HCG up-regulates hypoxia inducible factor-1 alpha ... - Oxford Journals

Download PDF
13 downloads 67 Views 4MB Size Report
Comment
block using normal goat serum (NGS, Diagnostics Scotland, Edinburgh, UK) diluted 1:5 ..... BC, blood clot; GLC, granulosa-lutein cells; STR, stroma; TLC, theca-.
Molecular Human Reproduction Vol.14, No.8 pp. 455–464, 2008 Advance Access publication on June 30, 2008

doi:10.1093/molehr/gan040

HCG up-regulates hypoxia inducible factor-1 alpha in luteinized granulosa cells: implications for the hormonal regulation of vascular endothelial growth factor A in the human corpus luteum Sander van den Driesche1,2,4, Michelle Myers1,3, Eva Gay1, K. Joo Thong1 and W. Colin Duncan1 1

Obstetrics and Gynaecology, Department of Reproductive and Developmental Sciences, The Queen’s Medical Research Institute, Centre for Reproductive Biology, University of Edinburgh, 47 Little France Crescent, Edinburgh EH16 4TJ, UK 2 Present address: MRC Human Reproductive Sciences Unit, Centre for Reproductive Biology, The Queen’s Medical Research Institute, 47 Little France Crescent, Edinburgh EH16 4TJ, UK 3 Present address: Department of Pathology, Baylor College of Medicine, One Baylor Plaza, Houston, TX, UK 4

Correspondence address. MRC Human Reproductive Sciences Unit, Centre for Reproductive Biology, The Queen’s Medical Research Institute, 47 Little France Crescent, Edinburgh EH16 4TJ, UK. Tel: þ44-131-242-9124; E-mail: [email protected] Vascular endothelial growth factor (VEGF)-dependent angiogenesis is essential for normal luteal development. Although it is believed that hypoxia is the primary inducer of VEGF, in the corpus luteum it is up-regulated by human chorionic gonadotrophin (hCG). As hypoxia-inducible factor (HIF)1A has been shown to regulate VEGFA under ligand-stimulated conditions, we hypothesized that the effect of hCG on luteal VEGFA was mediated through HIF1A. We studied the effect of hCG on VEGFA and HIF1A expression in human luteinized granulosa cells in vitro and in human corpora lutea in vivo. HCG up-regulated VEGFA (P < 0.05) and HIF1A (P < 0.001) in vitro and VEGFA (P < 0.05) and HIF1A (P < 0.05) in vivo. There was a correlation between HIF1A and VEGFA in vivo (P < 0.005) and in vitro (P < 0.05). Nuclear HIF1A in granulosa-lutein cells was highest during luteal formation and absent from the fully functional corpus luteum (P < 0.05). Both VEGFA (P < 0.001) and HIF1A (P < 0.01) were up-regulated by dibutyryl-cAMP, through a PKA pathway. Hypoxia increased VEGFA (P < 0.001) and HIF1A (P < 0.05) expression and hCG further augmented VEGFA (P < 0.001) and HIF1A (P < 0.01) under hypoxic conditions. However, progesterone increased hCGstimulated VEGFA but had no effect on HIF1A expression. The expression of HIF1A is therefore hormonally regulated in luteal cells in vitro and in vivo and may regulate VEGFA expression under normoxic and hypoxic conditions. However, the differential effects of progesterone suggest that not all regulation of VEGFA is associated with an up-regulation of HIF1A. Keywords: hCG; VEGFA; HIF1A; hypoxia; corpus luteum

Introduction Nowhere is physiological angiogenesis more marked than in the vascularization of the luteinizing granulosa layer of the follicle during formation of the corpus luteum (Christenson and Stouffer, 1996; Rodger et al., 1997). Vascular endothelial growth factor (VEGF) has a fundamental role in luteal vascularization as VEGF inhibition in vivo during the luteal phase prevents luteal angiogenesis and subsequent progesterone secretion (Ferrara et al., 1998; Fraser et al., 2000; Wulff et al., 2001b; Zimmermann et al., 2001; Hazzard et al., 2002). In addition, excess VEGF generation during the vascularization of multiple follicles is thought to cause ovarian hyperstimulation syndrome (OHSS) (McClure et al., 1994; Neulen et al., 1995, 1998). Indeed VEGF is expressed by luteinizing granulosa cells in the developing corpus luteum of both non-primate (Phillips et al., 1990; Redmer et al., 1996; Berisha et al., 2000) and primate (Kamat et al., 1995; Gordon et al., 1996; Yamamoto et al., 1997; Hazzard et al., 1999;

Sugino et al., 2000; Wulff et al., 2000) species. The molecular regulation of luteal VEGF expression is therefore of major importance. It has been suggested that a decline in local oxygen concentration, which causes a hypoxic environment, is the main stimulator for VEGF production in the pre-ovulatory follicle and subsequent developing corpus luteum (Neeman et al., 1997). This implies that the luteal expression of VEGF may be regulated through nuclear transcription factors such as hypoxia-inducible factor (HIF). Indeed it has been suggested that hypoxia is a potent stimulus for VEGF expression by granulosa cells (Koos, 1995; Lee et al., 1997). The hypoxic induction of VEGF expression is also strongly supported by observations by Dissen et al. (1994) who showed that VEGF mRNA increases markedly when the ovary is made ischaemic by autotransplantation. Certainly, hypoxia has been shown to be a potent inducer of VEGF expression in other cell systems (Shweiki et al., 1992; Ladoux and Frelin, 1993) secondary to HIF1 binding to a hypoxia response element (HRE) within the 50 flanking region of the VEGF promoter

# The Author 2008. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: [email protected] 455

van den Driesche et al. (Minchenko et al., 1994; Forsythe et al., 1996). Finally, Tesone et al. (2005) demonstrated in corpora lutea from non-human primates that hypoxic conditions increased VEGF levels significantly, whereas LH exposure increased progesterone, but not VEGF concentrations in culture media. However, there are other views about the primary regulation of VEGF expression in the ovary. Human chorionic gonadotrophin (hCG) stimulates VEGF synthesis in human luteinized granulosa cells (Ravindranath et al., 1992; Koos, 1995; Neulen et al., 1995, 1998; Christenson and Stouffer, 1997; Laitinen et al., 1997; Lee et al., 1997; Fraser et al., 2005). In addition, luteal vascularization and the development of OHSS is absolutely dependent on LH/hCG stimulation (Neulen et al., 1998). Furthermore, in a fully formed, highly vascular, corpus luteum hCG also up-regulates VEGF expression (Wulff et al., 2001a). As HIF1A can regulate VEGF expression under non-hypoxic conditions (Zelzer et al., 1998; Bilton and Booker, 2003), we hypothesized that VEGFA was regulated by HIF1A under both hypoxic and gonadotrophin-stimulated conditions. We therefore investigated: (i) the effect of hCG on VEGFA and HIF1A mRNA expression in luteinized granulosa cells in vitro and in human corpora lutea in vivo; (ii) the immunolocalization of HIF1A protein in human corpora lutea; (iii) the signalling pathway involved in the stimulation of VEGFA and HIF1A expression; (iv) the effect of progesterone pretreatment on the expression of VEGFA and HIF1A and (v) the effect of hypoxia on the expression of HIF1A and VEGFA in luteinized granulosa cells.

Materials and Methods Collection of human corpora lutea Tissue collection was approved by the medical research ethics committee and all women gave informed consent. Human corpora lutea (n ¼ 13) were enucleated at the time of surgery from women with regular menstrual cycles undergoing hysterectomy for benign conditions and dated on the basis of the urinary LH surge as described previously (Duncan et al., 1996; Duncan, 2000). In this study, five corpora lutea were classified as early luteal (LH þ 1 to LH þ 5), of which two were classified as very early (LH þ 1 to LH þ 2), four as mid-luteal (LH þ 6 to LH þ 10) and four as late-luteal (LH þ 11 to LH þ 14). At operation, the corpus luteum was quartered to ensure that each quarter contained all cellular elements and fixed in 10% (v/v) neutral buffered formalin for subsequent immunohistochemistry. In addition, archival corpora lutea that had been immediately frozen and stored at 2708C from previous studies (Duncan et al., 2005b; Fraser et al., 2005) were also available. Frozen tissue quarters for mRNA extraction were available from three early luteal, seven mid-luteal, five late-luteal and five corpora lutea that had been ‘rescued’ [women were given daily doubling doses of exogenous hCG (Serono Laboratories, Welwyn Garden City, UK), starting at 125 IU, from LH þ 7 for 5– 8 days until surgery] as described previously (Duncan et al., 1996, 1998).

Isolation of human luteinized granulosa cells The medical ethics committee separately approved the collection of cells from patients undergoing assisted conception. With patient consent, follicular fluid was collected from women undergoing transvaginal oocyte retrieval for in vitro fertilization after ovarian stimulation using a standard procedure (Duncan et al., 2005a). Isolation of luteinized granulosa cells using Percoll density gradient centrifugation was carried out as described previously (Duncan et al., 2005b; Myers et al., 2007: van den Driesche et al., 2008).

Treatments in primary cultures of luteinized granulosa cells To investigate the acute effects of hCG, pooled luteinized granulosa cells (100 000 per well of three to five patients) were cultured in 24-well plates precoated with matrigel (BD Biosciences, Bedford, MA, USA) in serum-free medium (DMEM/F12 Ham mixture; Sigma-Aldrich, UK), supplemented with glutamine (2 mmol l21), insulin (6.25 mg l21), transferrin (6.25 mg l21),

456

selenious acid (6.25 mg l21), amphotericin (2.5 mg l21), penicillin (50 mg l21) and streptomycin (60 mg l21) as described previously (Duncan et al., 2005b). In Experiment 1, cells were refreshed with serum-free culture medium every 2 days after until Day 6 when they were treated either with 100 ng ml21 hCG (Serono Laboratories, Welwyn Garden City, UK), 1 mmol l21 dibutyryl-cAMP (dbcAMP; Sigma-Aldrich), or with 100 mmol l21 8-pCPT-20 -O-Me-cAMP (8CPT-2Me-cAMP, Sigma-Aldrich). In Experiment 2, luteinized granulosa cells were cultured in the presence of 10 mmol l21 of progesterone in ethanol (Sigma-Aldrich) and then treating with 100 ng ml21 hCG for 24 h as above. Controls contained appropriate concentrations of the carrier solution. In Experiment 3, to investigate the effects of hypoxia, cells were cultured under normoxic conditions (20% O2) for 5 days after which the cells were split into groups: (i) treatment on Day 6 with hypoxia, (ii) treatment on Day 6 with 100 ng ml21 hCG for 24 h under normoxic conditions, (iii) treatment on Day 6 with 100 ng ml21 hCG for 24 h under hypoxic conditions (1% O2) or (iv) pretreatment with hypoxia for 24 h followed by treatment on Day 6 with 100 ng ml21 hCG for 24 h under hypoxic conditions. In Experiment 4, to study the chronic effects of hCG, luteinized granulosa cells were cultured for 13 days as described previously (Duncan et al., 2005a). Briefly, cells were grown in 1 ng ml21 hCG until Day 7 when hCG was removed or increased to 100 ng ml21 until Day 13 of culture. Cells were analysed at Day 2, Day 7 and Day 13 in the absence of hCG and on Day 13 with hCG. This regimen is thought to mimic the luteal phase and luteal rescue in primary culture (Duncan et al., 2005a). In each experiment, three wells were pooled, in triplicate for each treatment for subsequent quantitative real-time PCR analysis. Each experiment was carried out three times to avoid biological bias, except Experiment 1 which was carried out four times.

Preparation of cDNA from luteinized granulosa cells cultures Luteinized granulosa cell mRNA was extracted using RNeasy mini-spin columns after lysis by the addition of RNeasy lysis buffer (Qiagen, Crawley, Sussex, UK). Lysates were frozen until processed as per manufacturer’s protocols, then DNase treated with on-column DNaseI (Qiagen) and quantified using the NanoDrop ND-1000 Spectrophometer (NanoDrop Technologies, Wilmington, DE, USA). Messenger RNA was then reverse transcribed into cDNA using random hexamers (Applied Biosystems, Foster City, CA, USA).

Quantitative analysis of gene expression by RT-PCR Quantitative real-time PCR (QRT-PCR) was carried out on the ABI PRISM 7900 heat-cycler sequence detection system (Applied Biosystems) using specific primers and probes (Eurogentec, Southampton, UK) for each gene of interest (Table I) and levels were related to a ribosomal 18S internal control (Applied Biosystems). All samples were performed in duplicate and a relative comparison was made to an appropriate tissue control tissue cDNA.

Immunohistochemistry A specific rabbit polyclonal antibody was used for the immunolocalization of HIF1A (clone H-206, Santa Cruz Biotechnology, CA, USA) using 5 mm paraffin tissue sections of human corpora lutea prepared on poly-L-lysine-coated microscope slides. These sections were dewaxed, rehydrated, washed in PBS, subjected to antigen retrieval by boiling in a pressure cooker in 0.01 mol l21 citric acid (pH 6.0) for 5 min and left to cool to room temperature. All sections were washed and placed in 3% (v/v) H2O2/methanol for 30 min, followed by an avidin and biotin block (Vector Laboratories, Peterborough, UK) and a further block using normal goat serum (NGS, Diagnostics Scotland, Edinburgh, UK) diluted 1:5 in PBS containing 5% (w/v) BSA (NGS/PBS/BSA) for 1 h at room temperature. Sections were incubated overnight in primary antibody diluted 1:100 in NGS/PBS/BSA at 48C. All sections were then washed twice for 5 min in PBS plus 0.01% (v/v) Tween-20 (PBS-T; Sigma-Aldrich) before incubation with biotinylated goat anti-rabbit secondary antibody (DAKO Corp., Cambridge, UK), diluted 1:500 in NGS/PBS/BSA. Incubation lasted for 1 h and was followed by two washes in PBS-T for 5 min. Thereafter, sections were incubated in avidin– biotin complex-HRP (Vector Laboratories) for 1 h according to the manufacturer’s instructions. All sections were washed in PBS-T (2  5 min) and bound antibodies visualized by incubation with liquid 3,30 -diaminobenzidine tetra-hydrochloride (DAKO). Sections were counterstained lightly with haematoxylin to enable cell identification. Negative controls for each antibody

VEGFA and HIF1A expression in human luteinized granulosa cells Table I. List of all primer/probe sequences used for Taqman quantitative RT-PCR. Gene

Fwd primer 50 -30

Rev primer 50 -30

Probe 50 -FAM-TAMRA-30

HIF1A NM_001530 HIF2A NM_001430 STAR NM_000349 VEGFA BC065522

CGCATCTTGATAAGGCCTC AACGAGTCCGAAGCCGAAG TTGCTTTATGGGCTCAAGAATG GTGCCCACTGAGGAGTCCA

AATCACCAGCATCCAGAAG CATGTCGCCATCTTGGGTC GGAGACCCTCTGAGATTCTGCTT GTGCTGGCCTTGGTGAGGT

TCACACGCAAATAGCTGAT TCCAAGGCTTTCAGGTACAAGTTGTCCATCT CATGCGCTGGCAGTACATGTGCAC CATCACCATGCAGATTATGCGGATCAA

examined were performed identically to the above protocol with the primary antibody omitted or replaced with non-specific immunoglobulins (Santa Cruz Biotechnology). Images were captured using an Olympus Corp. Provis microscope (Olympus Corp. Optical Co., London, UK) equipped with a Kodak DCS330 camera (Eastman Kodak Co., Rochester, NY, USA), stored on a HP computer and assembled using Photoshop 7.0.1 (Adobe Systems Inc., Mountain View, CA, USA).

Statistical analysis Statistical analyses used are highlighted in the text and figure legends. Parametric statistics were used if the data were normally distributed with appropriate standard deviations (GraphPad Prism version 4.0c for Macintosh, GraphPad Software, San Diego, CA, USA). Data, which were not normally distributed, were analysed after logarithmic transformation. Where more than two related treatments were assessed, groups were analysed by one-way ANOVA with Tukey’s multiple comparison test. Where two appropriate treatments were assessed, analysis was carried out using an unpaired t-test. Linear correlation between gene expressions was assessed using Pearson co-efficient. Differences were considered significant at P , 0.05 level. Global intensity of nuclear HIF1A immunostaining was determined in the granulosa-lutein cell layer on a five-point scale by an observer blinded to tissue identity as described previously (Duncan et al., 2005a) and analysed by Kruskal– Wallis testing.

Results hCG up-regulates the expression of VEGFA and HIF1A mRNA in vitro Treatment of cultured luteinized granulosa cells, in normoxic conditions, with 100 ng ml21 hCG for 24 h significantly up-regulated the expression of both VEGFA (P , 0.05, t-test; Fig. 1A) and HIF1A (P , 0.001, t-test; Fig. 1B) mRNA. We also investigated the effect of hCG on HIF2A mRNA expression. Unlike VEGFA and HIF1A, HIF2A was not significantly up-regulated by hCG in shortterm primary cultures (P ¼ 0.1678, t-test; Fig. 1C). Thus, the hormonal up-regulation of VEGFA in vitro seen in cultures of luteinized granulosa cells occurs when there is also an up-regulation of HIF1A.

The effect of hCG on the expression of VEGFA and HIF1A in human corpora lutea in vivo In order to investigate the effect of hCG on the luteal expression of VEGFA and HIF1A in women, mRNA expression was examined in archival corpora lutea tissues collected throughout the luteal phase and after luteal rescue with hCG in vivo. Both VEGFA and HIF1A mRNA expression showed the same trend over the luteal phase and in the presence of exogenous hCG (Fig. 2A and B). VEGFA and HIF1A mRNA expressions were significantly up-regulated when the corpora lutea were rescued when compared with the late luteal stage (P , 0.05, ANOVA; Fig. 2A and B, respectively). Furthermore, there was a significant correlation between HIF1A and VEGFA mRNA expression in copora lutea (r ¼ 0.67, P ¼ 0.0013; Pearson linear correlation; Fig. 2E). Thus, the high VEGFA expression in the early luteal phase, after the LH surge, and in rescued corpora lutea, after exposure to hCG, is correlated with HIF1A expression.

Figure 1: Effect of short-term stimulation of luteinized granulosa cells with 100 ng ml21 hCG for 24 h on the mRNA expression of VEGFA (A) and HIF1A (B) and HIF2A (C) (n.s., not significant; *P , 0.05; ***P , 0.001, t-test).

457

van den Driesche et al.

Figure 2: (A–B) In vivo expression of VEGFA and HIF1A in human corpora lutea during the luteal phase. (A) VEGFA (*P , 0.05, ANOVA) and (B) HIF1A mRNA expression are shown in the early (LH þ 1 to LH þ 5), mid- (LH þ 6 to LH þ 10) and late- (LH þ 11 to LH þ 14) luteal stages and after treatment with hCG from LH þ 7 for 5– 8 days (Rescue). (C –D) In vitro chronic manipulation with hCG in luteinized granulosa cell cultures designed to mimic the luteal phase. Fresh cultures (Day 2) were treated with low-dose hCG until Day 7, then hCG was increased (Day 13 þ hCG) or removed (Day 13 2 hCG). (C) VEGFA and (D) HIF1A mRNA expression. (E – F) Linear correlation between VEGFA and HIF1A mRNA expressions in corpora lutea (E; r ¼ 0.67, P ¼ 0.0013, Pearson linear correlation) and in vitro mimicked luteal phase (F; r ¼ 0.32, P ¼ 0.02, Pearson linear correlation) (*P , 0.05; **P , 0.01; ***P , 0.001, ANOVA).

VEGFA and HIF1A expression follows the same trend in prolonged cultures of luteinized granulosa cells in vitro As more than 50% of cells in human corpora lutea are not steroidogenic, and cannot respond directly to gonadotrophin stimulation, we utilized

458

prolonged cultures of luteinized granulosa cells to mimic the human luteal phase and luteal rescue in the absence of other cell types (Duncan et al., 2005a). In vitro, both VEGFA (P , 0.001, ANOVA; Fig. 2C) and HIF1A (P , 0.01, ANOVA; Fig. 2D) mRNA expression

VEGFA and HIF1A expression in human luteinized granulosa cells was decreased in prolonged cultures in the absence of hCG. Again the pattern for HIF1A expression paralleled that of VEGFA. The presence of 100 ng ml21 hCG from Days 7 to 13 prevented the down regulation of both VEGFA (P , 0.001, ANOVA; Fig. 2C) and HIF1A (P , 0.05, ANOVA; Fig. 2D) mRNA expression seen when hCG is removed. Again, the expression of HIF1A was correlated to the expression of VEGFA (r ¼ 0.32, P ¼ 0.02; Pearson linear correlation; Fig. 2F). These data are consistent with HIF1A being associated with the hCG mediated up-regulation of VEGFA in luteal steroidogenic cells in vitro and in vivo.

Immunolocalization of HIF1A across the luteal phase Next, we analysed the immunolocalization of HIF1A in the corpus luteum throughout the luteal phase (Fig. 3). No staining could be detected in negative control sections, which were incubated with non-specific immunoglobulins (Fig. 3A). In sections taken from the very early luteal phase (LH þ 1 and LH þ 2), there was marked nuclear HIF1A immunostaining in the nuclei of the granulosa-lutein cells (Fig. 3B and C). This specific nuclear staining persisted later in the early luteal stage (Fig. 3D), but by the mid-luteal stage we could not detect any nuclear HIF1A immunostaining in the steroidogenic cells (Fig. 3E and G), although there was light cytoplasmic immunostaining that was not seen in the negative controls. In the late-luteal stage, some light nuclear immunostaining of HIF1A could be seen in some steroidogenic cells (Fig. 3F and G). Nuclear HIF1A immunostaining in the corpus luteum is associated with luteal formation and is absent from the mature, fully functioning, gland.

Dibutyryl-cAMP, but not 8-pCPT-2 0 -O-Me-cAMP activates VEGFA and HIF1A mRNA expression As VEGFA expression is correlated with HIF1A expression, it is possible that gonadotrophin-induced up-regulation of VEGFA is mediated through regulation of HIF1A. We therefore examined the signalling pathway from the LH/hCG receptor involved in the up-regulation of VEGFA and HIF1A expression. Treatment with 1 mmol l21 dibutyrylcAMP (dbcAMP) for 24 h significantly induced the mRNA expression of VEGFA (P , 0.001, ANOVA; Fig. 4A) and HIF1A (P , 0.01, ANOVA; Fig. 4B) in the same pattern as seen with STAR (P , 0.001, ANOVA; Fig. 4C). We could not observe induction in VEGFA (Fig. 4A), HIF1A (Fig. 4B) or STAR (Fig. 4C) mRNA expression when our luteinized granulosa cells were treated with 100 mmol l21 8-pCPT-20 -O-Me-cAMP (8CPT-Me-cAMP) for 24 h. This suggests that the induction of VEGFA and HIF1A expression by hCG in luteinized granulosa cells is mediated through the same cAMP-PKA signalling pathway, and not through Epac-mediated effects.

Effects of progesterone treatment on the mRNA expression of VEGFA and HIF1A As the human corpus luteum expresses genomic receptors to the progesterone it produces on its steroidogenic cells (Suzuki et al., 1994; Maybin and Duncan, 2004), we analysed the effect of progesterone on our luteinized granulosa cell system. Although progesterone treatment on its own did not significantly elevate the expression of VEGFA mRNA (Fig. 5A), progesterone further augmented hCG-induced VEGFA expression (P , 0.01, ANOVA; Fig. 5A). In contrast, treating luteinized granulosa cells with progesterone alone, or with progesterone in combination with hCG, did not have an effect on the basal and hCG-stimulated expression of HIF1A mRNA (Fig. 5B). Thus, in our in vitro luteinized granulosa cell culture, progesterone seem to enhance the mRNA expression of VEGFA, but not of HIF1A. This provides evidence for differences in the regulation of HIF1A and VEGFA in these cells.

Effects of hCG on VEGFA and HIF1A mRNA expression in the presence of hypoxia To investigate the effects of hypoxia on the expression of VEGFA and HIF1A, we cultured luteinized granulosa cells for 24 h in 1% O2. Hypoxia up-regulated both VEGFA (P , 0.001, t-test) and HIF1A (P , 0.05, t-test) expression (Fig. 6). There was no effect of an additional 24 h under hypoxic conditions on the basal expression of VEGFA or HIF1A. To determine if hCG could augment this hypoxic induction, we treated luteinized granulosa cells with 100 ng ml21 of hCG. As under normoxic conditions (20% O2), hCG up-regulated both HIF1A (P , 0.01, t-test) and VEGFA (P , 0.001, t-test) expression under hypoxic conditions (1% O2) (Fig. 6). The significant up-regulation of VEGFA (P , 0.05, t-test; Fig. 6A) and HIF1A (P , 0.01, t-test; Fig. 6B) mRNA expression was also observed after 24 h pretreatment with hypoxia. In the presence of hypoxia, hCG is therefore still able to further augment HIF1A and VEGFA expression.

Discussion Hypoxia-induced HIF1A has been shown to be a major regulator of VEGF expression in different tissue systems (Shweiki et al., 1992; Ladoux and Frelin, 1993). We have shown that nuclear HIF1A is present in the granulosa-lutein cells of the developing corpus luteum at the time of maximal VEGF-induced angiogenesis (Wulff et al., 2000, 2001b; Fraser and Duncan, 2005). This is consistent with a role for hypoxic regulation of VEGF in luteal development. However, we have shown that HIF1A expression is induced by hCG in luteinizing granulosa cells and hCG-stimulated HIF1A expression is highly correlated with VEGFA expression under both hypoxic and normoxic conditions. This suggests that hCG-stimulated VEGFA expression may be associated with the regulation of HIF1A. If hypoxic signalling through HIF1A expression is involved in luteal vascularization, it is likely that LH/hCG has a major regulatory role in this process. In this study, we have not been able to investigate VEGFA protein expression. This is important, as changes in VEGF protein have been demonstrated in the absence of changes in mRNA expression (Tesone et al., 2005). However, in human corpora lutea (Wulff et al., 2001a), non-human primate corpora lutea (Hazzard et al., 2000) and luteinized granulosa cells, increases in protein paralleling mRNA expression have already been reported (Lee et al., 1997; Neulen et al., 1998). It is likely that changes in VEGFA mRNA as documented here are important in the regulation of angiogenesis. Certainly, there is evidence for LH/hCG regulation of VEGF and angiogenesis in the corpus luteum of non-human primates and women. The administration of a GnRH antagonist decreased VEGF mRNA expression in the monkey corpus luteum (Ravindranath et al., 1992). VEGF mRNA expression in human luteinized granulosa cells has been shown to be dose and time dependently enhanced by hCG in vitro (Neulen et al., 1995). Indeed, chronic or acute exposure to hCG directly stimulates VEGF production and secretion by monkey (Christenson and Stouffer, 1997) and human luteinized granulosa cells (Laitinen et al., 1997; Lee et al., 1997; Neulen et al., 1998; Wulff et al., 2001a). Our data confirm the induction of VEGF expression in luteinized granulosa cells by hCG but reveal that HIF1A is also induced and may therefore have a role in the regulation of VEGF expression. HIF1A certainly is a candidate to be involved in hypoxic regulation of VEGF. The avascular granulosa cell layer at ovulation is associated with diminished local oxygen concentrations (Gosden and ByattSmith, 1986; Neeman et al., 1997) and some authors suggested that hypoxia is a potent stimulus for VEGF expression by granulosa

459

van den Driesche et al.

Figure 3: Immunolocalization of HIF1A in human corpora lutea, with detail in insets, during the very-early luteal (B – C), early luteal (D), mid-luteal (E) and lateluteal (F) stage of the luteal phase. (A) Negative control section of a mid-luteal corpus luteum. Arrows indicate nuclear staining. (G) Quantification of nuclear HIF1A staining in early luteal, mid-luteal and late-luteal corpora lutea (*P , 0.05, Kruskal– Wallis). BC, blood clot; GLC, granulosa-lutein cells; STR, stroma; TLC, thecalutein cells. Scale bars ¼ 30 mm.

cells (Koos, 1995; Lee et al., 1997). Indeed, in these studies, both hypoxia and hCG tended to increase VEGF expression in human luteinized granulosa cells. Hypoxia has been implicated in VEGF regulation in cells extracted from the mature corpus luteum. Tesone et al. (2005) demonstrated in monkey corpora lutea that hypoxic conditions increased VEGF levels significantly. Indeed, inhibition of the development of the luteal vasculature and associated luteal hypoperfusion, using VEGF Trap, is associated with increased VEGF expression

460

(Wulff et al., 2001b) in the absence of clear LH action (with regards to stimulation of progesterone production) (Fraser and Duncan, 2005). In contrast, Martinez-Chequer et al. (2003) suggested that hypoxia is not a primary regulator of VEGF production in primate granulosa cells. It may be that hypoxic signals and gonadotrophin signalling are not independent in the regulation of VEGF. Little previous work has been done on HIF1A immunolocalization in the ovary. Nuclear HIF1A localization is a marker of hypoxia in other

VEGFA and HIF1A expression in human luteinized granulosa cells

Figure 5: The effect of progesterone treatment on the mRNA expression of VEGFA (A) and HIF1A (B). Luteinised granulosa cells (CTL) were cultured in the presence of 10 mmol l21 of progesterone (P4) and treated with 100 ng ml21 hCG (hCG þ P4) for 24 h, or in the absence of progesterone with 100 ng ml21 hCG (hCG) (*P , 0.05; **P , 0.01; ***P , 0.001, ANOVA).

Figure 4: The effect of dbcAMP and 8CPT-Me-cAMP on the mRNA expression of VEGFA (A), HIF1A (B) and STAR (C). Luteinized granulosa cells were stimulated with 100 ng ml21 hCG, 1 mmol l21 dibutyryl-cAMP (dbcAMP), or 100 mmol l21 8-pCPT-20 -O-Me-cAMP (8CPT-2Me-cAMP) for 24 h (*P , 0.05; **P , 0.01; ***P , 0.001, ANOVA).

tissue systems, including prostate cancer (Monsef et al., 2007) and the endometrium (Critchley et al., 2006). In the pig ovary, HIF1A mRNA has been described in the corpus luteum, particularly in the early luteal stage (Boonyaprakob et al., 2005). VEGF expression in the human corpus luteum has been shown to be high in the early luteal stage, and then to be reduced in the mid-luteal and late luteal stages (Otani et al., 1999; Sugino et al., 2000; Wulff et al., 2000, 2001a; Endo et al., 2001; Fraser et al., 2005). Specific nuclear localization of the HIFA protein is associated with hypoxia and HIF1A transcriptional activity. Our HIF1A immunostaining demonstrate that nuclear HIF1A expression in the luteal cells of the corpus luteum is highest

461

van den Driesche et al.

Figure 6: The effect of hCG treatment on VEGFA (A) and HIF1A (B) mRNA expression in the presence of hypoxia. Luteinized granulosa cells were cultured under normoxic conditions (20% O2) for 5 days after which the cells were (i) cultured under hypoxic (1% O2) (Hyp. CTL) or normoxic (Norm. CTL) conditions for 24 h; (ii) treatment on Day 6 with 100 ng ml21 hCG (Norm. hCG) or control (Norm. CTL) for 24 h under normoxic conditions; (iii) treatment on Day 6 with 100 ng ml21 hCG (Hyp. hCG) or control (Hyp. CTL) for 24 h under hypoxic conditions or (iv) pretreatment with hypoxia for 24 h followed by treatment on Day 6 with 100 ng ml21 hCG (Hyp.24 hCG) or control (Hyp.24 CTL) for 24 h under hypoxic conditions (*P , 0.05; **P , 0.01; ***P , 0.001, t-test).

during the early luteal stage. Indeed, we have recently confirmed this in the primate ovary and shown that VEGF inhibition increases nuclear HIF1A expression (Duncan et al., 2008). This suggests HIF1A involvement in luteal vascularization, but whether its expression is driven primarily by LH or hypoxia is uncertain. However, it is worth noting that the correlation of VEGFA and HIF1A expression persisted during luteal rescue when a fully vascularized corpus luteum is exposed to hCG. In addition, hCG increased HIF1A expression under hypoxic conditions and hypoxia did not increase HIF1A to the same extent as treatment with hCG. Although we found changes in HIF1A expression in luteinized granulosa cells, we did not observe any differences in HIF2A expression. This is in contrast to the only other study we are aware of in this area by Herr et al. (2004). In their study, they demonstrated that hCG up-regulated HIF2A in these cells. HIF2A was up-regulated by 11%, no more than the magnitude of the change in our studies (22%) that did not reach significance. Whether there is a small up-regulation of HIF2A by hCG or not, it is clear that the magnitude of the regulation of HIF1A expression is much greater. Both HIF1A and VEGFA seem to be activated by the same signalling pathway. Human CG binding to the LH/hCG receptor induces the

462

formation of the ternary complex of ligand-receptor-G protein, which in turn activates the second messenger cAMP system (Ryu et al., 1996). When we treat luteinized granulosa cells with dibutyryl-cAMP, which signals through PKA, we observed a significant up-regulation of VEGFA and HIF1A mRNA expression. In this experiment, the inclusion of one poor replicate meant that hCG treatment did not quite reach statistical significance. As an absolutely PKA-dependent control, STAR expression (Devoto et al., 2002) was also investigated in luteinized granulosa cells and showed the same up-regulation. Cyclic AMP also directly regulates Epac1 and Epac2, guanine nucleotide-exchange factors for the small GTPases Rap1 and Rap2 (Bos, 2006). A novel cAMP analogue, 8-pCPT-20 -O-Me-cAMP (8CPT-Me-cAMP), functions as a tool to discriminate between PKA- and Epac-mediated effects (Enserink et al., 2002). Our negative results with this compound confirm the PKA-dependent activation of both HIF1A and VEGFA. Interestingly, Toffoli et al. (2007) recently demonstrated an involvement of PKA in the phosphorylation of HIF1A in endothelial cells under hypoxic conditions. As indicated previously, there is good evidence for ligand-induced regulation of HIF1A expression (reviewed by Bilton and Booker, 2003). For example, Zelzer et al. (1998) demonstrated that the growth factors insulin and insulin-like growth factor-1 (IGF1) activate HIF1A and that this has subsequently been shown to occur through pathways separate to that employed by the classical hypoxic pathway. Furthermore, Richard et al. (2000) demonstrated an induction of HIF1A by various growth factors and hormones in vascular smooth muscle cells. We have shown that HIF1A mRNA expression is increased by hCG under both normoxic and hypoxic conditions. Although we were not able to investigate whether this translated into nuclear localization of the HIF1A protein, in the marmoset the LH surge is associated with marked induction of nuclear HIF1A expression (Duncan et al., 2008). It remains possible that the link between LH/hCG/cAMP and HIF1A is metabolic rather than direct. There is evidence for HIF1A involvement in glucose mobilization for energy requirements as well as cell metabolism (Airley and Mobasheri, 2007; Evans et al., 2007). It is possible that the marked metabolic changes induced by LH/hCG during luteinization drive HIF1A expression. Our data are not consistent with this being the major regulator, as no HIF1A immunostaining could be detected in the mid-luteal phase when the corpus luteum is highly metabolically active. Indeed, HIF2A is also implicated in glucose mobilization (Nilsson et al., 2005) and its expression did not change. However, it remains possible that a relatively hypoxic environment augments any effects of increasing cell metabolism on hypoxic signals. One compound with varying effects on VEGF expression is progesterone. In various human tissues, progesterone has been shown to induce VEGF expression (Hyder et al., 1998; Mirkin and Archer, 2004). Furthermore, an up-regulation of VEGF by progesterone in cultured bovine granulosa cells has also been reported (Shimizu and Miyamoto, 2007), and in isolated human endometrial cells, progesterone was shown to increase VEGF expression and production (Shifren et al., 1996). However, Lee et al. (1997) showed that VEGF production by human luteinized granulosa cells was enhanced by hCG independent of gonadotrophin-stimulated progesterone synthesis. This was confirmed by Fraser et al. (2005), who demonstrated that progesterone is not a major acute regulator of VEGF mRNA expression in cultures on luteinized granulosa cells, and by Tropea et al. (2006), who showed that progesterone reduces VEGF expression cells isolated from mid-luteal copora lutea. In this study, progesterone had little effect itself, but it augmented hCG-stimulated VEGFA expression. Although this observation is of interest by itself, and may explain the varying reports of the effects of progesterone, it is

VEGFA and HIF1A expression in human luteinized granulosa cells of particular interest in the context of HIF1A expression. Unlike the clear effect on VEGFA expression, progesterone had no effect on HIF1A expression suggesting other regulatory pathways involved in the regulation of VEGFA beside those involved in HIF1A regulation. In summary, HIF1A is expressed in the human corpus luteum and luteinized granulosa cells. As HIF1A is a major regulator of VEGFA in other tissue systems, it is likely that HIF1A regulates VEGFA in the human corpus luteum. Certainly, hypoxia increases VEGFA directly and nuclear HIF1A is most marked in the early luteal phase at the time of maximal angiogenesis. Although we have shown a clear correlation between HIF1A expression and VEGFA expression, and have shown hCG regulation of HIF1A under both hypoxic and normoxic conditions, it is still not clear if the effect of hCG on VEGFA is mediated through HIF1A expression. To that end, experiments focusing on the binding of HIF1A to the VEGF promoter upon hCG stimulation or HIF1A inhibition would now be indicated to further strengthen our hypothesis. It is unlikely, however, that all VEGFA regulation is mediated through PKA-regulated HIF1A expression as the progesterone augmented, hCG regulated, VEGFA expression seems to be independent of HIF1A. In luteal steroidogenic cells, HIF1A expression is induced by LH/hCG and this may have a role in the regulation of luteal VEGFA expression in the absence of hypoxia.

Funding The Cunningham Trust (to W.C.D. and S.D.).

Acknowledgements The authors would like to acknowledge the patients, nursing staff and embryologists of the assisted conception unit for their help in the tissue collection. We are grateful to Pam Cornes and Helen Wilson for technical advice and support, and Professor Hamish Fraser provided helpful discussion.

References Airley RE, Mobasheri A. Hypoxic regulation of glucose transport, anaerobic metabolism and angiogenesis in cancer: novel pathways and targets for anticancer therapeutics. Chemotherapy 2007;53:233–256. Berisha B, Schams D, Kosmann M, Amselgruber W, Einspanier R. Expression and tissue concentration of vascular endothelial growth factor, its receptors, and localization in the bovine corpus luteum during estrous cycle and pregnancy. Biol Reprod 2000;63:1106– 1114. Bilton RL, Booker GW. The subtle side to hypoxia inducible factor (HIFalpha) regulation. Eur J Biochem 2003;270:791– 798. Boonyaprakob U, Gadsby JE, Hedgpeth V, Routh PA, Almond GW. Expression and localization of hypoxia inducible factor-1alpha mRNA in the porcine ovary. Can J Vet Res 2005;69:215–222. Bos JL. Epac proteins: multi-purpose cAMP targets. Trends Biochem Sci 2006;31:680–686. Christenson LK, Stouffer RL. Proliferation of microvascular endothelial cells in the primate corpus luteum during the menstrual cycle and simulated early pregnancy. Endocrinology 1996;137:367–374. Christenson LK, Stouffer RL. Follicle-stimulating hormone and luteinizing hormone/chorionic gonadotropin stimulation of vascular endothelial growth factor production by macaque granulosa cells from pre- and periovulatory follicles. J Clin Endocrinol Metab 1997;82:2135–2142. Critchley HO, Osei J, Henderson TA, Boswell L, Sales KJ, Jabbour HN, Hirani N. Hypoxia-inducible factor-1alpha expression in human endometrium and its regulation by prostaglandin E-series prostanoid receptor 2 (EP2). Endocrinology 2006;147:744–753. Devoto L, Kohen P, Vega M, Castro O, Gonzalez RR, Retamales I, Carvallo P, Christenson LK, Strauss JF. Control of human luteal steroidogenesis. Mol Cell Endocrinol 2002;186:137–141. Dissen GA, Lara HE, Fahrenbach WH, Costa ME, Ojeda SR. Immature rat ovaries become revascularized rapidly after autotransplantation and show a gonadotropin-dependent increase in angiogenic factor gene expression. Endocrinology 1994;134:1146–1154.

Duncan WC. The human corpus luteum: remodelling during luteolysis and maternal recognition of pregnancy. Rev Reprod 2000;5:12– 17. Duncan WC, McNeilly AS, Illingworth PJ. Expression of tissue inhibitor of metalloproteinases-1 in the human corpus luteum after luteal rescue. J Endocrinol 1996;148:59– 67. Duncan WC, McNeilly AS, Illingworth PJ. The effect of luteal ‘rescue’ on the expression and localization of matrix metalloproteinases and their tissue inhibitors in the human corpus luteum. J Clin Endocrinol Metab 1998;83:2470–2478. Duncan WC, Gay E, Maybin JA. The effect of human chorionic gonadotrophin on the expression of progesterone receptors in human luteal cells in vivo and in vitro. Reproduction 2005a;130:83 –93. Duncan WC, Hillier SG, Gay E, Bell J, Fraser HM. Connective tissue growth factor expression in the human corpus luteum: paracrine regulation by human chorionic gonadotropin. J Clin Endocrinol Metab 2005b;90: 5366– 5376. Duncan WC, van den Driesche S, Fraser HM. Inhibition of vascular endothelial growth factor in the primate ovary up-regulates hypoxia inducible factor-1falphag in the follicle and corpus luteum. Endocrinology 2008;149:3313–3320. Endo T, Kitajima Y, Nishikawa A, Manase K, Shibuya M, Kudo R. Cyclic changes in expression of mRNA of vascular endothelial growth factor, its receptors Flt-1 and KDR/Flk-1, and Ets-1 in human corpora lutea. Fertil Steril 2001;76:762–768. Enserink JM, Christensen AE, de Rooij J, van Triest M, Schwede F, Genieser HG, Doskeland SO, Blank JL, Bos JL. A novel Epac-specific cAMP analogue demonstrates independent regulation of Rap1 and ERK. Nat Cell Biol 2002;4:901– 906. Evans A, Bates V, Troy H, Hewitt S, Holbeck S, Chung YL, Phillips R, Stubbs M, Griffiths J, Airley R. Glut-1 as a therapeutic target: increased chemoresistance and HIF-1-independent link with cell turnover is revealed through COMPARE analysis and metabolomic studies. Cancer Chemother Pharmacol 2007;61:377–379. Ferrara N, Chen H, Davis-Smyth T, Gerber HP, Nguyen TN, Peers D, Chisholm V, Hillan KJ, Schwall RH. Vascular endothelial growth factor is essential for corpus luteum angiogenesis. Nat Med 1998;4:336–340. Forsythe JA, Jiang BH, Iyer NV, Agani F, Leung SW, Koos RD, Semenza GL. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol 1996;16:4604–4613. Fraser HM, Duncan WC. Vascular morphogenesis in the primate ovary. Angiogenesis 2005;8:101–116. Fraser HM, Dickson SE, Lunn SF, Wulff C, Morris KD, Carroll VA, Bicknell R. Suppression of luteal angiogenesis in the primate after neutralization of vascular endothelial growth factor. Endocrinology 2000;141:995–1000. Fraser HM, Bell J, Wilson H, Taylor PD, Morgan K, Anderson RA, Duncan WC. Localization and quantification of cyclic changes in the expression of endocrine gland vascular endothelial growth factor in the human corpus luteum. J Clin Endocrinol Metab 2005;90:427–434. Gordon JD, Mesiano S, Zaloudek CJ, Jaffe RB. Vascular endothelial growth factor localization in human ovary and fallopian tubes: possible role in reproductive function and ovarian cyst formation. J Clin Endocrinol Metab 1996;81:353–359. Gosden RG, Byatt-Smith JG. Oxygen concentration gradient across the ovarian follicular epithelium: model, predictions and implications. Hum Reprod 1986;1:65 –68. Hazzard TM, Molskness TA, Chaffin CL, Stouffer RL. Vascular endothelial growth factor (VEGF) and angiopoietin regulation by gonadotrophin and steroids in macaque granulosa cells during the peri-ovulatory interval. Mol Hum Reprod 1999;5:1115– 1121. Hazzard TM, Christenson LK, Stouffer RL. Changes in expression of vascular endothelial growth factor and angiopoietin-1 and -2 in the macaque corpus luteum during the menstrual cycle. Mol Hum Reprod 2000;6:993– 998. Hazzard TM, Xu F, Stouffer RL. Injection of soluble vascular endothelial growth factor receptor 1 into the preovulatory follicle disrupts ovulation and subsequent luteal function in rhesus monkeys. Biol Reprod 2002;67:1305–1312. Herr D, Keck C, Tempfer C, Pietrowski D. Chorionic gonadotropin regulates the transcript level of VHL, p53, and HIF-2alpha in human granulosa lutein cells. Mol Reprod Dev 2004;69:397–401. Hyder SM, Murthy L, Stancel GM. Progestin regulation of vascular endothelial growth factor in human breast cancer cells. Cancer Res 1998;58:392– 395. Kamat BR, Brown LF, Manseau EJ, Senger DR, Dvorak HF. Expression of vascular permeability factor/vascular endothelial growth factor by human granulosa and theca lutein cells. Role in corpus luteum development. Am J Pathol 1995;146:157– 165.

463

van den Driesche et al. Koos RD. Increased expression of vascular endothelial growth/permeability factor in the rat ovary following an ovulatory gonadotropin stimulus: potential roles in follicle rupture. Biol Reprod 1995;52:1426–1435. Ladoux A, Frelin C. Hypoxia is a strong inducer of vascular endothelial growth factor mRNA expression in the heart. Biochem Biophys Res Commun 1993;195:1005– 1010. Laitinen M, Ristimaki A, Honkasalo M, Narko K, Paavonen K, Ritvos O. Differential hormonal regulation of vascular endothelial growth factors VEGF, VEGF-B, and VEGF-C messenger ribonucleic acid levels in cultured human granulosa-luteal cells. Endocrinology 1997;138:4748– 4756. Lee A, Christenson LK, Patton PE, Burry KA, Stouffer RL. Vascular endothelial growth factor production by human luteinized granulosa cells in vitro. Hum Reprod 1997;12:2756– 2761. Martinez-Chequer JC, Stouffer RL, Hazzard TM, Patton PE, Molskness TA. Insulin-like growth factors-1 and -2, but not hypoxia, synergize with gonadotropin hormone to promote vascular endothelial growth factor-A secretion by monkey granulosa cells from preovulatory follicles. Biol Reprod 2003;68:1112–1118. Maybin JA, Duncan WC. The human corpus luteum: which cells have progesterone receptors? Reproduction 2004;128:423– 431. McClure N, Healy DL, Rogers PA, Sullivan J, Beaton L, Haning RV, Jr, Connolly DT, Robertson DM. Vascular endothelial growth factor as capillary permeability agent in ovarian hyperstimulation syndrome. Lancet 1994;344:235–236. Minchenko A, Salceda S, Bauer T, Caro J. Hypoxia regulatory elements of the human vascular endothelial growth factor gene. Cell Mol Biol Res 1994;40:35– 39. Mirkin S, Archer DF. Effects of mifepristone on vascular endothelial growth factor and thrombospondin-1 mRNA in Ishikawa cells: implication for the endometrial effects of mifepristone. Contraception 2004;70:327–333. Monsef N, Helczynski L, Lundwall A, Pahlman S. Localization of immunoreactive HIF-1alpha and HIF-2alpha in neuroendocrine cells of both benign and malignant prostate glands. Prostate 2007;67:1219– 1229. Myers M, Gay E, McNeilly AS, Fraser HM, Duncan WC. In vitro evidence suggests activin-A may promote tissue remodeling associated with human luteolysis. Endocrinology 2007;148:3730–3739. Neeman M, Abramovitch R, Schiffenbauer YS, Tempel C. Regulation of angiogenesis by hypoxic stress: from solid tumours to the ovarian follicle. Int J Exp Pathol 1997;78:57 –70. Neulen J, Yan Z, Raczek S, Weindel K, Keck C, Weich HA, Marme D, Breckwoldt M. Human chorionic gonadotropin-dependent expression of vascular endothelial growth factor/vascular permeability factor in human granulosa cells: importance in ovarian hyperstimulation syndrome. J Clin Endocrinol Metab 1995;80:1967– 1971. Neulen J, Raczek S, Pogorzelski M, Grunwald K, Yeo TK, Dvorak HF, Weich HA, Breckwoldt M. Secretion of vascular endothelial growth factor/vascular permeability factor from human luteinized granulosa cells is human chorionic gonadotrophin dependent. Mol Hum Reprod 1998;4:203–206. Nilsson H, Jogi A, Beckman S, Harris AL, Poellinger L, Pahlman S. HIF-2alpha expression in human fetal paraganglia and neuroblastoma: relation to sympathetic differentiation, glucose deficiency, and hypoxia. Exp Cell Res 2005;303:447– 456. Otani N, Minami S, Yamoto M, Shikone T, Otani H, Nishiyama R, Otani T, Nakano R. The vascular endothelial growth factor/fms-like tyrosine kinase system in human ovary during the menstrual cycle and early pregnancy. J Clin Endocrinol Metab 1999;84:3845– 3851. Phillips HS, Hains J, Leung DW, Ferrara N. Vascular endothelial growth factor is expressed in rat corpus luteum. Endocrinology 1990;127:965–967. Ravindranath N, Little-Ihrig L, Phillips HS, Ferrara N, Zeleznik AJ. Vascular endothelial growth factor messenger ribonucleic acid expression in the primate ovary. Endocrinology 1992;131:254– 260. Redmer DA, Dai Y, Li J, Charnock-Jones DS, Smith SK, Reynolds LP, Moor RM. Characterization and expression of vascular endothelial growth factor (VEGF) in the ovine corpus luteum. J Reprod Fertil 1996;108:157–165. Richard DE, Berra E, Pouyssegur J. Nonhypoxic pathway mediates the induction of hypoxia-inducible factor 1alpha in vascular smooth muscle cells. J Biol Chem 2000;275:26765– 26771.

464

Rodger FE, Young FM, Fraser HM, Illingworth PJ. Endothelial cell proliferation follows the mid-cycle luteinizing hormone surge, but not human chorionic gonadotrophin rescue, in the human corpus luteum. Hum Reprod 1997;12:1723– 1729. Ryu KS, Ji I, Chang L, Ji TH. Molecular mechanism of LH/CG receptor activation. Mol Cell Endocrinol 1996;125:93– 100. Shifren JL, Tseng JF, Zaloudek CJ, Ryan IP, Meng YG, Ferrara N, Jaffe RB, Taylor RN. Ovarian steroid regulation of vascular endothelial growth factor in the human endometrium: implications for angiogenesis during the menstrual cycle and in the pathogenesis of endometriosis. J Clin Endocrinol Metab 1996;81:3112–3118. Shimizu T, Miyamoto A. Progesterone induces the expression of vascular endothelial growth factor (VEGF) 120 and Flk-1, its receptor, in bovine granulosa cells. Anim Reprod Sci 2007;102:228– 237. Shweiki D, Itin A, Soffer D, Keshet E. Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 1992;359:843– 845. Sugino N, Kashida S, Takiguchi S, Karube A, Kato H. Expression of vascular endothelial growth factor and its receptors in the human corpus luteum during the menstrual cycle and in early pregnancy. J Clin Endocrinol Metab 2000;85:3919– 3924. Suzuki T, Sasano H, Kimura N, Tamura M, Fukaya T, Yajima A, Nagura H. Immunohistochemical distribution of progesterone, androgen and oestrogen receptors in the human ovary during the menstrual cycle: relationship to expression of steroidogenic enzymes. Hum Reprod 1994;9:1589–1595. Tesone M, Stouffer RL, Borman SM, Hennebold JD, Molskness TA. Vascular endothelial growth factor (VEGF) production by the monkey corpus luteum during the menstrual cycle: isoform-selective messenger RNA expression in vivo and hypoxia-regulated protein secretion in vitro. Biol Reprod 2005;73:927–934. Toffoli S, Feron O, Raes M, Michiels C. Intermittent hypoxia changes HIF-1alpha phosphorylation pattern in endothelial cells: unravelling of a new PKA-dependent regulation of HIF-1alpha. Biochim Biophys Acta 2007;1773:1558–1571. Tropea A, Miceli F, Minici F, Tiberi F, Orlando M, Gangale MF, Romani F, Catino S, Mancuso S, Navarra P et al. Regulation of vascular endothelial growth factor synthesis and release by human luteal cells in vitro. J Clin Endocrinol Metab 2006;91:2303–2309. van den Driesche S, Smith VM, Myers M, Duncan WC. Expression and regulation of oestrogen receptors in the human corpus luteum. Reproduction 2008;135:509– 517. Wulff C, Wilson H, Largue P, Duncan WC, Armstrong DG, Fraser HM. Angiogenesis in the human corpus luteum: localization and changes in angiopoietins, tie-2, and vascular endothelial growth factor messenger ribonucleic acid. J Clin Endocrinol Metab 2000;85:4302– 4309. Wulff C, Dickson SE, Duncan WC, Fraser HM. Angiogenesis in the human corpus luteum: simulated early pregnancy by HCG treatment is associated with both angiogenesis and vessel stabilization. Hum Reprod 2001a;16:2515– 2524. Wulff C, Wilson H, Rudge JS, Wiegand SJ, Lunn SF, Fraser HM. Luteal angiogenesis: prevention and intervention by treatment with vascular endothelial growth factor trap(A40). J Clin Endocrinol Metab 2001b; 86:3377– 3386. Yamamoto S, Konishi I, Tsuruta Y, Nanbu K, Mandai M, Kuroda H, Matsushita K, Hamid AA, Yura Y, Mori T. Expression of vascular endothelial growth factor (VEGF) during folliculogenesis and corpus luteum formation in the human ovary. Gynecol Endocrinol 1997;11:371–381. Zelzer E, Levy Y, Kahana C, Shilo BZ, Rubinstein M, Cohen B. Insulin induces transcription of target genes through the hypoxia-inducible factor HIF1alpha/ARNT. EMBO J 1998;17:5085– 5094. Zimmermann RC, Hartman T, Bohlen P, Sauer MV, Kitajewski J. Preovulatory treatment of mice with anti-VEGF receptor 2 antibody inhibits angiogenesis in corpora lutea. Microvasc Res 2001;62:15– 25. Submitted on June 6, 2008; resubmitted on June 26, 2008; accepted on June 27, 2008