TTT GCC AAG AGT TTC TAC 1TC ATA TGT TAT CTC TGT CTr TAT CTT GCT CTG L M F A K S F Y F I C Y L C L Y L A L

H

TaAGGAAGCTGAAAAACTCAGACGCAATATAATTCATCATTrGCATGGGGTCAAATGGTTCMCMCA TTTATATGCTGrTTCrAA1TrAAAATCCTATGCCTTTTCAArTGTAGCTAArMI-TCTCTATTTTrAAAAATTA TrGACCATCCAAACTGCATGCATACATrGOGTATGGTGTGATATGTGGTATATrrATACAATGTGGGATG AAIAAATCCAAGTATATACTrCAGTAAGAGCACCAAAAAAAAAA

B -

I U

12 Exon Domain S I

U

3 11

lamda-2

B

lambda 18

B

lambda 19 lambda 7

U

i

4A5 III

5 IV

-

V678 V 8 V VI Vll

p s

B

PS

B

PS

B

9

Tm/Cyt

1 kb

FIG. 2. Organization of murine VCAM cDNAs and their genomic coding regions. (A) The structure of the two characterized murine VCAM cDNAs are diagrammed. The first line represents the 3.7-kb cDNA shown in Fig. 1A. The 1.6-kb cDNA was produced by fusion of separate cDNA clones. The unique 3' end is designated as A5 and shown as a stippled box. The nucleotide sequence of the unique region of PCR-generated cDNAs and the 36-aa C-terminal peptide (single letter code) encoded are shown below. A portion of the sequence encoding domain 3 is also shown (boxed). A poly(A) addition site found 28 bp upstream of the poly(A) tail is underlined. (B) The intron-exon structure of the murine VCAM gene is diagramed. Introns are represented by thin lines between exons. Untranslated regions of the exons are shown as open boxes and translated regions of exons shown as solid boxes. The domain encoded by each exon is designated below the exon number. Shown below are the genomic A clones isolated that span the entire murine VCAM coding region. Restriction sites shown are BamHI (B), Pac I (P), and Stu I (S).

alternate exon 5. This exon lies 800 bp downstream of exon 4 (encoding domain III) and begins after a canonical splice acceptor sequence (data not shown). Thus, the AS-containing mRNA is an alternatively spliced VCAM message. The 1.6-kb RNA Encodes a GPI-Anchored VCAM Protein. The nucleotide sequence of the 1.6-kb mRNA predicts a three-domain form of VCAM with a 36-aa tail. The 36 aa do not contain a sufficiently long stretch of hydrophobic amino acids to encode a transmembrane segment. The 36-aa sequence does contain several possible sites for attachment of a GPI anchor (26, 27). In this regard, it was of interest to note that another related immunoglobulin superfamily member, neural cell adhesion molecule, also exists in transmembrane and GPI-anchored forms derived from alternatively spliced mRNAs (28). To determine the nature of the protein encoded by the 1.6-kb mRNA, cDNA expression vectors for the seven-domain VCAM transmembrane protein (pmVCAM3.7) and for the truncated VCAM protein (pmVCAM1.6) were transfected into COS-7 cells and the expression of the VCAM molecules was examined by immunoprecipitation (Fig. 3). Transfection with pmVCAM3.7 resulted in the production of large amounts of a '100-kDa protein found in the cell lysate. This protein was the same size as that reported for murine VCAM (14, 21). Low levels of a smaller VCAM protein were found in the supernatant. This

5922

Medical Sciences: Terry et al.

35S-Cysteine 1

2

Proc. Natl. Acad. Sci. USA 90 (1993)

Cos-7 Cells

3H -Eth 3

1 2 3 MP S P S P S PPp

200w

PI-PLC

*

97 _ 69

-

+ - + - + - +

-

100 -0

10O0 kDa

46IIII

SVEC

Mock 3.7 kb 1.6 kb PPS S PPS S PPSS +

-

PPS S L

+

.

-

100_

43

43 -_

43 kDa

30 21

FIG. 3. Expression of VCAM cDNAs in transfected COS-7 cells. COS-7 cells were transfected with no DNA (lane 1), pmVCAM3.7 (lane 2), or pmVCAMl.6 (lane 3) and metabolically labeled with either [35S]cysteine or [3H]ethanolamine (Eth) as indicated. Immunoprecipitations with the anti-murine VCAM antibody M/K-2 were carried out on proteins isolated from cell pellets (lanes P) or from culture supernatants (lanes S) as indicated. The sizes of 14C molecular markers (lane M) are indicated in kDa. The positions of 100-kDa and 43-kDa murine VCAM proteins are indicated with arrows on the right. most likely reflects a small amount of proteolytic cleavage of

the seven-domain VCAM transmembrane protein that would result in an -95-kDa protein (29). Transfection with pmVCAM1.6 resulted in the production of a =43-kDa protein(s). The predicted size for the protein encoded by the 1.6-kb cDNA is 38 kDa in a nonglycosylated form. The protein detected after transfection was heterogeneous in size, most likely reflecting the presence of differentially glycosylated or otherwise modified forms. VCAM-specific proteins expressed by pmVCAM1.6 were not secreted and were found exclusively in the cell-associated fraction. To determine whether the 43-kDa protein might be attached to the membrane via a GPI anchor, transfected COS-7 cells were labeled with [3H]ethanolamine and immunoprecipitations were carried out on cell pellets (Fig. 3). Ethanolamine is used as a metabolic precursor in the synthesis of GPI tails and can be used to specifically label GPI-anchored proteins (30). Although no 3H-labeled proteins were detected after mock-transfection or transfection with pmVCAM3.7, a 43-kDa protein was detected after transfection with pmVCAM1.6 (lane 3). This indicated that the 1.6-kb cDNA encodes a protein containing a GPI tail. To confirm that the 43-kDa VCAM protein was anchored to the cell surface via a GPI tail, the ability of a PI-specific phospholipase, PI-PLC, to release the small VCAM protein from the cell surface was tested. COS-7 cells were transfected with both VCAM expression vectors and treated with digestion buffer alone or with PI-PLC (Fig. 4). The 100-kDa VCAM protein produced by pmVCAM3.7 was again mostly present in the cell pellet, although a small amount was also present in the supernatants from both treated and untreated cells. No increase in the amount of the 100-kDa protein in the supematant was observed after treatment with PI-PLC. The 43-kDa VCAM protein encoded by pmVCAM1.6 was detected in the cell pellets of both treated and untreated cells and was not detected in the supernatants of untreated cells. PI-PLC treatment of pmVCAM1.6-transfected cells resulted in the release of -50o of the 43-kDa protein into the supematant. The 43-kDa protein was also secreted from cells when cotransfected with a GPI-phospholipase D expression vector (data not shown) shown to facilitate secretion of GPI-anchored proteins (31). Thus, the 1.6-kb mRNA encodes a GPI-anchored form of VCAM referred to here as VCAMGPI.

FIG. 4. PI-PLC cleavage of the 43-kDa VCAM protein. Immunoprecipitations were carried out with the M/K-2 antibody and 35S-labeled proteins isolated from either transfected COS-7 cells or nontransfected SVEC cells, a mouse endothelial cell line. COS-7 cell were transfected with no DNA (Mock), pmVCAM3.7 (3.7 kb), or pmVCAM1.6 (1.6 kb) as indicated on the left. Immunoprecipitations from SVEC cells are shown to the right. Immunoprecipitations were carried out using proteins prepared form the cell pellets (lanes P) or from culture supernatants (lanes S) as described above except that before harvesting, cultures were treated with PLC digestion buffer with (+) or without (-) PI-PLC. The sizes of VCAM-specific proteins are shown on the left in kDa.

Because the identification of the VCAMGPI protein was based on expression of cloned cDNAs, it was important to determine whether VCAMGPI was produced normally by murine cells. Thus, IL-1lB3treated SVEC cells (simian virus 40-transformed mouse endothelial cells) were assayed for the presence of VCAM proteins by immunoprecipitation. Two VCAM-specific proteins were detected in these cells (Fig. 4); a 100-kDa protein corresponding in size to the seven-domain VCAM protein and a 43-kDa protein that comigrated with the 43-kDa VCAM protein detected in COS-7 cells transfected with pmVCAM1.6. To verify that this protein was VCAMGPI, the SVEC cells were treated with PI-PLC. PI-PLC treatment released nearly all of the 43-kDa protein into the supernatant but none of the 100-kDa VCAM protein. The 43-kDa protein could also be labeled with [3H]ethanolamine (data not shown). Thus, the 43-kDa VCAM protein detected in SVEC cells appears to be VCAMGPI. VCAMGPI was also detected in a murine aortic endothelial cell line (EOMA; data not shown).

E

C

I

FIG. 5. VCAMGPI mediates VLA-4-dependent adhesion to leukocytes. COS-7 cells were mock-transfected (A) or transfected with pmVCAM3.7 (B) or pmVCAM1.6 encoding VCAMGPI (C and D). Monolayers of transfected cells were tested for the ability to bind U937 cells. The U937 cells used in D were pretreated with antiVLA-4 antibody before addition to the transfected COS-7 cells. Monolayers and adherent U937 cells were photographed immediately after the adhesion assay.

Medical Sciences:

Terry et al.

VCAMGPI Protein Is a Functional Adhesion Molecule. To determine whether the VCAMGPI was functional, transfected COS-7 cells were tested for their ability to bind U937 cells, a human macrophage cell line that expresses VLA-4, the ligand for human VCAM. It has been shown (13, 14) that the interaction between VCAM and VLA-4 is conserved between species. COS-7 cells were transfected with both VCAM cDNA expression vectors and tested for their ability to form rosettes with U937 cells (Fig. 5). The U937 cells failed to adhere to mock-transfected COS-7 cells (Fig. 5A) but efficiently bound to cells transfected with either pmVCAM3.7 (Fig. SB) or pmVCAM1.6 (Fig. SC). Pretreatment of the U937 cells with an antibody to VLA-4 completely blocked adhesion to pmVCAM1.6-transfected cells (Fig. SD). Thus VCAMGPI is a functional adhesion molecule. DISCUSSION Characterization of murine VCAM cDNAs has identified a GPI-anchored form of VCAM, VCAMGPI. The message encoding VCAM0PI is an alternatively spliced mRNA that is preferentially induced in a tissue-specific manner by IL-1,8. Thus, these experiments suggest that cytokines can control gene expression by alternative splicing. Cytokines may directly affect alternative splicing or processing of the VCAM message. Alternatively, cytokines may be inducing transcription of VCAM in cell types that have unique splicing machinery. In either case, these data demonstrate that VCAM is differentially regulated at the level of RNA processing. The finding that the 1.6-kb VCAM RNA is induced by cytokines suggests that the GPI-anchored form of VCAM may play an important role in inflammation. It is possible that different biochemical forms of VCAM may have been adapted to roles in normal and pathophysiological processes. What unique role(s) VCAMGPI may play remains to be elucidated. The GPI anchor might be needed for the rapid release of VCAM from the cell surface to limit potentially deleterious inflammatory effects of prolonged VCAM expression or to release bound cells after extravasation. Similar mechanisms exist to rapidly shed L-selectin from the surface of lymphocytes (32). Conversely, because it is known that the transmembrane form of VCAM is proteolytically shed from the surface, VCAMGPI might have a longer half-life on the cell surface. The GPI anchor might also be needed to direct the location of VCAM on the cell surface in polarized cell types. In this regard it is interesting to note that human VCAM is expressed in kidney proximal tubule epithelial cells in a variety of inflammatory kidney diseases (11). Expression of a VCAMGPI in this cell type would be expected to localize VCAM to the apical surface as is the case for the GPIanchored form of neural cell adhesion molecule (33). A third possible role for VCAMGPI might involve signal transduction since Thy-1, another immunoglobulin superfamily member containing a GPI anchor, can mediate the activation of Thy-l-expressing T cells (34). Finally, although it is not yet known whether humans produce a GPI-anchored form of VCAM, VCAMGPI bears some similarity to the six-immunoglobulin-domain/transmembrane form of human VCAM in the sense that both molecules are predicted to have only a single immunoglobulin-domain capable of interacting with VLA-4. Thus both molecules may be monovalent whereas the seven-domain forms of VCAM appear to be functionally bivalent (35). The identification of monovalent and bivalent forms of VCAM in both human and murine cells may indicate conserved functions for these molecules. Note Added in Proof. Similar observations were recently reported while this paper was in press (36). We thank Jarko Kochan, Mary Graves, Gwen Wong, and Greg Pirozzi for helpful discussions; Chitra Chandra for help with transfections; Chris Norton for cells; and Warren McComas and Richard

Proc. Natl. Acad. Sci. USA 90 (1993)

5923

Motyka for oligonucleotides. We especially thank Dan Bums and his laboratory for extensive help throughout the work. R.W.T. and L.K. contributed equally to the work presented in this report. 1. Osborn, L., Hession, C., Tiszard, R., Bassallo, C., Luhowsky, S. & Lobb, R. (1989) Cell 59, 1203-1211. 2. Bochner, B. S., Luscinskas, F. W., Gimbrone, M. A., Jr., Newman, W., Sterbinsky, S. A., Derse-Anthony, C. P., Klunk, D. & Schleimer, R. P. (1991) J. Exp. Med. 173, 1553-1556. 3. Carlos, T. M., Schwartz, B. R., Kovach, N. L., Yee, E., Rosso, M., Osborn, L., Chi-Rosso, G., Newman, B., Lobb, R. & Harlan, J. M. (1990) Blood 76, 965-970. 4. Elices, M. J., Osborn, L., Takada, Y., Crouse, C., Luhowskyj, S., Hemler, M. E. & Lobb, R. R. (1990) Cell 60, 577-584. 5. Burkly, L. C., Jakubowski, A., Newman, B. M., Rosa, M. D., Chi-Rosso, G. & Lobb, R. (1991) Eur. J. Immunol. 21, 2871-2875. 6. Damle, N. K. & Aruffo, A. (1991) Proc. Natl. Acad. Sci. USA 88, 6403-6407. 7. Rice, G. E., Munro, J. M., Corless, C. & Bevilacqua, M. P. (1991) Am. J. Pathol. 138, 385-393. 8. Cybulsky, M. I. & Gimbrone, M. A., Jr. (1991) Science 251, 788-791. 9. van Dinther-Janssen, A. C. H. M., Horst, E., Koopman, G., Newmann, W., Scheper, R. J., Meijer, C. J. L. & Pals, S. T. (1991) J. Immunol. 147, 4207-4210. 10. Pelletier, R. P., Ohye, R. G., Vanbuskirk, A., Sedmak, D. D., Kincade, P., Rerguson, R. M. & Orosz, C. G. (1992) J. Immunol. 149, 2473-2481. 11. Rice, G. E. & Bevilacqua, M. P. (1989) Science 246, 1303-1306. 12. Seron, D., Cameron, J. S. & Haskard, D. 0. (1991) Nephrol. Dialysis Transplant. 6, 917-922. 13. Birdsall, H. H., Lane, C., Ramser, M. N. & Anderson, D. C. (1992) J. Immunol. 148, 2717-2723. 14. Miyake, K., Weissman, I. L., Greenberger, J. S. & Kincade, P. W. (1991) J. Exp. Med. 173, 599-607. 15. Miyake, K., Medina, K., Ishihara, K., Kimoto, M., Auerbach, R. & Kincade, P. W. (1991) J. Cell Biol. 114, 557-565. 16. Rosen, G. D., Sanes, J. R., LaChance, R., Cunningham, J. M., Roman, J. & Dean, D. C. (1992) Cell 69, 1107-1119. 17. Freedman, A. S., Munro, J. M., Rice, G. E., Bevilacqua, M. P., Morimoto, C., McIntyre, B. W., Rhynhar, K., Pober, J. S. & Nadler, L. M. (1990) Science 249, 1030-1032. 18. Cybulsky, M. I., Fries, J. W. U., Williams, A. J., Sultan, P., Eddy, R., Byers, M., Shows, T., Gimbrone, M. A., Jr., & Collins, T. (1991) Proc. Natl. Acad. Sci. USA 88, 7859-7863. 19. Polte, T., Newman, W. & Gopal, T. V. (1990) Nucleic Acids Res. 18, 5901. 20. Polte, T., Newman, W., Raghunathan, G. & Gopal, T. V. (1991) DNA Cell Biol. 10, 3490-357. 21. Hession, C., Moy, P., Tizzard, R., Chisholm, P., Williams, C., Wysk, M., Burkly, L., Miyake, K., Kincade, P. & Lobb, R. (1992) Biochem. Biophys. Res. Commun. 183, 163-169. 22. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press, Plainview, NY), 2nd Ed. 23. Feinberg, A. P. & Vogelstein, B. (1983) Anal. Biochem. 132, 6-13. 24. Larigan, J. D., Tsang, T. C., Rumberger, J. M. & Burns, D. K. (1992) DNA Cell Biol. 11, 149-162. 25. Laemmli, V. K. (1970) Nature (London) 227, 680-685. 26. Gerber, L. D., Kodukula, K. & Udenfriend, S. (1992) J. Biol. Chem. 267, 12168-12173. 27. Cross, G. A. M. (1990) Annu. Rev. Cell Biol. 6, 1-39. 28. Cunningham, B. A., Hemperly, J. J., Murray, B. A., Prediger, E. A., Brackenbury, R. & Edleman, G. M. (1987) Nature (London) 236, 799-806. 29. Pigott, R., Dillon, L. P., Hemingway, I. H. & Gearing, A. J. H. (1992) Biochem. Biophys. Res. Commun. 187, 584-589. 30. Thomas, J. R., Dwek, R. A. & Rademacher, T. W. (1990) Biochemistry 29, 5413-5422. 31. Scallon, B. J., Kado-Fong, H., Nettleton, M. Y. & Kochan, J. P. (1992) BiolTechnology 10, 550-556. 32. Kishimoto, T. K., Jutila, M. A., Berg, E. L. & Butcher, E. C. (1989) Science 245, 1238-1241. 33. Powell, S. K., Cunningham, B. A., Edelman, G. M. & RodriguezBoulan, E. (1991) Nature (London) 353, 76-77. 34. Gunter, K. C., Germain, R. N., Lioczek, R. A., Saito, T., Yokoyamma, W. M., Chan, C., Weiss, A. & Shevach, E. M. (1987) Nature (London) 326, 505-507. 35. Osborn, L., Vassallo, C. & Benjamin, C. D. (1992) J. Exp. Med. 176, 99-107. 36. Moy, P., Lobb, R., Tizard, R., Olson, D. & Hession, C. (1993) J. Biol. Chem. 268, 8835-8841.