Heat shock protein 27 is associated with irinotecan resistance in ...

FEBS Letters 581 (2007) 1649–1656

Heat shock protein 27 is associated with irinotecan resistance in human colorectal cancer cells Dae Hwa Choia, Jin Sook Hab,c, Won Hyuck Leec, Jeong Kee Songc, Gyu Yeol Kima, Jae Hoo Parkb, Hee Jeong Chad, Byung Ju Leec, Jeong Woo Parkc,* a

d

Department of Surgery, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan 682-060, Republic of Korea b Internal Medicine, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan 682-060, Republic of Korea c Department of Biological Sciences, University of Ulsan, Ulsan 680-749, Republic of Korea Department of Pathology, Ulsan University Hospital, University of Ulsan College of Medicine, Ulsan 682-060, Republic of Korea Received 16 December 2006; revised 13 February 2007; accepted 14 February 2007 Available online 22 March 2007 Edited by Varda Rotter

Abstract Heat shock protein (Hsp) in tumor cells has been proposed to enhance their resistance to chemotherapeutic agents. In the present study, we investigated the influence of Hsp expression on the irinotecan resistance of human colorectal cancer cells. Among eight Hsp genes tested in this study, we confirmed that the expression of Hsp27 correlated with irinotecan resistance in colorectal cancer cells. Specific inhibition of Hsp27 expression using an antisense oliogodeoxynucleotide increased the irinotecan sensitivity. On the contrary, an overexpression of Hsp27 decreased the irinotecan sensitivity in colorectal cancer cells. Elevated expression of Hsp27 decreased caspase-3 activity in colorectal cancer cells. The expression level of Hsp27 determined by immunohistochemical analysis correlated with the clinical response to irinotecan in colorectal cancer patients. Hsp27 expression levels of irinotecan-non-responder (mean staining score, 6.28; proportion of high staining score, 64.2%) were significantly higher compared to those of irinotecan-responder (mean staining score, 3.16; proportion of high staining score, 33.3%) (P for ttest = 0.045). These findings suggest that Hsp27 is involved in the irinotecan resistance of colorectal cancer cells possibly by reducing caspase-3 activity. 2007 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: Human colorectal cancer cells; Irinotecan resistance; Hsp27

1. Introduction Irinotecan (CPT-11) is a topoisomerase I (Top1) inhibitor that has efficacy in the treatment of certain neoplasm including colorectal cancer [1]. Irinotecan treatment results collisions between Top1 cleavage complexes and DNA replication forks that produce irreversible double-strand breaks, ultimately leading to irreversible DNA damage and to a series of events that result in apoptosis [2,3]. Despite an initial response to therapy, most patients treated with irinotecan become resistant *

Corresponding author. Fax: +82 52 259 1694. E-mail addresses: [email protected] (D.H. Choi), [email protected] (J.W. Park). Abbreviations: Hsp, heat shock protein; ODN, oliogodeoxynucleotide; TUNEL, TdT-mediated dUTP nick end labeling

to this chemotherapy and exhibit tumor progression [4]. Based on preclinical studies, it is likely that clinical resistance to this drug is the result of (a) inadequate accumulation of drug in the tumors, (b) resistance-conferring alterations in Top1-irinotecan interaction, or (c) alterations in cellular responses to the Top1-irinotecan interaction [5]. Recent experimental evidence suggests that heat shock proteins (Hsps) like Hsp27, Hsp70, and Hsp90 are overexpressed in several tumor cells [6,7]. For example, Hsp27, a small Hsp, is abundantly expressed in colon carcinoma cells [8] and many other cancer cells [9], Hsp70 is highly expressed in human breast tumors and is needed for their survival [10], and expression of Hsp90 was elevated in prostate carcinoma [11]. Hsps can inhibit apoptosis by interaction with apoptotic molecules [12–15] and high expression of Hsps has been shown to protect tumor cells from apoptosis by several commonly used anticancer drugs [12,16–20]. Apoptosis induction is an important mechanism in the irinotecan-induced killing of tumors [2,3] and, thus, inhibition of apoptosis by Hsps can induce a resistance to irinotecan. However, the role of Hsps in the irinotecan resistance of cancer cells is poorly understood. In the present study, we have examined the effect of an overexpression of Hsps on the irinotecan resistance of human colorectal cancer cells. Our study indicates that Hsp27 is overexpressed in irinotecan-resistant colorectal cancer cells. Hsp27 inhibition using Hsp27 antisense oliogodeoxynucleotide (ODN) increased the irinotecan sensitivity of colorectal cancer cells and, on the contrary, an overexpression of Hsp27 increased the irinotecan resistance of the colorectal cancer cells. Immunohistochemical analysis on resected specimens before irinotecan treatment showed a clinical relationship between Hsp27 expression levels and irinotecan resistance in colorectal cancer patients. Our results suggested that Hsp27 expression is associated with the irinotecan resistance of colorectal cancer cells.

2. Materials and methods 2.1. Cell culture and cell line selection Four human colorectal cancer cell lines, Colo320HSR, KM20, KM12C, and KM1214 were purchased from Korean Cell Line Bank (KCLB) (Seoul, Korea) and were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (GibcoBRL), 100 U of penicillin, and 100 lg of streptomycin/ml. They were cultured at 37 C in a humidified chamber containing 5% CO2.

0014-5793/$32.00 2007 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2007.02.075

1650 For the induction of apoptosis, cells were plated in 60-mm dishes 1 day prior to irinotecan treatment. Relative irinotecan cytotoxicity of the four cell lines was evaluated using an MTT colorimetric assay. Briefly, cells were plated in triplicate at 1.2 · 104 cells/well in 96-well culture plates in DMEM. On the following day, the cells were treated with irinotecan at concentrations ranging from 0 to 400 lM. On the consecutive days, the cells were incubated with MTT dye (1 mg/ml) at 37 C for 4 h and lysed in a buffer containing 20% (w/v) SDS, 50% (v/v) N,N-dimethylformamide (pH 4.5). Absorbance at 600 nm (OD600) was determined for each well using an ELX 808 automated microplate reader (Bioteck Instrument). 2.2. TdT-mediated dUTP nick end labeling (TUNEL) staining TUNEL staining was conducted using an in situ cell death detection kit, TMR Red, according to the protocol supplied by the manufacturer (Roche Molecular Biochemicals). Briefly, cells were plated in 25 cm2 flasks at 2 · 105 cells/ml DMEM. On the following day, the cells were treated with 50 lM irinotecan, harvested and were fixed with 2% paraformaldehyde solution and permeabilized with 0.1% Triton X-100 in 0.1% sodium citrate. After washing twice with PBS, cells were incubated in a TUNEL reaction mixture containing terminal deoxynucleotidyl transferase and tetramethyl-rhodamine-dUTP. Cells were analyzed for fluorescence intensity using a FACS flow cytometer (Becton Dickinson, Inc.) and a FluoView 500 confocal microscope (Olymphus). The effects of the caspase-3 inhibitor, Ac-DEVD-CHO (Calbiochem, USA), on irinotecan-induced apoptosis were determined by adding 3 lM or 10 lM Ac-DEVD-CHO to cultured cells 1 h prior to treatment with 50 lM irinotecan. 2.3. Semi-quantitative RT-PCR and real-time PCR Five micrograms of DNase I-treated total RNA was reverse transcribed using oligo-dT and Superscript II reverse transcriptase (Invitrogen), according to the manufacturer’s instructions. Semiquantitative RT-PCR was performed using Taq polymerase (Qiagen) and appropriate primers. Quantitative PCR was performed by monitoring in real-time the increase in fluorescence of the SYBR Green dye (Molecular Probes, Eugene, OR) on a DNA Engine Opticon Continuous Fluorescence Detection System (MJ Research Inc.) according to the manufacturer’s instructions. Specificities of each primer pair were confirmed by melting curve analysis and agarose-gel electrophoresis. 2.4. PCR primers Primers were designed using the Primer3 software: http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi. PCR primer pairs were as follows. Hsp27: GTCCCTGGATGTCAACCACT, CTTTACTTGGCGGCAGTCTC; Hsp40: ATGGTACCTCTTTCAGCTACACATT, GAGATTTTCATCTTCTTGGTACAGC; Hsp60: TCTTATGA-TAGAGTGTTCAGCCAGA, TGTAAAGATCCATCCCTTTTCATAG; Hsp70: AGGTAAGGCTAACAAGATCACCAAT, CTTCTGATGCTCATACTCCTCCTT; GRP78: TTCTTCAATGGCAAGGAACC, TTTGTCAGGGGTCTTTCACC; Hsp90a: GGCAGAGGCTGATAAGAACG, AGTCATCCCTCAGCCAGAGA; Hsp90b: TCCATCTATTACATCACTGGTGAGA, GATTGTCAC CTTCTCAACCTTCTTA; GRP94: TCCATGATATGATGCCTAAATACCT, TAATGTCAGTTGGATGATGAGAAGA. 2.5. Plasmid construction and transfection KM12C cells that overexpressed human Hsp27 were generated using the pcDNA3.1/Myc-His A vector (Invitrogen). Full-length human cDNA of Hsp27 was cloned by RT-PCR from the RNA of Colo320 cell lines using a forward primer GAATTCATGACCGAGCGCCGCGTC and a reverse primer CTCGAGCTTGGCGGCAGTCTCATC and subcloned into the pcDNA3.1/Myc-His A vector. KM12C cells were transfected with pcDNA3.1-Hsp27 construct using Lipofectamine (GibcoBRL). KM12C/Hsp27 cells stably transfected with Hsp27 were selected by adding neomycin (200 lg of neomycin/ml; Invitrogen) 3 days after transfection and stably transfected cells were tested for an overexpression of Hsp27 by RT-PCR. KM12C/pcDNA cells was generated by transfection with pcDNA3.1/Myc-His vector and used as controls. A region of Hsp27 (5 0 -GTCAGCCAGCATGACCGAGC-3 0 ) was chosen as the target for Hsp27 antisense ODN. An Hsp27 scrambled ODN with the same nucleotide composi-

D.H. Choi et al. / FEBS Letters 581 (2007) 1649–1656 tion as Hsp27 antisense ODN but which lacked significant sequence homology to the Hsp27 was also designed as a negative control. The phosphorothioate/phosphodiester chimeric ODNs were purchased from Integrated DNA Technologies (Coralville, IA, USA). 5 · 105 cells were plated on culture flask (25 cm2) on day 0 and transfection was performed on day 1 using oligofectamine (GIBCO-BRL) according to the manufacturer’s protocol in the presence of 200 nM of ODNs. Two days after the transfection, cells were treated with 50 lM irinotecan for 24 h. 2.6. Construction of DRG2 luciferase reporter constructs and luciferase assay PCR was performed to amplify promoter region (from 724 to 35; translation start site, +1) of Hsp27 which is required for Hsp27 promoter activity [21]. Primers for PCR were designed from the genomic sequence adjacent to the human hsp27 exon 1 in a GenBank database of human chromosome 7. Hsp27-Pm-Up, 5 0 -GGTACCACAGGCATGCACCAC-3 0 ; Hsp27-Pm-Down, 5 0 -CTCGAGAAGTGCGGGGCGCTG-3 0 . The PCR product (701 bp) amplified from human genomic DNA was ligated into the Kpn1/Xho1 site of the promoterless luciferase-reporter vector pGL3-basic (Promega). Cells were grown to a density of about 40% confluency and transfected with 200 ng of hsp27 promoter luciferase-reporter construct, pGL3/Hsp27 promoter, using 3 ll/g DNA of Lipofectamin in a volume of 50 ll Opti-MEM (Gibco BRL). Twenty four hours after transfection, cells were treated with 50 lM irinotecan for 24 h. Transfection efficiency was normalized by cotransfecting the plasmid pCMV-b-gal (Clontech, Palo Alto, CA, USA) at 20 ng/ml. Both the luciferase assay (Luciferase Assay System, Promega) and the b-galactosidase assay were carried out according to the manufacturer’s instructions as reported [22]. In both cases, the chemiluminescent signal was determined in a luminometer (VICTOR2 Multilabel Reader, Wallac). 2.7. Caspase-3 activity assay Cells were lysed in lysis buffer (10 mM HEPES, pH 7.4, 10% sucrose, 2 mM EDTA, 0.1% CHAPS, 10 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, and 20 lg/ml each of pepstatin A, leupeptin, and aprotinin) for 15 min on ice. After centrifugation at 15 000 · g for 15 min at 4 C, supernatants containing 50 lg of protein were incubated with 50 lM Ac-DEVD-AFC for 1 h. Caspase-3 activity was determined by fluorometric detection of the hydrolyzed product using a microplate spectrofluorometer (VICTOR2 Multilabel Reader, Wallac). 2.8. Immunoblot analysis Cells were washed twice with cold-phosphate-buffered saline and 30– 50 lg of protein was resolved by SDS–PAGE, transferred onto Hybond-P membranes (Amersham Biosciences, Inc.), and probed with appropriate dilutions of the following primary antibodies: antiHsp27 (F-4) (Santa Cruz Biotechnology); anti-caspase 3 (CPP32) (Sigma). Immunoreactivity was detected using the ECL detection system (Amersham Biosciences, Inc.). The films were exposed at multiple time points to ensure that the images were not saturated. 2.9. Patients and samples The study group was composed of 20 patients with colorectal cancer who underwent surgical treatment at our Hospital and had a follow-up therapeutic treatment with irinotecan. Irinotecan was administrated i.v. at 180 mg/m2 for 90 min and 5-FU 400 mg/m2 over 2 days and leukovorin, 200 mg/m2, six times, at 2-week intervals until there was evidence of disease progression (FOLFIRI regimen). Response to irinotecan was evaluated every cycle (i.e., every 2 or 3 months), based on (a) computed tomography performed every cycle and (b) serum CEA level (i.e., every 4 weeks). To be classified as ‘‘responder’’, patients had to be rated improved for one or two measures without being assessed as aggravated for the other factor. Otherwise, patients were classified as ‘‘non-responder’’. The surgical colorectal samples were fixed in 10% buffered formalin, embedded in paraffin wax using standard procedures, and were later used for immunohistochemical analyses. The Local Ethical Committee of our hospital provided institutional review board approval for this study. Because this study was performed on archival material, we did not obtain informed consent.

D.H. Choi et al. / FEBS Letters 581 (2007) 1649–1656

3. Results

A 120

Colo320 KM12C

100

Percent control

KM20 KM1214

80 60 40 20 0 0

10

50

100

200

400

Irinotecan (μM)

B % apoptotic cells

2.10. Immunohistochemistry The paraffin blocks of the most representative tumor tissues fulfilling the histological criteria were cut on to poly-L -lysin-coated slides. The sections were deparaffinized and rehydrated, and endogenous peroxidase activity was blocked using a 0.3% hydrogen peroxide solution at room temperature for 10 min. For epitope retrieval before immunostaining, slides were preheated with 0.01 M citrate buffer, pH 6.0 (three times for 10 min at 700 W) and allowed to cool to room temperature for 20 min. The sections were then incubated with primary anti-human Hsp27 monoclonal antibody (F-4) (Santa Cruz Biotechnology) at 4 C overnight. On the next day, primary antibodies were detected by using a commercial kit (DAKO LSAB kit, Carpinteria, CA). Briefly, a biotinylated linking antibody and a streptavidin peroxidase complex were added consecutively for 10 min at room temperature. After washing twice in PBS, peroxidase activity was visualized with 3-amino-9-ethyl carbazole (Sigma). The sections were counterstained with Mayer’s hematoxylin. The negative control was stained by omitting the primary antibody incubation. All the tumor tissue in the section was selected for immunohistochemical evaluation. The Hsp27 expression was scored semiquantitatively based on the staining intensity and proportion of staining. Staining intensity was scored as 0–10%, 0; 11–50%, 1; 51–75%, 2; and 76–100%, 3 and proportion of staining was scored as 0–25%, 1; 26–50%, 2; 51–75%, 3; 76–100%, 4. Staining scores were obtained by a multiplication of staining intensity by proportion of staining. Two pathologists, who did not have any prior clinical or pathological information, scored the expression at 100· magnification in light microscopy. All the available areas in the section were evaluated.

1651

70 60

KM12C

50

Colo320

40 30 20 10

3.1. Irinotecan cytotoxicity assay To select cell lines with different irinotecan sensitivity, we determined the irinotecan sensitivity among four colorectal cancer cell lines. There was variable irinotecan sensitivity among those four cell lines. The IC50 for the most resistant cell line, Colo320, was approximately 10 times higher than the IC50 for the most sensitive cell line, KM12C. The results of the cytotoxicity assay are shown in Fig. 1A. To examine the ability of irinotecan to induce apoptosis in Colo320 and KM12C cells, cultures were treated with 50 lM irinotecan, after which they were stained with TUNEL and examined by FACS analysis. As shown in Fig. 1B, irinotecan caused the apoptosis of KM12C cells and irinotecan-induced apoptosis began to be detected after 18 h of treatment of irinotecan and increased dramatically thereafter resulting in the death of greater than 43% of the cell population by 24 h of treatment. However, the irinotecan treatment did not cause a significant increase in apoptosis of Colo320 cells until 24 h of irinotecan treatment. 3.2. Expressions of Hsps in Colo320 and KM12C cell lines To determine whether or not the expression levels of Hsps were related to irinotecan resistance, mRNA expression levels of Hsp27, Hsp40, Hsp60, Hsp70, Hsp90a, Hsp90b, GRP78, and GRP94 were evaluated by RT-PCR and real-time PCR in irinotecan-treated Colo320 and KM12C cells. The expression levels of three Hsps, such as Hsp90a, Hsp90b and GRP78, were significantly higher than those of five other Hsps such as Hsp27, Hsp40, Hsp60, Hsp70 and Grp94, both in the irinotecan-treated Colo320 and KM12C cells (Fig. 2A and B). However, the expression levels of the three Hsps in irinotecantreated Colo320 cells were similar to those in irinotecan-treated KM12C cells, suggesting that expression levels of the three Hsps were not related to irinotecan resistance. On the contrary, among the five Hsps with low expression levels, the

0 0

6

12

18

24

30

36

48

Time (hrs) Fig. 1. Selection of irinotecan-sensitive (KM12C) and irinotecanresistant (Colo320) cell lines. (A) Irinotecan cytotoxicity assay for the four colorectal cancer cell lines. Cell lines were plated at equal density on day zero, and treated with increasing concentrations of irinotecan on day 1. Viability for all cell lines was determined by MTT on day 2. (B) Irinotecan induced apoptosis of cells in a time-dependent manner. KM12C and Colo320 cells were treated with 50 lM irinotecan for the indicated times. Cells were then fixed with 2% paraformaldehyde, stained with TUNEL, and analyzed by FACS. The results are presented as the means ± S.D. from three separate experiments.

expression level of Hsp27 showed significant difference between the two cell lines and was about 35-fold higher in the irinotecan-treated Colo320 cells than in the irinotecan-treated KM12C cells in real-time PCR analysis (Fig. 2A and B), suggesting the possibility that the expression level of Hsp27 is related to the irinotecan resistance. Under normal conditions, the expression level of Hsp27 showed about 7-fold difference between Colo320 cells and KM12C cells. However, irinotecan treatment caused a significant difference in the expression level of Hsp27 between the two cell lines (Fig. 2C). In irinotecansensitive KM12C cells, irinotecan treatment caused a slight decrease in Hsp27 expression level. However, in irinotecanresistant Colo320 cells, irinotecan treatment increased Hsp27 expression level by 3-fold (Fig. 2C). 3.3. Hsp27 expression and irinotecan sensitivity in colorectal cell lines To determine whether or not Hsp27 expression is correlated with irinotecan resistance, we analyzed the Hsp27 expression

1652


GR

P7 8 HS P4 0 HS P7 0 HS P9 0b GR P9 4 HS P6 0 HS P27 HS P90 a

Expression relative to GAPDH

C

A

KM12C

Colo320

D

3.5

Luciferase activity (fold of pGL3)

Expression relative to GAPDH

B

Colo320 KM12C

3 2.5 2 1.5 1 0.5 0 HSP27

HSP40

HSP60

HSP70 HSP90a HSP90b GRP78

GRP94

0.8 No treatment

0.7

Irinotecan

0.6 0.5 0.4 0.3 0.2 0.1 0

Colo320

KM12C

KM20

KM1214

14 12 Colo320 KM12C

10 8 6 4 2 0 pGL3

pGL3 + Irinotecan

pGL3/Hsp27P pGL3/Hsp27P + Irinotecan

Fig. 2. Differential expression of Hsp27 between irinotecan-sensitive and irinotecan-resistant cells. (A) Expressions of 8 Hsp genes in KM12C and Colo320 cells 24 h after irinotecan treatment were determined by semiquantitative RT-PCR analysis and the PCR products were analyzed by 1% agarose gel electrophoresis and stained with ethidium bromide. (B) Quantitative, real-time RT-PCR analysis of 8 Hsp mRNAs expression in KM12C and Colo320 cells 24 h after irinotecan treatment. (C) Expression levels of Hsp27 in four colorectal cancer cell lines were determined by real-time PCR analysis of Hsp mRNAs before and 24 h after irinotecan treatment. Relative expression values in real-time PCR were obtained by the equation: relative expression Hsp27 (y = 2(Ct(y)Ct(GAPDH))). (C) Analysis of Hsp27 promoter activity in KM12C and Colo320 cells. Hsp27 promoter luciferase-reporter construct was transiently transfected into cells. After irinotecan treatment for 24 h, luciferase activity was assayed and luciferase activity was normalized to b-galactosidase activity. The luciferase activity of pGL3 of untreated cells was defined as one. The results are presented as the means ± S.D. from three separate experiments.

in four colorectal cancer cell lines with different irinotecan resistance. Cell lines showing intermediate irinotecan resistance (such as KM1214 and KM20) revealed intermediate expression level of Hsp27 compared to Colo320 and KM12C cell lines (Fig. 2C), suggesting an association of Hsp27 expression with the irinotecan resistance of colorectal cancer cell lines. To determine whether or not there is difference in the irinotecan-induced expression of Hsp27 between irinotecan-sensitive KM12C cells and irinotecan-resistant Colo320 cells, KM12C and Colo320 cells were transfected with Hsp27 promoter luciferase-reporter construct. Transient transfection of Colo320 cells with this construct resulted in luciferase level 4-fold higher than the promoterless control plasmid pGL3basic. In addition, irinotecan treatment induced the luciferase level to 10-fold higher than the pGL3basic in Colo320 cells (Fig. 2D). However, when this construct was transfected into the KM12C cells, luciferase level was decreased to 0.6-fold of the pGL3basic control and irinotecan treatment resulted in further decrease of luciferase level to 0.3-fold of pGL3basic (Fig. 2D). These results suggest that, while Hsp27 expression is suppressed and is not induced by irinotecan in irinotecansensitive KM12C cells, Hsp27 is expressed under normal condition and its expression is further increased by irinotecan in irinotecan-resistant Colo320 cells.

3.4. Overexpression induced the resistance of colorectal cancer cells to irinotecan Although the results described above demonstrated that elevated levels of Hsp27 were associated with irinotecan resistance, they did not address whether or not Hsp27 was directly involved in irinotecan resistance in human colorectal cancer cells. Therefore, we sought to determine if an overexpression of Hsp27 could induce irinotecan resistance in irinotecan sensitive colorectal cancer cells, KM12C cells. To test this possibility, Hsp27 expression vector (pcDNA3.1-Hsp27) was transfected into KM12C cells to establish stably transfected cells, KM12C/Hsp27. KM12C/pcDNA cells that were stably transfected with empty vector were used as controls. The overexpression of Hsp27 in the KM12C/Hsp27 cells was confirmed by RT-PCR (Fig. 3A) and Western blotting (Fig. 3B). The Hsp27 protein level of KM12C/Hsp27 cells was increased by more than 2-fold compared to KM12C cells (Fig. 3B). As shown in Fig. 3C, while the irinotecan-induced apoptosis of KM12C/pcDNA cells was similar to that of KM12C cells, the KM12C/Hsp27 cells showed a decreased irinotecan-induced apoptosis to 46% of KM12C cells. To test whether or not the down-regulation of Hsp27 affects irinotecan resistance in Colo320 cells, we used an antisense ODN. Treatment of the Colo320 cells with antisense ODN against Hsp27 significantly reduced the Hsp27 expression level

HSP27

Colo320

A

RT-PCR

Colo320/Scramble

1653

Colo320/Antisense

KM12C/pcDNA

KM12C

A

KM12C/Hsp27


Hsp27

GAPDH

GAPDH

B

Hsp27

Western blot

B

Hsp27

β-actin

% apoptotic cells

40 20

Western blot

β-actin

C 60

40 30 20 10

Colo320/Scramble

Colo320/Antisense

KM12C/pcDNA

KM12C/Hsp27

Colo320

0

0

KM12C

% apoptotic cells

C

RT-PCR

Fig. 3. Effects of Hsp27 overexpression on the irinotecan-induced apoptosis in irinotecan-sensitive colorectal cancer cell line. Irinotecansensitive cell, KM12C, was stably transfected with full-length cDNA of Hsp27 and, as a control, KM12C cells were stably transfected with pcDNA3.1. The stable transfectants of KM12C cells were treated with 50 lM irinotecan for 24 h. The expression of Hsp27 was determined by RT-PCR (A) and Western blotting (B) and the irinotecan-induced apoptosis was determined by TUNEL staining at 24 h after irinotecan treatment (C).

Fig. 4. Effects of down-regulation of Hsp27 on the irinotecan-induced apoptosis in irinotecan-resistant colorectal cancer cell line. Irinotecanresistant cell, Colo320, was transfected with 200 nM of Hsp27 antisense or scrambled ODNs and then 2 days after the transfection, cells were treated with 50 lM irinotecan for 24 h. The expression of Hsp27 was determined by RT-PCR (A) and Western blotting (B) before the irinotecan treatment and the irinotecan-induced apoptosis was determined by TUNEL staining at 24 h after irinotecan treatment (C).

and Hsp27 protein level of antisense ODN-treated Colo320 cells was reduced to less than 20% of untreated control (Fig. 4A and B). Down-regulation of the Hsp27 by treatment with antisense ODN increased the irinotecan-induced apoptosis by about 10-fold compared to Colo320 cells (Fig. 4C). As shown in Fig. 4C, the irinotecan-induced apoptosis of scrambled ODN-treated Colo320 cells slightly increased compared to that of Colo320 cells, which may be explained by the non-specific effects of ODN. These results indicate that the expression of Hsp27 is directly associated with the irinotecan resistance of human colorectal cancer cell lines.

activities among KM12C/Hsp27 cells and antisense ODN-treated Colo320 cells after irinotecan treatment. While caspase-3 activity of KM12C/Hsp27 cells was reduced to 61% of KM12C cells, that of antisense ODN-treated Colo320 cells was increased by 1.6-fold compared to that of untreated Colo320 cells (Fig. 5A). Overall, these results showed that Hsp27 expression decreased caspase-3 activity, which coincided with a decreased irinotecan-induced apoptosis.

3.5. Hsp27 expression reduced the caspase-3 activity There was a significant difference in caspase-3 activity between irinotecan-sensitive KM12C and irinotecan-resistant Colo320 cells. While caspase-3 activity was hardly detected in irinotecan-treated Colo320 cells, irinotecan treatment induced a 2.4-fold increase in caspase-3 activity in KM12C cells (Fig. 5A). Treatment of caspase-3 inhibitor, Ac-DEVD-CHO, suppressed the irinotecan-induced apoptosis of irinotecan-sensitive KM12C cells (Fig. 4B), which suggests that the caspase-3 activity is required for the irinotecan-induced apoptosis of KM12C cells. To determine whether or not Hsp27 expression is associated with caspase-3 activity, we analyzed the caspase-3

3.6. Hsp27 expression is up-regulated in irinotecan-resistant primary tumors To determine whether or not the relationship between Hsp27 expression and irinotecan resistance detected in cell lines are clinically relevant, we examined Hsp27 expression level in the surgically resected primary colorectal tumors from 20 patients using immunohistochemistry (Fig. 6). Among the 20 samples used in this study, 6 were from patients classified as clinical responders and 16 from non-responders to irinotecan treatment and we compared the Hsp27 expression level among responders and non-responders. Although both responders and non-responders expressed Hsp27, we found statistically significant differences in Hsp27 expression level between responders and non-responders. The Hsp27 expression level in non-responders (mean staining score, 6.28; proportion of

1654

3 No treatment

2.5

Irinotecan

suggest that there is a correlation between the expression of Hsp27 and the clinical response of colorectal cancer patients to the irinotecan treatment.

2 1.5

4. Discussion

1 0.5

% apoptotic cells

B

Colo320/Scramble

Colo320/Antisense

Colo320

KM12C/pcDNA

KM12C/Hsp27

0 KM12C

Caspase-3 activity (fold)

A


60 40 20 0 -

+

+

+

-

-

3 μM

10 μM

Irinotecan Ac-DEVD-CHO

Fig. 5. Effects of Hsp27 expression on caspase-3 activity induced by irinotecan treatment. (A) Suppression of caspase-3 activity by Hsp27 expression. Cell lysates were prepared at 24 h after from parental Colo320 and KM12C cells, antisense ODN-treated or scrambled ODN-treated Colo320 cells and KM12C derivatives stably transfected with pcDNA3.1-Hsp27, KM12C/Hsp27, or empty vector pcDNA3.1, KM12C/pcDNA. (B) Requirement of caspase-3 activity in irinotecaninduced apoptosis of colorectal cancer cells. Irinotecan-sensitive KM12C cells were treated with 50 lM irinotecan in the absence or presence of Ac-DEVD-CHO (3 lM and 10 lM). Ac-DEVD-CHO was added 1 h prior to irinotecan treatment. Irinotecan-induced apoptosis was determined by TUNEL staining at 24 h after irinotecan treatment. Caspase-3 activity was measured in cell lysates at 24 h after irinotecan treatment as described under Section 2. The caspase-3 activity of parental Colo320 cells was defined as 1.

high staining score, 64.2%) was significantly greater (P for ttest = 0.045) compared with responders (mean staining score, 3.16; proportion of high staining score, 33.3%). These results

In this study, we have demonstrated a strong positive correlation between cellular Hsp27 level and irinotecan resistance in human colorectal cancer cells. This suggests that Hsp27 expression is one of major determinants of irinotecan resistance in human colorectal cancer cells. This conclusion was established by our results showing that the expression level of Hsp27 was higher in irinotecan-resistant colorectal cancer cells than in irinotecan-sensitive colorectal cancer cells. In addition, an overexpression of Hsp27 reverted irinotecansensitive cells to irinotecan-resistant cells and, vice versa, a suppression of Hsp27 using antisense ODNs reverted irinotecan-resistant cells to irinotecan-sensitive cells. There was a clinical correlation between the expression level of Hsp27 and the irinotecan resistance of colorectal cancer patients. This suggests that an expression of Hsp27 leads to irinotecan resistance in human colorectal cancer cells. In recent years, evidence has accumulated to show that Hsp27 can inhibit apoptosis [17,23,24]. Since apoptosis induction is an important mechanism in the irinotecan-induced killing of tumors [2,3,25], the inhibition of apoptosis by increased level of Hsp27 may render tumors more resistant to irinotecan. Our study provides evidence that shows a direct correlation between Hsp27 expression and irinotecan resistance. These findings are consistent with various other studies that link Hsp27 and chemoresistance in different cell types. For example, higher than normal level of Hsp27 expression is commonly detected in breast [26,27], prostate [28], gastric [29], ovarian [30], and oral squamous carcinoma cancers [31], as well as in Hodgkin’s Disease [32]. In addition, several reports have demonstrated the role of Hsp27 in cisplatin-resistant human ovarian cancer cells [20,33], doxorubicin-resistant colorectal cancer cells [9] and Dex-resistant multiple myeloma cells [34]. Together, all these suggest a role of Hsp27 in mediating irinotecan resistance in colorectal cancer cells. Hsp27 level is generally low within unstressed cells and increases during the stress response [35]. However, the mechanisms that regulate Hsp27 mRNA and protein levels have

Fig. 6. Immunohistochemical expression of Hsp27 in surgically resected tumors from colorectal cancer patients. Colorectal tumor tissues from responder (A) showed weaker immunohistochemical reactivity to Hsp27 (staining score 1), compared to colorectal tumor tissues from non-responder (B) (staining score 12).


yet to be identified. Our study showed that, under normal conditions, expression level of Hsp27 was low both in irinotecan-resistant and irinotecan-sensitive cells. However, after irinotecan treatment, an upregulation of Hsp27 occurred only in irinotecan-resistant cells. Thus, a difference in the irinotecan-induced induction of Hsp27 seemed to be one factor for the irinotecan resistance of colorectal cancer cells, suggesting that blocking the irinotecan-induced induction of Hsp27 may enhance the therapeutic efficiency of irinotecan. The clinical relevance of our cell line studies was derived from an examination of Hsp27 expression in resected specimens before irinotecan treatment. High expression level of Hsp27 in resected specimens before irinotecan treatment correlated with the clinical response of the cancer patients. However, there were several cases in which, in spite of low levels of Hsp27 expression, the clinical response of colorectal cancer patients against irinotecan treatment was negative. Based on our cell line studies, it is possible that Hsp27 expression was upregulated after irinotecan treatment in the tumor tissues of these colorectal cancer patients. It is also possible that drugresistant genes other than Hsp27 [5] played a critical role in the induction of irinotecan resistance. We need to confirm which one is true. How does Hsp27 mediate irinotecan resistance in colorectal cancer cells? Our study provides evidence that caspase-3 activity is necessary for the irinotecan-induced apoptosis of colorectal cancer cells: (a) irinotecan treatment increased caspase-3 activity in irinotecan-sensitive colorectal cancer cells and (b) treatment of caspase-3 inhibitor suppressed the irinotecan-induced apoptosis. These results are consistent with other studies reporting the activation of caspase-3 after a treatment of topoisomerase I inhibitor in leukemia cells [36] and hepatoma cells [37]. Our study also showed that there was an inverse correlation between the expression levels of Hsp27 and caspase-3 activity. This suggests the possibility that Hsp27 decreases caspase-3 activity, which then leads to the irinotecan resistance of human colorectal cancer cells. Recently, evidences have accumulated to show that Hsp27 can inhibit apoptosis through a direct inhibition of caspase activation [17,21]. It has been shown that Hsp27 can inhibit caspase-3 activity by interacting with the pro-caspase-3 molecule [38,39]. In addition, multiple studies have shown that Hsp27 can inhibit caspase activity by preventing a release of cytochrome c [40,41] and Smac [34] from mitochondria. Recent evidence has also demonstrated that a significant pool of Hsp27 is located in the mitochondria and that it may protect against apoptotic stimuli in a manner similar to Bcl-2 by blocking the release of cytochrome c [23]. In our study, we did not determine the details about the mechanisms by which Hsp27 modulates caspase-3 activity in irinotecan-treated colorectal cancer cells. Nevertheless, our data demonstrate that Hsp27 modulates caspase-3 activity in colorectal cancer cells and enables colorectal cancer cells to evade the cytotoxic effects of irinotecan. In this study, we have shown for the first time that increased level of Hsp27 rendered colorectal cancer cells more resistant to irinotecan and that high expression level of Hsp27 in a resected specimen before irinotecan treatment correlated with the clinical response of the cancer patients. Our results provide important information to understand the molecular mechanisms that lead to irinotecan resistance and suggests a potential therapeutic approach for irinotecan-resistant colorectal cancer.

1655 Acknowledgements: This study was supported by grants from the Ulsan University Hospital and the University of Ulsan. Won Hyuk Lee was partly supported by the BK21 Program of the Korea Research Foundation.

References [1] Wasserman, E., Sutherland, W. and Cvitkovic, E. (2001) Irinotecan plus oxaliplatin: a promising combination for advanced colorectal cancer. Clin. Colorectal Cancer 1, 149–153. [2] Chen, A.Y. and Liu, L.F. (1994) DNA topoisomerases: essential enzymes and lethal targets. Annu. Rev. Pharmacol. Toxicol. 36, 191–218. [3] Pommier, Y. (1996) Eukaryotic DNA topoisomerase I: genome gatekeeper and its intruders, camptothecins. Semin. Oncol. 23, 3– 10. [4] Calvo, E., Cortes, J., Rodriguez, J., Fernandez-Hidalgo, O., Rebollo, J., Martin-Algarra, S., Garcia-Foncillas, J., MartinezMonge, R., de Irala, J. and Brugarolas, A. (2002) Irinotecan, oxaliplatin, and 5-fluorouracil/leucovorin combination chemotherapy in advanced colorectal carcinoma: a Phase II study. Clin. Colorectal Cancer 2, 104–110. [5] Rasheed, Z.A. and Rubin, E.H. (2003) Mechanisms of resistance to topoisomerase I-targeting drugs. Oncogene 22, 7296–7304. [6] Soti, C.S. and Csermely, P. (1998) Molecular chaperones in the etiology and therapy of cancer. Pathol. Oncol. Res. 4, 316–321. [7] Jolly, C. and Morimoto, R.I. (2000) Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J. Natl. Cancer Res. Inst. 92, 1564–1572. [8] Garrido, C., Fromentin, A., Bonnotte, B., Favre, N., Moutet, M., Arrigo, A.P., Mehlen, P. and Solary, E. (1998) Heat shock protein 27 enhances the tumorigenicity of immunogenic rat colon carcinoma cells. Cancer Res. 58, 5495–5499. [9] Garrido, C., Ottavi, P., Fromentin, A., Hammann, A., Arrigo, A.P., Chauffert, B. and Mehlen, P. (1997) HSP27 as a mediator of confluence-dependent resistance to cell death induced by anticancer drugs. Cancer Res. 57, 2661–2667. [10] Nylandsted, J., Rohde, M., Brand, K., Bastholm, L., Elling, F. and Jaattela, M. (2000) Selective depletion of heat shock protein 70 (Hsp70) activates a tumor-specific death program that is independent of caspases and bypasses Bcl-2. Proc. Natl. Acad. Sci. USA 97, 7871–7876. [11] Akalin, A., Elmore, L.W., Forsythe, H.L., Amaker, B.A., McCollum, E.D., Nelson, P.S., Ware, J.L. and Holt, S.E. (2001) A novel mechanism for chaperone-mediated telomerase during prostate cancer progression. Cancer Res. 61, 4791–4796. [12] Bruey, J.M., Ducasse, C., Bonniaud, P., Ravagnan, L., Susin, S.A., Diaz-Latoud, C., Gurbuxani, S., Arrigo, A.P., Kroemer, G., Solary, E. and Garrido, C. (2000) Hsp27 negatively regulates cell death by interacting with cytochrome c. Nat. Cell Biol. 2, 645– 652. [13] Beere, H.M., Wolf, B.B., Cain, K., Mosser, D.D., Mahboubi, A., Kuwana, T., Tailor, P., Morimoto, R.I., Cohen, G.M. and Green, D.R. (2000) Heat-shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome. Nat. Cell Biol. 2, 469–475. [14] Saleh, A., Srinivasula, S.M., Balkir, L., Robbins, P.D. and Alnemri, E.S. (2000) Negative regulation of the Apaf-1 apoptosome by Hsp70. Nat. Cell Biol. 2, 476–483. [15] Pandey, P., Saleh, A., Nakazawa, A., Kumar, S., Srinivasula, S.M., Kumar, V., Weichselbaum, R., Nalin, C., Alnemri, E.S., Kufe, D. and Kharbanda, S. (2000) Negative regulation of cytochrome c-mediated oligomerization of Apaf-1 and activation of procaspase-9 by heat shock protein 90. EMBO J. 19, 4310– 4322. [16] Garrido, C., Gurbuxani, S., Ravagnan, L. and Kroemer, G. (2001) Heat shock proteins: endogenous modulators of apoptotic cell death. Biochem. Biophys. Res. Commun. 286, 433–442. [17] Garrido, C., Bruey, J.M., Fromentin, A., Hammann, A., Arrigo, A.P. and Solary, E. (1999) HSP27 inhibits cytochrome c-dependent activation of procaspase-9. FASEB J. 13, 2061–2070. [18] Huot, J., Roy, G., Lambert, H., Chretien, P. and Landry, J. (1991) Increased survival after treatments with anticancer agents

1656

[19]

[20]

[21] [22]

[23]

[24] [25] [26] [27]

[28]

[29] [30]

D.H. Choi et al. / FEBS Letters 581 (2007) 1649–1656 of Chinese hamster cells expressing the human Mr 27,000 heat shock protein. Cancer Res. 51, 5245–5252. Oesterreich, S., Hilsenbeck, S.G., Ciocca, D.R., Allred, D.C., Clark, G.M., Chamness, G.C., Osborne, C.K. and Fuqua, S.A. (1996) The small heat shock protein 27 is not an independent prognostic marker in axillary lymph node-negative breast cancer patients. Clin. Cancer Res. 2, 1199–1206. Yamamoto, K., Okamoto, A., Isonishi, S., Ochiai, K. and Ohtake, Y. (2001) Heat shock protein 27 was up-regulated in cisplatin resistant human ovarian tumor cell line and associated with the cisplatin resistance. Cancer Lett. 168, 173–181. Oesterreich, S., Hickey, E., Weber, L.A. and Fugua, S.A. (1996) Basal regulatory elements of the hsp27 gene in human breast cancer cells. Biochem. Biophys. Res. Commun. 222, 155–163. Lee, B.J., Cho, G.J., Norgren Jr., R.B., Junier, M.P., Hill, D.F., Tapia, V., Costa, M.E. and Ojeda, S.R. (2001) TTF-1, a homeodomain gene required for diencephalic morphogenesis, is postnatally expressed in the neuroendocrine brain in a developmentally regulated and cell-specific fashion. Mol. Cell. Neurosci. 17, 107–126. Samali, A., Robertson, J.D., Peterson, E., Manero, F., van Zeijl, L., Paul, C., Cotgreave, I.A., Arrigo, A.P. and Orrenius, S. (2001) Hsp27 protects mitochondria of thermotolerant cells against apoptotic stimuli. Cell Stress Chaperon 6, 49–58. Concannon, C.G., Gorman, A.M. and Samali, A. (2003) On the role of Hsp27 in regulating apoptosis. Apoptosis 8, 61–70. Schmitt, E., Sane, A.T. and Bertrand, R. (1999) Activation and role of caspases in chemotherapy-induced apoptosis. Drug Resist. Update 2, 21–29. Love, S. and King, R.J. (1994) A 27 kDa heat shock protein that has anomalous prognostic powers in early and advanced breast cancer. Br. J. Cancer 69, 743–748. Oesterreich, S., Weng, C.N., Qiu, M., Hilsenbeck, S.G., Osborne, C.K. and Fuqua, S.A. (1993) The small heat shock protein hsp27 is correlated with growth and drug resistance in human breast cancer cell lines. Cancer Res. 53, 4443–4448. Cornford, P.A., Dodson, A.R., Parsons, K.F., Desmond, A.D., Woolfenden, A., Fordham, M., Neoptolemos, J.P., Ke, Y. and Foster, C.S. (2000) Heat shock protein expression independently predicts clinical outcome in prostate cancer. Cancer Res. 60, 7099–7105. Ehrenfried, J.A., Herron, B.E., Townsend Jr., C.M. and Evers, B.M. (1995) Heat shock proteins are differentially expressed in human gastrointestinal cancers. Surg. Oncol. 4, 197–203. Langdon, S.P., Rabiasz, G.J., Hirst, G.L., King, R.J., Hawkins, R.A., Smyth, J.F. and Miller, W.R. (1995) Expression of the heat shock protein HSP27 in human ovarian cancer. Clin. Cancer Res. 1, 1603–1609.

[31] Mese, H., Sasaki, A., Nakayama, S., Yoshioka, N., Yoshihama, Y., Kishimoto, K. and Matsumura, T. (2002) Prognostic significance of heat shock protein 27 (HSP27) in patients with oral squamous cell carcinoma. Oncol. Rep. 9, 341–344. [32] Hsu, P.L. and Hsu, S.M. (1998) Abundance of heat shock proteins (hsp89, hsp60, and hsp27) in malignant cells of Hodgkin’s disease. Cancer Res. 58, 5507–5513. [33] Richards, E.H., Hickey, E., Weber, L. and Master, J.R. (1996) Effect of overexpression of the small heat shock protein HSP27 on the heat and drug sensitivities of human testis tumor cells. Cancer Res. 56, 2446–2451. [34] Chauhan, D., Li, G., Hideshima, T., Podar, K., Mitsiades, C., Mitsiades, N., Catley, L., Tai, Y.T., Hayashi, T., Shringarpure, R., Burger, R., Munshi, N., Ohtake, Y., Saxena, S. and Anderson, K.C. (2003) Hsp27 inhibits release of mitochondrial protein Smac in multiple myeloma cells and confers dexamethasone resistance. Blood 102, 3379–3386. [35] Landry, J., Chretien, P., Laszlo, A. and Lambert, H. (1991) Phosphorylation of HSP27 during development and decay of thermotolerance in Chinese hamster cells. J. Cell Physiol. 147, 93– 101. [36] Samejima, K., Svingen, P.A., Basi, G.S., Kottke, T., Mesner Jr., P.W., Stewart, L., Durrieu, F., Poirier, G.G., Alnemri, E.S., Champoux, J.J., Kaufmann, S.H. and Earnshaw, W.C. (1999) Caspase-mediated cleavage of DNA topoisomerase I at unconventional sites during apoptosis. J. Biol. Chem. 274, 4335– 4340. [37] Zhang, X.W. and Xu, B. (2000) Differential regulation of P53, cMyc, Bcl-2, Bax and AFP protein expression, and caspase activity during 10-hydroxycamptothecin-induced apoptosis in Hep G2 cells. Anti-cancer Drug 11, 747–756. [38] Concannon, C.G., Orrenius, S. and Samali, A. (2001) Hsp27 inhibits cytochrome c-mediated caspase activation by sequestering both pro-caspase-3 and cytochrome c. Gene Expression 9, 195– 201. [39] Pandey, P., Farber, R., Nakazawa, A., Kumar, S., Bharti, A., Nalin, C., Weichselbaum, R., Kufe, D. and Kharbanda, S. (2000) Hsp27 functions as a negative regulator of cytochrome cdependent activation of procaspase-3. Oncogene 19, 1975–1981. [40] Paul, C., Manero, F., Gonin, S., Kretz-Remy, C., Virot, S. and Arrigo, A.P. (2002) Hsp27 as a negative regulator of cytochrome C release. Mol. Cell. Biol. 22, 816–834. [41] Mehlen, P., Kretz-Remy, C., Briolay, J., Fostan, P., Mirault, M.E. and Arrigo, A.P. (1995) Intracellular reactive oxygen species as apparent modulators of heat-shock protein 27 (hsp27) structural organization and phosphorylation in basal and tumour necrosis factor alpha-treated T47D human carcinoma cells. Biochem. J. 312, 367–375.