Helicobacter pylori cagA GENE DIVERSITY: EFFECT ON THE. GASTRIC EPITHELIAL CELLS ACTIVITIES by. Ahmet GÃNER. A thesis submitted to.
11
Ahmet GÜNER Helicobacter pylori cagA GENE DIVERSITY: EFFECT ON THE GASTRIC EPITHELIAL CELLS ACTIVITIES
M.S. Thesis In Biology
by
Ahmet GÜNER
June - 2011 June 2011 Istanbul, Turkey
1iii
Helicobacter pylori cagA GENE DIVERSITY: EFFECT ON THE GASTRIC EPITHELIAL CELLS ACTIVITIES
by Ahmet GÜNER
A thesis submitted to the Graduate Institute of Sciences and Engineering
of
Fatih University
in partial fulfillment of the requirements for the degree of Master of Science
in
Biology
June 2011 Istanbul, Turkey
iv iii
APPROVAL PAGE
I certify that this thesis satisfies all the requirements as a thesis for the degree of Master of Science. Assist. Prof. Dr. Sevim IŞIK Head of Department
This is to certify that I have read this thesis and that in my opinion it is fully adequate, in scope and quality, as a thesis for the degree of Master of Science.
Assoc. Prof. Barık SALİH Supervisor
Examining Committee Members: Assoc. Prof. Barık SALİH
…...……..…………..
Assist. Prof. Dr. Sevim IŞIK
…...……..…………..
Assist. Prof. Dr. Fahri AKBAŞ
…...……..…………..
It is approved that this thesis has been written in compliance with the formatting rules laid down by the Graduate Institute of Sciences and Engineering.
Assoc. Prof. Nurullah ARSLAN Director
1 iv
Helicobacter pylori cagA GENE DIVERSITY: EFFECT ON THE GASTRIC EPITHELIAL CELLS ACTIVITIES Ahmet GÜNER M.S. Thesis – Biology June 2011 Supervisor: Assoc. Prof. Barık SALİH
ABSTRACT
Helicobacter pylori infection causes gastritis that might progress to peptic ulceration and even gastric cancer. The cag pathogenicity island (cagPAI) was shown to play an important role in pathogenesis, however little is known about the functions of the cagPAI genes in Turkish patients with peptic ulcerations. Also the role of the cytotoxin-associated gene (cagA) in the induction of IL-8 and morphological changes of the AGS cells in vitro is still not very well defined. In this study, we aimed to investigate the effect of H. pylori infection on the function and morphological changes of the AGS gastric epithelial cell line in vitro, to determine the role of the cagPAI virulent genes (cagT, cagM, cagE, cagA) and the cagA EPIYA motifs on the induction of IL-8 secretion and the formation of the hummingbird phenotype. Fifty-three patients attended the endoscopy unit at the Istanbul Teaching Hospital were enrolled in this study. Gastric biopsies from the antrum for rapid urease test (RUT), culture and PCR were collected to detect the presence or absence of H. pylori. Of the 53 patients 38 (Gastritis=16, Duodenal ulcers=13, Gastric ulcer=9) (16 females) were found infected with H. pylori. The presence of H. pylori was further confirmed by PCR using primers to detect the urease-C gene. Amplification of the cagT, cagM, cagE genes and the cagA 3‟ variable region and the EPIYA motif encoding sequences A, B, C and D was also done. The AGS cell line was used for coculture study, detection of IL-8 secretion and morphological changes. The concentration of IL-8 in each sample was measured by using the OptEIA human IL-8 ELISA kit.
v2
Among all the isolates studied we found that 42.1% had intact, 39.5% with partial deletions and 18.4% had absence of the cagPAI. The possession of the cagA gene was found in 76% of the strains examined. Of these 58.7% had the EPIYA motifs ABC, 34.5% ABCC and 3.4% with ABCCC and ABCCCCC respectively. The detection of deletions in the cagPAI showed that isolates from gastritis patients had higher deletion frequencies of the cagT and cagM genes than the other 2 genes, while isolates from DU patients had higher deletion frequencies of the cagM gene over the other genes. Deletion frequencies of the cagT, cagM and cagE genes were higher in isolates from GU patients as compared to gastritis and DU patients. Coculture of the AGS cells with H. pylori resulted in morphological changes that started with elongations at 3h after infection and formed the hummingbird phenotype at 48h. Isolates with the EPIYA-ABCCC caused complete morphological changes of the infected AGS cells at 48h when compared to those of the EPIYA-ABCC and the EPIYA-ABC types. The cagA positive strains had significant association with IL-8 secretion when compared to cagA negative strains. The concentrations of IL-8 were significantly higher when the AGS cells infected with isolates from gastritis patients, DU and GU patients with EPIYA-ABCC than those of the EPIYA-ABC. In addition, isolates from DU patients with EPIYA-ABCCC and EPIYA-ABCCCCC had significantly higher association with increased concentrations of the IL-8 than those with EPIYA-ABC. Also isolates from gastritis patients, DU and GU patients with intact cagPAI genes induced higher IL-8 secretion than those with partial deletions. In conclusion, we found that the intactness of the cagPAI in isolates from gastritis patients, DU and GU patients is not conserved. The possession of the cagA gene appeared to play an important role in the induction of IL-8 and the morphological changes of the AGS cells. An increase in the number of the EPIYA-C motifs had noticeable effect on the formation of the hummingbird phenotype. The possession of the cagPAI genes was also found to play an important role in the pathogenesis of DU but not GU or gastritis. Higher deletion frequencies of the cagT and cagM did not seem to affect the induction of morphological changes of the AGS cells.
Key words: Helicobacter pylori, cagPAI, cagA, AGS, IL-8, EPIYA motifs
vi3
Helicobacter pylori cagA GEN ÇEŞİTLİLİĞİNİN MİDE EPİTEL HÜCRELERİNE ETKİSİ Ahmet GÜNER Yüksek Lisans Tezi – Biyoloji Haziran 2011 Tez Danışmanı: Doç. Dr. Barık SALİH ÖZ
Helicobacter pylori enfeksiyonu gastrite neden olup bu durum peptik ülsere ve hatta mide kanserine yol açabilmektedir. cag patojenik adasının (cagPAI) patojenezde önemli bir rol oynadığı gösterilmiş fakat mide ülserli Türk hastalardan izole edilen suşlardaki cagPAI genlerinin fonksiyonları hakkında yeterli bilgi bulunmamaktadır. Aynı zamanda sitotoksin ilişkili gen A‟nın (cagA) IL-8 salgılanması ve in vitro ortamda bulunan mide adenokarsinoma hücrelerindeki (AGS) morfolojik değişikliklerle alakalı rolü hala netlik kazanmış değildir. Bizim bu çalışmada in vitro koşullarda H. pylori ile AGS epitel hücrelerini enfekte ederek hücreler üzerinde ne gibi değişiklilerin olduğunu, H. pylori‟de bulunan cag patojenik adasındaki virulent genlerin (cagT, cagM, cagE, cagA) ve cagA EPIYA motiflerinin IL-8 salınımında ne gibi bir etkisinin olduğunu ve AGS hücrelerinde sinekkuşu fenotipinin oluşumunu gözlemlemeyi amaçlamaktayız. Bu çalışmada İstanbul Eğitim ve Araştırma Hastanesi‟nin endoskopi ünitesinde tedavi gören 53 tane hastanın mide antrum bölgesinden biyopsiler alınarak H. pylori’nin var olup olmadığına hızlı üre testi, kültüre ekim ve PZR yöntemleri ile bakıldı. 53 hastadan 38 tanesinin (16 Gastrit, 13 Duodenal ülser ve 9 Mide ülseri) H. pylori ile enfekte olduğu saptandı. H. pylori‟nin varlığı daha sonra PZR yöntemi ile bu bakteride bulunan üreaz-C geninin tespiti sonucu doğrulandı. cagT, cagM, cagE genlerinin ve cagA 3‟ değişken bölgesinin EPIYA A, B, C ve D dizilerinin yine bu yöntemle amplifikasyonu yapıldı. AGS hücreleri H. pylori ile birlikte kültür edilerek, IL-8 salınımı belirlendi ve morfolojik değişimler gözlendi. Tüm örnekler için IL-8 konsantrasyonu OptEIA human IL-8 ELISA kit kullanılarak ölçüldü.
4 vii
Tüm bu izolatlardan %42,1‟i tam (intact), %39,5‟i kısmi eksik (partial deletions) ve %18,4‟ü tamamen eksik (complete deletions) cagPAI olarak saptandı. Tüm suşların %76‟sında cagA geninin varlığı tespit edildi. Bunlarında sırasıyla %58,7‟sinin EPIYAABC, %34,5‟nin ABCC ve %3,4‟ünün ABCCC ve ABCCCCC olduğu bulundu. Gastrit hastalarında cagPAI‟ daki eksik genlerin tespitinde cagT ve cagM genlerinin eksikliğinin diğer iki gene oranla daha fazla olduğu belirlendi ve öte yandan duodenal ülser hastalarında cagM geninin eksikliğinin diğer tüm genlere nispeten daha fazla olduğu tespit edildi. Mide ülseri hastalarındaki cagT, cagM ve cagE genlerinin eksikliğinin gastrit ve duodenal ülser hastalarına nazaran daha yüksek olduğu tespit edilmiştir. H. pylori‟nin AGS ile enfeksiyonu sonucu 3. saatte morfolojik değişimlerin başladığı ve 48. saatin sonunda sinekkuşu fenotipinin oluştuğu gözlemlendi. EPIYAABCCC motiflerine sahip izolatların EPIYA-ABC ve EPIYA-ABCC‟ye kıyasla enfekte edilmiş AGS hücrelerinin morfolojik olarak tamamen değişimlerine neden olduğu tespit edildi. cagA-pozitif suşların cagA-negatif suşlara kıyasla önemli derecede IL-8 salınımıyla ilişkisi olduğu saptandı. EPIYA-ABCC motiflerine sahip gastrit, duodenal ülser ve mide ülseri hasta suşlarının AGS hücreleri ile enfeksiyonu sonucunda ortamdaki IL-8 konsantrasyonunun EPIYA-ABC motiflerine sahip suşlara oranla çok daha önemli derecede fazla olduğu tespit edildi. Buna ek olarak duodenal ülser hastalarından EPIYA-ABCCC ve EPIYA-ABCCCCC motiflerine sahip olanların EPIYA-ABC motiflerine sahip olanlara nazaran çok daha önemli derecede ortamdaki IL-8 konsantrasyonunu arttırdığı saptandı. Aynı zamanda tam cagPAI (intact) genlerine sahip olanların kısmi eksik (partial deletion) olanlara nispeten IL-8 salgılanmasını daha fazla tetiklediği belirlendi. Sonuç olarak, gastrit, duodenal ülser ve mide ülseri hastalarından izole edilen tam cagPAI‟ya sahip suşların korunmadığı bulundu. cagA geninin varlığı AGS hücrelerinin IL-8 salgılanmasını tetiklemede ve hücrelerin morfolojik değişiminde önemli bir rol oynadığı gösterildi. EPIYA-C motiflerinin sayısının artmasının belirgin bir şekilde sinekkuşu fenotipi oluşumunu etkilediği görüldü. Mide ülseri veya gastrit hastalarına nazaran duodenal ülser hastalarında cagPAI genlerinin varlığının patojenik açıdan ciddi bir rol oynadığı saptandı. Çoğunlukla cagT ve cagM genlerinin eksikliğinin AGS hücrelerinde morfolojik değişikliği tetiklemediği gözlendi.
Anahtar Kelimeler: Helicobacter pylori, cagPAI, cagA, AGS, IL-8, EPIYA
5 viii
DEDICATION To my parents and my family
6 ix
ACKNOWLEDGEMENT
I am heartily thankful to my major professor, Dr. Barık SALİH, whose encouragement, guidance and support from the initial to the final stages enabled me to develop skills and to understand and conduct this thesis. Moreover, I would like to thank him for guiding me how to struggle with the research problems and teaching me how to do scientific research and most of all for his valuable thoughts and recommendations.
I would also like to thank The Graduate Institute of Sciences and Engineering of Fatih University for funding my thesis.
I am thankful to all my colleagues and friends who helped me during the experiments and always supported and motivated me without getting bored.
Lastly, I would like to express my thanks and appreciation to my wife for her understanding, motivation and patience.
x7
TABLE OF CONTENTS ABSTRACT ............................................................................................................. iii ÖZ ............................................................................................................................... v DEDICATION ......................................................................................................... vii ACKNOWLEDGEMENT .................................................................................... viii TABLE OF CONTENTS ...................................................................................... ix LIST OF TABLES .................................................................................................. xii LIST OF FIGURES ................................................................................................ xiii LIST OF SYMBOLS AND ABBREVIATIONS ........................................... xv CHAPTER I 1.1
INTRODUCTION ................................................................. 1
Helicobacter pylori ............................................................................. 1
CHAPTER II
REVIEW OF LITERATURE ............................................. 4
2.1
Pathogenesis ......................................................................................... 4
2.2
Helicobacter pylori virulence factors ................................................... 5
2.3
cag Pathogenicity Island (cag PAI) ..................................................... 7
2.4
Type IV Secretion System (T4SS) ....................................................... 9
2.5
Cytotoxin associated gene (cagA) ....................................................... 14
2.6
cagA 3‟ end EPIYA motifs .................................................................. 16
2.7
Interleukin-8 induction ......................................................................... 20
2.8
Hummingbird phenotype ..................................................................... 23
2.9
Tissue culture cell line ......................................................................... 24
CHAPTER III
MATERIALS AND METHODS ....................................... 25
3.1
Patients ................................................................................................. 25
3.2
Rapid urease test (RUT) ....................................................................... 25
3.3
Isolation and culture of H. pylori strains .............................................. 27
3.4
Gram staining ....................................................................................... 27
3.5
Catalase test .......................................................................................... 27
8 xi
3.6
Oxidase test .......................................................................................... 28
3.7
Extraction of genomic DNA ................................................................ 28
3.8
PCR ..................................................................................................... 29
3.9
Agarose gel electrophoresis ................................................................. 31
3.10
3.9.1
Preparation of the gel .......................................................... 31
3.9.2
Loading................................................................................ 31
AGS cell culture ................................................................................... 31 3.10.1
AGS cell culture protocol.................................................... 32
3.10.2
Viable cell counting procedure ........................................... 33
3.10.3
Calculation of cells .............................................................. 34
3.11
Co-culture with H. pylori ..................................................................... 35
3.12
ELISA TEST ........................................................................................ 35 3.12.1 Human IL-8/NAP-1 Immunoassay Kit Content ....................... 35 3.12.1 ELISA Protocol ......................................................................... 36
3.13
Statistical analysis ............................................................................... 37
CHAPTER IV
RESULTS ................................................................................ 38
4.1
Isolation and culture of H. pylori ......................................................... 38
4.2
PCR analysis ........................................................................................ 40 4.2.1
cag PAI detection ................................................................ 40
4.2.2
cagA detection ..................................................................... 42
4.2.3
CagA-EPIYA motifs ........................................................... 42
4.3
AGS cell culture ................................................................................... 46
4.4
Co-culture ............................................................................................. 48
4.5
Determination of IL-8 secretion ........................................................... 50
CHAPTER V REFERENCES
DISCUSSION and CONCLUSION .................................. 59 ............................................................................................. 64
9 xii
LIST OF TABLES
Table 3.1
Specific primers used to identify H. pylori, cag PAI genes and EPIYA motifs in this study ................................................................................. 30
Table 4.1
The presence or absence of the cagPAI in H. pylori strains from patients with various diseases ................................................................. 41
Table 4.2
The EPIYA motif types detected in strains isolated from 38 patients.... 43
Table 4.3
The distribution of cagPAI and EPIYA motifs among strains isolated from gastritis patients ............................................................................. 44
Table 4.4
The distribution of cagPAI and EPIYA motifs among strains isolated from duodenal ulcer patients .................................................................. 45
Table 4.5
The distribution of cagPAI and EPIYA motifs among strains isolated from gastric ulcer patients ...................................................................... 46
Table 4.6
The IL-8 concentration determined at 6h and 24h following coculture of the AGS cells with H. pylori from gastritis patients .......................... 52
Table 4.7
The IL-8 concentration determined at 6h and 24h following coculture of the AGS cells with H. pylori from gastric ulcer patients ................... 53
Table 4.8
The IL-8 concentration determined at 6h and 24h following coculture of the AGS cells with H. pylori from duodenal ulcer patients ............... 54
10 xiii
LIST OF FIGURES
Figure 2.1 Schematic representation of the factors contributing to gastric pathology and disease outcome in H. pylori infection. .......................... 5 Figure 2.2
Schematic representation of the cag region. ........................................... 8
Figure 2.3
CagA is phosphorylated by SRC. ........................................................... 11
Figure 2.4 Model for the assembled T4SS machinery and its role in H. pylori induced cell signaling. ............................................................................ 12 Figure 2.5 Structural polymorphism in the C-terminal, EPIYA-repeat region of CagA. ...................................................................................................... 18 Figure 2.6 The role of IL-8 signaling in the tumor microenvironment.................... 21 Figure 4.1 The typical appearance of H. pylori colonies on a Colombia blood agar plate................................................................................................. 38 Figure 4.2 Gram staining of H. pylori (1000x). ....................................................... 39 Figure 4.3 Catalase test. Presence of effervescence indicates presence of H. pylori. ...................................................................................................... 39 Figure 4.4 Oxidase test. Purple coloration indicates presence of H. pylori. ............ 39 Figure 4.5 Rapid Urease Test for H. pylori.............................................................. 40 Figure 4.6 Gel electrophoresis of PCR products of the cagPAI genes. ................... 41 Figure 4.7 cagA 3‟ variable region in a representative group of dyspeptic patients. 42 Figure 4.8 Detection of cagA 3‟ end ABC type EPIYA motifs. .............................. 42 Figure 4.9 The photos of AGS cells. ........................................................................ 47 Figure 4.10 The AGS cells cocultured with H. pylori. .............................................. 48 Figure 4.11 Morphological changes of the AGS cells infected with H. pylori strains possessing EPIYA-ABC motifs. ................................................. 49 Figure 4.12 A photograph of a real hummingbird as compared to the AGS cell morphological changes and elongation hummingbird phenotype. ......... 50 Figure 4.13 IL-8 Standard curve. ............................................................................... 51
11 xiv
Figure 4.14 Comparison between the concentration levels of IL-8 at MOI 1:100 and 1:300 and the H. pylori strains were used for culture isolated from patients with gastritis, gastric ulcer and duodenal ulcer. ........................ 55 Figure 4.15 IL-8 concentrations produced by AGS cells infected with H. pylori strains isolated from gastritis patients. ................................................... 56 Figure 4.16 IL-8 concentrations produced by AGS cells infected with H. pylori strains isolated from gastric ulcer patients. ............................................ 57 Figure 4.17 IL-8 concentrations produced by AGS cells infected with H. pylori strains isolated from duodenal ulcer patients. ........................................ 58
12 xv
LIST OF SYMBOLS AND ABBREVIATIONS
SYMBOL/ABBREVIATION AGS AJ APS BPB BSA CA cag PAI cagA CRPIA DMEM DNA DTT DU ELISA EPIYA FBS GU H. pylori HRP IL-8 kb MALT MOI NF-kB nm PAGE PAK PBS PCR RT SD SDS
human gastric adenocarcinoma adherence junction Ammonium persulfate Bromophenol blue Bovine Serum Albumin Gastric cancer cag Pathogenicity Island cytotoxin associated gene A conserved repeat responsible for phosphorylation-independent activity Dulbecco's Modified Eagle Medium Deoxyribo Nucleic Acid Dithiothreitol Duodenal ulcers Enzyme-linked immunosorbent assay Glu-Pro-Ile-Tyr-Ala amino acids Fetal Bovine Serum Gastric ulcers Helicobacter pylori Horse Radish Peroxidase Interleukin-8 kilo base mucosa-associated lymphoid tissue lymphoma Multiplicity of Infection nuclear factor kappa B nano meter Polyacrylamide gel electrophoresis α21-activated kinase Phosphate Buffer Solution polymerease chain reaction Room Temperature Standard Deviation Sodium dodecyl sulfide
13 xvi
SFKs SHP-2 T4SS TBE TBST TEMED TJ TMB UV vacA αPix β-ME
Src family kinases Src homology region 2 type IV secretion system Tris-borate EDTA Tris Buffer Saline Tween20 Tetramethyl etilen diamine tight junction Tetramethylbenzidine Ultra violet Vacuolating cytotoxin antigen gene A interactive exchange factor ß-mercaptoethanol
1
CHAPTER I
INTRODUCTION
1.1 Helicobacter pylori Helicobacter pylori is a spiral shaped, flagellated, Gram-negative bacterium that colonizes the human gastric epithelium cells. Approximately half of the World populations are known to be infected with H. pylori. It is a major cause of peptic ulcer disease (both gastric and duodenal ulcers) and a risk factor for the development of gastric adenocarcinoma and mucosa-associated lymphoid tissue (MALT) lymphoma (Reyes-Leon et al., 2007; Atherton and Blaser 2009; Baghaei et al., 2009; Sgouras et al., 2009; Ritter et al., 2010; Salih et al., 2010) . In developing countries, more than 70% and up to 100% of the populations are infected with H. pylori (Perez et al., 2004), while in developed countries the prevalence is below 40% and is considerably lower in children and adolescents than in adults and elderly people (Kusters et al., 2006). H. pylori infection in the stomach induces mucosal inflammatory responses and oxidative stress that leads to diverse clinical outcomes in humans (Zaidi et al., 2009). The pathogenicity of H. pylori requires a complex interaction of bacterial, host and environmental factors (Hardin and Wright 2002). Several virulence factors of H. pylori that are essential for the colonization of the stomach and survival in this hostile environment play an important role in pathogenicity. Among these, the urease enzyme that mediates tolerance to acidity, adherence factors indispensable for colonization and maintenance of the infection, and the flagella which is important in penetrating the mucous layer (Xiang et al., 1995; Desaphy et al., 2004). The cag pathogenicity island (cagPAI) a 40-kb DNA segment integrated in the glutamate racemase gene of H. pylori chromosome is one of the major
1
2 virulence factors that is associated with the severity of infection (Censini et al., 1996, Higashi et al., 2002).
The cagPAI contains 31 genes that are important in pathogenesis and the formation of a type IV secretion system (T4SS). The cytotoxin associated gene (cagA) and the vacuolating cytotoxin gene (vacA) are H. pylori virulence factors mostly responsible for the severity of the disease (Backert et al., 2004; Jafari et al., 2008; Kumar et al., 2010; Shokrzadeh et al., 2010).
The cytotoxin-associated gene A (cagA) located in the right half end of the cagPAI encodes the CagA protein a highly immunodominant protein that has been found to be associated with an increased severity of gastric mucosal inflammation, development of peptic ulceration, and an increased risk of gastric cancer (Censini et al., 1996; Ishikawa et al., 2009; Jones et al., 2009; Kumar et al., 2010; Shokrzadeh et al., 2010). The CagA protein is injected into the cytoplasm of the host cell by the T4SS and induces cell morphologic alterations, proliferation, adhesion and apoptosis (Lima et al., 2011).
The CagA protein varies in size between 120-140 kDa that is due to the presence of repeat sequences located in the 3′ region that contains the Glu-Pro-Ile-Tyr-Ala amino acids known as EPIYA motifs (Oldani et al., 2009; Salih et al., 2010). When the CagA protein is injected into the gastric epithelial cells, some CagA molecules are tyrosinephosphorylated through their EPIYA motifs, while others remain unphosphorylated (Poppe et al., 2007; Salih et al., 2010). Tyrosine phosphorylation of the EPIYA motifs plays a critical role in the morphological transformation of the gastric epithelial cells (Jones et al., 2009; Takata et al., 2009). In vitro and in vivo studies have shown that H. pylori induces inflammatory mediators such as interleukin-8 (IL-8) that plays a crucial role by chemo attracting and activating neutrophils to the site of infected gastric mucosa (Cendron et al., 2009; Jones et al., 2009; Sgouras et al., 2009; Zaidi et al., 2009). Reports on the role of the cagPAI in the induction of the disease were controversial. The presence or absence of the cagPAI and the correlation with the
3 severity of the disease also varies. In addition the role of the cagA EPIYA motifs in the secretion of IL-8 and the morphological changes of the AGS cells is still not clear. In this study, we aimed to investigate the effect of H. pylori infection on the function and morphological changes of the AGS gastric epithelial cell line in vitro, the role of the cagPAI virulent genes (cagT, cagM, cagE, cagA) on the induction of IL-8 secretion and the formation of the hummingbird phenotype.
Our objectives were to establish a correlation between the presence of an intact, partially deleted or absence of the cagPAI genes (cagT, cagM, cagE, cagA) and the induction of IL-8 and the morphological changes of the AGS epithelial cells in vitro. Similarly, a correlation between an increase in the number of the EPIYA-C motifs and the induction of IL-8 and the AGS morphological changes will be determined. To determine the cagA genotypic diversity of strains isolated from patients with gastritis, gastric ulcer and duodenal ulcer and their effect on the AGS gastric epithelial cancer cell activities in vitro.
This will provide evidence for the role of cagPAI and cagA virulence factors in this process and determine the level of IL-8 induced by cagA-positive strains from different gastric pathologies as compared to those of cagA-negative strains. In this study we will (1) detect the cagPAI genes (cagT, cagM, cagE, cagA), (2) detect the EPIYA motifs of cagA gene, (3) detect the level of IL-8 induction by the AGS gastric epithelial cells and (4) detect the induction of cellular elongation (Hummingbird phenotype) of AGS cells.
14
CHAPTER II
REVIEW OF LITERATURE
2.1 Pathogenesis H. pylori infects up to 50% of the world populations. Its capacity to adapt itself to the host rises from the high genetic variability of its genome. The bacterium is able to interplay closely with gastric epithelial cells and to response to diverse environmental stimuli. H. pylori produces strong variations in host cell cycle determining hyperproliferation and deregulation of important cell mechanisms (Desaphy et al., 2004; Monstein et al., 2010). It has been postulated that infection by H. pylori may contribute to disease in two distinct ways. One is by activating a chronic inflammatory response, which causes a cascade of molecular and morphological changes in the inflamed epithelium, leading to mucosal atrophy, metaplasia, dysplasia, ulcers and eventually gastric cancer. The other is that this bacterium may directly modify epithelial cell function and promote carcinogenesis by interfering with genes such as those regulating apoptosis, cell cycle control, tumor suppression, and cell-to-cell contacts (Backert and Selbach 2008; Keates et al., 2008). Infection of humans with H. pylori generally produces a chronic gastritis that in some people can lead to the development of the associated pathologies. While some infected individuals develop serious pathologies, others remain asymptomatic. This variability is due to a variety of complex interactions of different factors that include bacterial strain genetic variation, genetic makeup of the infected host that influence the immune responses mounted against infection, geographical distribution and other
4
5 environmental factors (Backert et al., 2001; Bourzac and Guillemin 2005; Atherton and Blaser 2009). The primary disorder, which occurs after colonization with H. pylori, is chronic active gastritis. The intragastric distribution and severity of this chronic inflammatory process depend on a variety of factors, such as genetic characteristics of the colonizing strain, virulence factors, host immune responses, and other environmental factors (Figure 2.1). Understanding of these factors is thus crucial for the recognition of the role of H. pylori in the etiology of upper gastrointestinal pathology (Kusters et al., 2006).
Figure 2.1 Schematic representation of the factors contributing to gastric pathology and disease outcome in H. pylori infection (Kusters et al., 2006). 2.2 Helicobacter pylori Virulence Factors Although a number of factors have been shown to be essential for colonization and the induction of mucosal damage by H. pylori, little is known about the exact molecular mechanisms that regulate the coordinated expression of the genes responsible of these functions. The human stomach is far from a stable habitat, experiencing
6 considerable fluctuations in nutrient availability, pH and temperature. Thus, a certain degree of adaptability would be expected to allow successful and persistent colonization. (Bijlsma et al., 2002; Desaphy et al., 2004).
Among the defined virulence factors of H. pylori, the flagella is essential for swimming through the mucous layer and the urease enzyme for neutralization of the stomach acidity. The multifunctional vacuolating cytotoxin (vacA) found in all strains causes vacuole formation in the infected cells (Bourzac and Guillemin 2005). The cytotoxin associated gene (cagA) on the other hand is present in nearly 60% of the strains and play a very important role in disturbing the cells signal transduction.
It is well known that H. pylori colonizes the stomach during childhood and persists for life (Atherton and Blaser, 2009). This article implies near perfect adaptation to the niche and an ability to evade the human immune response. Its spiral shape and flagella allow it to corkscrew through the gastric mucus gel, and numerous adhesions enable selective adherence to the epithelium. H. pylori has multiple mechanisms for protection against gastric acid; notably, 15% of its protein content comprises cytoplasmic urease. When the external pH is less than 6.5, a specific channel opens in the bacterial cytoplasmic membrane, allowing the urea to ingress. The ammonia produced by urea hydrolysis neutralizes the periplasm, allowing maintenance of the cytoplasmic membrane potential (Atherton and Blaser 2009).
Early investigations of the differential pathogenic properties of H. pylori strains showed that such properties were correlated with the ability of these virulent strains to induce morphological changes, vacuolization, and successive degeneration of in vitrocultured cells (Leunk et al., 1988). The cytotoxin associated gene (cagA) of the cagPAI and the vacuolating cytotoxin (vacA) gene not only affects the ability of the organism to colonize and cause disease but also affects inflammation and gastric acid output (Kusters et al., 2006). Much of the research interest worldwide is focused on the CagA effector protein since cagA-positive but not cagA-negative H. pylori strains are associated with the development of severe gastric diseases (Backert and Selbach 2008). The VacA and CagA proteins play a central role in the course of H.pylori infections as shown in vivo in the Mongolian gerbil and mouse models (Peek et al., 2000; Fujikawa et al., 2003; Rieder et al., 2005) as well as in vitro using cultured gastric epithelial cells.
7 A hallmark of H. pylori infected AGS cells is the development of the so-called “hummingbird” or “elongation” phenotype, which is dependent on the injection of CagA into the epithelial cell. This phenotype may have an important impact on pathogenesis because it could influence several processes including immune responses, wound healing, metastasis or invasive growth of cancer cells in vivo (Schneider et al., 2008). Recent functional studies in animal and cell culture models provided compelling evidence for the importance of H. pylori CagA and cagPAI in pathogenesis (Covacci 2000; Backert and Meyer 2006; Hatakeyama 2008).
2.3 cag Pathogenicity Island (cagPAI)
The cagPAI a 40 kb DNA insertion element, that carries up to 32 genes flanked by 31 bp direct repeats, is most likely acquired horizontally from a yet unknown ancestor and integrated into the H. pylori chromosomal glutamate racemase gene (figure 2) (Higashi et al. 2002; Desaphy et al. 2004; Backert and Selbach 2008; Cendron et al. 2009; McClain et al. 2009). CagA was recognized as a marker for the cagPAI region which is present in virulent strains but missing in avirulent H. pylori isolates (Censini et al., 1996; Akopyanz et al., 1998; Blomstergren et al., 2004). Similarly, it was reported that the cagPAI gene cluster is speculated to have been acquired by horizontal transfer from the other bacteria or H. pylori during bacterial evolution (Sugiyama and Asaka, 2004; Hatakeyama 2009). Among H. pylori virulence factors, the cagPAI has been shown to be involved in inducing inflammation, ulceration and carcinogenesis (Hatakeyama 2004) and similarly Terry et al. (2005) reported that in comparison to infection with cagPAI-negative H. pylori strains, infection with cagPAI-positive strains is associated with an increased severity of gastric mucosal inflammation and an increased risk for the development of peptic ulceration and gastric cancer. Nilsson et al. (2003) reported that an intact cagPAI was associated with a fivefold increased risk of severe disease outcome and suggested that isolates with internal deletions had reduced virulence comparable to those that were cagPAI-negative. These authors found no significant difference in the risk of developing severe disease among patients infected with cagPAI-negative strains and those with strains carrying the intermediate genotype. However, investigation of H. pylori cagPAI genotypes from different human populations has demonstrated that the cagPAI appears to be disrupted in the majority of
8 patients worldwide, with a range of conversation from 57.1% in Japanese strains to 415% in European isolates (Kauser et al., 2004).
Glutamate Racemase
Figure 2.2 Schematic representation of the cagPAI region. The cagPAI integration site within the glutamate racemase gene is shaded (a). cag structure: the putative ORFs are represented by arrows (b). The name of the genes are in boldface type (Censini et al., 1996).
According to Kauser et al. (2004), the cagPAI is highly conserved in Japanese isolates, least conserved in European and African isolates, and very poorly conserved in Peruvian and Indian isolates. The authors found that deletion frequencies of the cagA, cagE, and cagT genes were at their highest in benign cases, whereas the cagA promoter and the left end of the cagPAI were frequently rearranged in isolates from severe cases. The lack of correlation of different cagPAI rearrangements with clinical presentation has also been noted in several other reports (Nishiya et al., 2004). Deletion of the cagT, cagM, cagG, cagE and cagA genes has been reported in several cases of chronic gastritis, gastric ulcer and gastric cancer cases, indicating that the pathogenicity of H. pylori may not be determined by cagPAI genes alone (Kumar et al., 2010).
9 Also Schmidt et al. (2010) reported that a more comprehensive analysis of the cagPAI using multiple genes and oligonucleotide primer pairs has revealed that the cagPAI was not intact in the majority of H. pylori isolates from several countries and continents. Therefore, the association of the cagPAI, as a whole or in part, with clinical presentation is not yet completely understood. The finding of an intact cagPAI recovered homogenously from multiple paired antrum/corpus biopsies in almost 30% of patients is high considering the European ethnic origin of the study population (Matteo et al., 2007).
It is well-known that the cagPAI has several important pathological functions. It contains the cagA, a gene responsible for producing CagA protein, which is believed to have oncogenic potential (Hatakeyama 2004; Hatakeyama 2006). The cagPAI encodes a type IV secretion system (T4SS), a syringe-like structure specialized in the transfer of bacterial components such as CagA protein and peptidoglycan into host cells (Backert et al., 2000; Odenbreit et al., 2000; Viala et al., 2004). The cagPAI also induces the secretion of several inflammatory cytokines from the host cell including interleukin 8 (IL-8) (Censini et al., 1996; Yamaoka et al., 1997).
2.4 Type IV Secretion System (T4SS)
The type IV secretion system (T4SS) is encoded by the H. pylori cagPAI (Muyskens and Guillemin 2011). The T4SS consist of a large group of transporter machines in many Gram-negative bacteria that are ancestrally related to conjugation systems (Backert and Meyer 2006). These transporters are functionally diverse both in terms of the transported substrate (proteins or DNA-protein complexes) and the recipients, which can be either bacterial cells or eukaryotic cells (Sicinschi et al., 2010).
The T4SS enables bacteria to inject effector molecules into the cytoplasm of the host cells (Bauer et al., 2005; McClain et al., 2009). However, according to Backert et al. (2008), most T4SSs of different pathogens do not translocate their effectors into the culture supernatant and therefore the functional activation of these T4SSs requires a signal from the host cell, for example, the interaction with a specific receptor. In 2007, Kwok et al. reported that host cell integrins were recently shown to directly interact
10 with the H. pylori CagL protein and are so far the only T4SS receptor known. Binding of CagL to integrins induces local membrane ruffling, indicative of a general effect on membrane dynamics. The T4SS is involved in direct injection of virulence factors into host cells (Cornelis and Wolf-Watz 1997; Covacci et al., 1999; Galan and Collmer 1999). Model systems have been established for Agrobacterium tumefaciens, Bordetella pertussis, Legionella pneumophila and Helicobacter pylori. The prototypical T4SS is the A. tumefaciens transfer (T)-DNA transfer machine, which delivers oncogenic nucleoprotein particles into plant cells (Pansegrau and Lanka 1996).
How does the translocation of the CagA protein into gastric epithelial cells by the T4SS promote cancer? While the role of the T4SS specific accessory factors is unknown, the function of CagL and CagF was recently elucidated. Recent studies have shown that CagF, a chaperon-like protein which interacts with the C-terminal secretion signal of CagA, is involved in the early steps of CagA recognition and is crucial for CagA delivery (Couturier et al., 2006; Pattis et al., 2007; Backert and Selbach 2008). The binding of CagF may be important in stabilizing the entire protein and in preventing proteolysis before its injection (Angelini et al., 2009). On the other hand, CagL is a pilus-covering protein which acts as a specialized adhesion that connects the T4SS with target cells and CagL-intergrin interaction triggers CagA delivery into target cells. Once the T4SS injection needle is established, H. pylori also affects the actin cytoskeleton, transcriptional responses and cell-to-cell junctions. Interestingly, injected CagA mainly localizes to focal adhesions during infection (Kwok et al., 2007) while vector expressed CagA in the absence of H. pylori localizes to the entire host membrane (Higashi et al., 2002). This strongly suggests that H. pylori injects CagA locally at focal adhesions. Within the cells, CagA is phosphorylated by host cell kinases, forms a complex with SHP-2 (Src homology region 2), and activates the phosphatase SHP-2 resulting in a signaling cascade (Figure 2.3) that is further associated with cytoskeletal rearrangements and elongation of cultured epithelial cells (Sicinschi et al., 2010; Blomstergren et al., 2004; Wen and Moss 2009). The CagA translocation induces several consequences that result in the scattering and elongation of infected host cells in cell culture, resembling those of malignant cellular transformation (Cendron et al., 2009). Interestingly, the only known effector protein injected by the T4SS is CagA having no sequence homology with any known bacterial or eukaryotic protein (Hatakeyama 2008; Backert et al., 2010). Due to their pivotal role in H. pylori
11 colonization and pathogenesis, all these bacterial factors are currently being intensively studied to decipher how they trigger specific host cell responses (Backert et al., 2010).
Figure 2.3 CagA is phosphorylated by SRC, which allows it to specifically interact with the SRC-homology 2 (SH2) domains of the protein tyrosine phosphatase SHP2 (Hatakeyama 2004).
The SHP-2 plays an important role in both cell growth and cell motility, deregulation of SHP-2 by CagA may be involved in the induction of abnormal proliferation and elongation of gastric epithelial cells, a cellular condition eventually leading to gastritis and gastric carcinoma. According to Truong et al. (2009), it is possible that deregulation of SHP-2 by the translocation of CagA plays a role in the acquisition of a cellular transformed phenotype at a relatively early stage in the carcinogenesis of gastric carcinoma (Truong et al., 2009). Higashi et al. (2002) showed
12 that membrane tethering and activation of SHP-2 by the tyrosine phosphorylated CagA are necessary and sufficient for the induction of the hummingbird phenotype. The potential of individual CagA to perturb host-cell functions is determined by the degree of SHP-2 binding activity, which depends in turn on the number and sequences of tyrosine phosphorylation sites. The CagA protein of H. pylori in East Asian countries were shown to be significantly more potent in binding SHP-2 and in inducing cellular morphological changes than are CagA proteins of Western isolates (Higashi et al., 2002). Differences in the biological activities of Western and East Asian CagA proteins may underlie the striking difference in gastric cancer incidence between these two geographic areas (Higashi et al., 2002; Wen and Moss 2009).
Figure 2.4 Model for the assembled T4SS machinery and its role in H. pylori induced cell signaling (Backert and Selbach 2008). AJ, adherence junction; TJ, tight junction. A. Hypothetical model of the T4SS machinery. The T4SS is a multi-component protein complex spanning the inner and outer membranes of H. pylori. Current knowledge of T4SS functions and cellular localization of its components is shown in a simplified manner. The coupling protein VirD4 and structural components (VirB1–11) are typically required for secretion and are positioned according to their proposed functions.
13 This transporter enables secretion of substrates (CagA, peptidoglycan) from the bacterial cytoplasm directly into the cytoplasm of infected host cells. The CagL protein interacts with integrin receptors via its RGD motif to deliver CagA across the host cell membrane and to activate the Src tyrosine kinase for CagA phosphorylation. B. Functional activity of the T4SS pilus requires integrin receptors of the host. Scanning electron micrograph of T4SS pili are shown at the bottom. The T4SS and CagA are involved in numerous cellular effects, including membrane dynamics, actin cytoskeletal rearrangements, nuclear signaling and disruption of cell-to-cell junctions as indicated.
In 2008, Schneider et al. reported that although the injected CagA might imitate eukaryotic adaptor proteins by recruiting host signaling factors into protein complexes, both in a phosphorylation-dependent and a phosphorylation-independent manner. In addition, the tyrosine phosphorylation of CagA is maintained by Abl kinases in late phase infections, ensuring that the CagA protein constitutively stimulates signaling pathways in host cells. The CagA protein associated cell elongation possibly hinders H. pylori mediated cell migration, since failure of tail retraction might result in reduced migration speed. In contrast, elongation allows cells to pass tissues more easily, which would support invasive growth of single cells (Schneider et al., 2008).
Briefly, CagA is found in two states after injection into gastric epithelial cells: some CagA molecules undergo tyrosine phosphorylation, while others remain unphosphorylated or become dephosphorylated. With fully one-third of the epithelial cell genes‟ expressions altered by CagA after H. pylori infection, the changes observed were not affected by the phosphorylation state of CagA (Schmidt et al., 2009; Suzuki et al., 2009). In 2005, Bourzac et al. indicated that some of studies of CagA‟s cellular activities in epithelial cells reveal that CagA interacts with a large number of host proteins and has multiple effects on host signal transduction pathways, the cytoskeleton and cell junctions. The redistribution of junction proteins occurs independently of CagA phosphorylation and promotes leakiness of the tight junctions (Amieva et al., 2003), while other cellular changes, including cell elongation, are mediated by the phosphorylated form of CagA (Bourzac and Guillemin 2005). This results in
14 cytoskeletal reorganization and cell elongation – a phenotype that leads to cell scattering and the so-called “hummingbird” morphological change.
2.5 Cytotoxin Associated Gene (cagA) The cagA gene localized at the 3‟ end of the cagPAI in H. pylori genome encodes a 120-140 kDa CagA protein that is highly immunogenic (Sicinschi et al., 2010). H. pylori strains are subdivided into two types, cagA-positive strain and cagAnegative strain (Murata-Kamiya 2011). More than 90-95% of H. pylori strains isolated in East Asian countries such as Japan, Korea and China carry cagA gene. In contrast, only 60% of H. pylori strains isolated in Western countries such as America and Africa carry cagA gene (Yamaoka 2009). Hatakeyama et al. (2009) also indicated that approximately 30-40% of H. pylori strains isolated in Western countries do not carry cagPAI and thus are cagA-negative, whereas almost all of the East Asian H. pylori isolates are cagA-positive. In agreement with the in vitro consensus that East Asian type cagA is more virulent than Western type cagA, in one study more than 70% of the gastric cancer patients carried East Asian type cagA, whereas only 20% of simple gastric cases had East Asian type cagA.
Studies have shown that most people with peptic ulcer disease mounted a systemic or local antibody response to CagA, and although CagA positive strains are common even amongst those without ulcers, their prevalence in ulcer patients is consistently higher (Atherton 1998). In Western populations, chronic infection with cagA-positive strains induces progressive histopathological changes in gastric mucosa that lead to superficial gastritis, atrophic gastritis, intestinal metaplasia, dysplasia and adenocarcinoma such relationship was not observed in many populations with high rates of gastric cancer including East Asia (Hatakeyama 2009; Wen and Moss 2009; Sicinschi et al., 2010).
Much of what is known about CagA is through cell culture studies (Muyskens et al., 2011). Using cultured human gastric cells, it was shown that the CagA protein is inserted into the host cells through a T4SS, and once inside the cell it is phosphorylated by Src kinases at tyrosines within repeated EPIYA motifs (Hatakeyama 2008; Monstein et al., 2010). Once phosphorylated, CagA binds to a cytoplasmic Src Homology 2 (SH2)
15 domain of Src Homology 2 phosphatase (SHP-2). Because CagA–SHP-2 complexes disrupt signal transduction pathways of the cell, the complexes may be involved in the development of atrophic gastritis and the transition from atrophy to intestinal metaplasia (Acosta et al., 2010; Sicinschi et al., 2010). In addition, it also interferes with the signal transduction pathway of the host cell and manipulates cell growth, differentiation and apoptosis (Xu et al., 2010). This interference causes a restructure of the host cell cytoskeleton, cell scattering as well as invasive growth of cells, and formation of hummingbird phenotype with gastric epithelial cells (Acosta et al., 2010; Terradot and Waksman 2011). Such a process not only is considered an important strategy of interaction between H. pylori and host cell, but also is the most significant mechanism of pathogenesis and carcinogenesis of H. pylori (Hatakeyama 2008).
Other studies shared that H. pylori infection could induce IL-8 release in AGS cells and that the induction of IL-8 by these cells was dependent on the presence of CagA protein (Li et al., 2010). Similarly Panayotopoulou et al. (2010) indicated that infection with strains possessing a functional T4SS led to significant higher IL-8 secretion, irrespective of the number of EPIYA-C site and to CagA phosphorylation.
Reyes-Leon et al. (2007) reported that low phosphorylation of CagA might explain the low cell activity, but in others, negative activity was observed in spite of the translocation and phosphorylation of CagA. In addition to its phosphorylationdependent activities, CagA perturbs cell functions in a tyrosine phosphorylationindependent manner. For instance, the CagA protein has been shown to disrupt apical junctions, impair cell-cell contacts, and thereby destroy normal epithelial architecture. The CagA protein also activates the nuclear factor of activated T cells by stimulating calcineurin in a phosphorylation-independent manner and also the nuclear factor kappa B (NF-kB), which induces pro-inflammatory cytokines, such as interleukin (IL)-8 (Kurashima et al., 2008).
Interestingly, studies on the delivery mechanism of CagA have shown that the T4SS requires a receptor on the host cell surface, the integrins member β1 (Kwok et al., 2007; Jimenez-Soto et al., 2009). In addition, the effector protein CagA itself can also interact with β1 integrin (Jimenez-Soto et al., 2009) as well as membrane-associated phoshatidylserine (Murata-Kamiya et al., 2011). Thus, it can be proposed that CagA is
16 not injected into host cells in a random fashion but rather in a possibly tightly controlled way (Wessler and Backert 2008). Experimental delivery of CagA into target cells, which can be achieved either by H. pylori infection or transfection of transgenes in cultured cells or expression in mice in the absence of H. pylori, has provided evidence that CagA evolved the ability to disturb multiple host cell signaling cascades. These signaling pathways not only include the induction of membrane dynamics, actincytoskeletal rearrangements and the disruption of cell-to-cell junctions but also proliferative, pro-inflammatory and anti-apoptotic nuclear responses (Hatakeyama 2008; Backert and Naumann 2010; Kim et al., 2010). 2.6 cagA 3’ End EPIYA Motifs The cagA gene contains a 5‟ end which is highly conserved and a 3‟ end which is variable (Reyes-Leon et al., 2007). The CagA 3‟ end is structurally characterized by the presence of repeated units of five different amino acid sequences glutamine-prolineisoleucine-tyrosine-alanine (Glu-Pro-Ile-Tyr-Ala), designated as EPIYA motifs (Kanada et al., 2008; Nguyen et al., 2008; Sgouras et al., 2009; Sicinschi et al., 2010; Batista et al., 2011). Phosphorylation of CagA occurs within the tyrosine phosphorylation motifs in the carboxy-terminal variable region of the protein. These motifs are defined as EPIYA A, B, C and D according to different amino acid sequences (Reyes-Leon et al., 2007; Jones et al., 2009; Queiroz et al., 2010).
Recent studies showed that two major types of CagA protein have been identified depending on the geographic location. The Western type, which represents the CagA of H. pylori strains prevalent in Europe, America, Australia and Africa, contains EPIYA-A and EPIYA-B and Western cagA-specific EPIYA-C segments (Kurashima et al., 2008; Fock and Ang 2010; Murata-Kamiya et al., 2010). The latter motif varies in number among distinct Western CagA proteins, mostly ranging from one to five (Argent et al., 2008; Salih et al., 2010). The Eastern type CagA of H. pylori strains circulating in Japan, Korea and China, also possesses EPIYA-A, EPIYA-B segments and a distinct EPIYA-containing segment, termed EPIYA-D, which is unique to East Asian strains. Accordingly, the EPIYA repeat region of East Asian CagA is in an arrangement of EPIYA-A, EPIYA-B and EPIYA-D segments (A-B-D type CagA) (Kurashima et al., 2008; Nguyen et al., 2008; Hatakeyama 2009; Sicinschi et al., 2010;
17 Murata-Kamiya 2011). Remarkably, the EPIYA-A and EPIYA-B motifs are found in strains throughout the world. These EPIYA-repeats can appear in different numbers and configurations at the carboxy-terminus of CagA variants (Backert et al., 2010).
Recent reports have demonstrated that tyrosine phosphorylation of EPIYA motifs in CagA plays a critical role in the morphological transformation of cells, and that East Asian CagA has greater toxicity than Western CagA (Takata et al., 2009). Accordingly, East Asian strains are believed to be more virulent than Western strains, and this might be the reason why the incidences of gastric cancer in East Asian countries are relatively higher than those in Europe, North America, and Australia (Truong et al., 2009; Xia et al., 2009). A recent study also showed that H. pylori strains possessing East Asian type CagA have an ability to induce higher amount of interleukin-8 from gastric epithelial cells than H. pylori strains possessing Western type CagA (Argent et al., 2008).
The EPIYA-repeat region of Western CagA is subdivided into the EPIYA-A segment, the EPIYA-B segment and the EPIYA-C segment, each of which contains a single EPIYA motif (Figure 5). The border of each EPIYA segment was determined by comparing sequences of the EPIYA-containing regions in various CagA molecules, which were made by genomic recombination. The EPIYA-C segment variably multiplies (mostly from one to five times) among different Western Cag species. East Asian CagA does not have the EPIYA-C segment, but instead possesses the EPIYA-D segment (Hatakeyama 2009).
18
Figure 1.5 Structural polymorphism in the C-terminal, end of the cagA gene showing the EPIYA-repeat regions of the CagA protein of the Western type and the East Asian type cagA. (Hatakeyama 2009).
The EPIYA-C and EPIYA-D serve as the primary CagA phosphorylation sites and are required for binding to SHP-2 (Jones et al., 2009; Xia et al., 2009). It has been suggested that the variation in number of repeating EPIYA-C motifs determines the biological activity of CagA in phosphorylation-dependent as well as phosphorylationindependent ways (Higashi et al., 2002; Hatakeyama 2008). It has also been shown that the number of CagA EPIYA-C motifs is an important factor for cancer risk among Western strains (Monstein et al., 2010; Shokrzadeh et al., 2010). Most of the molecular epidemiological studies have indicated a correlation between disease severity and increased number of EPIYA-C motifs among Western isolates and the number of EPIYA-C sites is directly related to levels of CagA tyrosine phosphorylation, SHP-2 binding activity, and cytoskeletal alterations known as the „hummingbird phenotype‟ (Reyes-Leon et al., 2007; Jones et al., 2009; Sicinschi et al., 2010).
19 Wen et al. (2009), also showed that the EPIYA-D region of East Asian CagA shows stronger SHP-2 binding activity and induces the hummingbird phenotype in cultivated gastric epithelial cells to a greater extent than that induced by the EPIYA-C segment of Western CagA (Wen and Moss 2009; Zhang et al., 2009; Shokrzadeh et al., 2010). Given that CagA phosphorylation is essential for modulating cellular functions, H. pylori would potentially be able to modify the effects of CagA by varying the number of EPIYA repeats. It is tempting to speculate that the number of phosphorylation sites present in CagA correlates with the degree of pathogenic effects induced during infection with H. pylori (Selbach et al., 2002).
With fully one-third of the epithelial cell gene expressions altered by CagA after H. pylori infection, the changes observed were not affected by the phosphorylation state of CagA (Suzuki et al., 2009). Previous studies had indicated that phosphorylated CagA caused a down regulation of Src family kinases activities, via both Csk-dependent and independent pathways, and that this decrease in kinases activities exerted a feedback effect that decreased the levels of phosphorylated CagA during H. pylori infection in vitro (Selbach et al., 2003).
The biological half-life of CagA in gastric epithelial cells was calculated to be about 200 minutes and is independent of its phosphorylation sites (Ishikawa et al., 2009). However, in another study CagA-EPIYA deletion mutants still localized to the plasma membrane (Mimuro et al., 2002). Interestingly, the eukaryotic kinases responsible for CagA phosphorylation have been identified as well known oncoproteins. In particular, Src family kinases (SFKs) that control cytoskeletal processes, differentiation and proliferation of healthy cells, are also key players in tumorigenesis, have been found to phosphorylate CagA both in vivo and in vitro (Selbach et al., 2002; Backert et al., 2010).
In a recent study on H. pylori strains isolated from South African gastric carcinoma patients five of six Western-type H. pylori strains possessed multiple EPIYA-C sites, compared to only one of 19 strains from non-cancer patients (Argent et al., 2004). Yamaoka et al. (1999) found a significant association between the EPIYA-C motifs in triplicate and gastric atrophy and intestinal metaplasia among H. pylori isolates from Colombian patient.
20 Quite recently, Suziki et al. (2009) reported that the phosphorylationindependent proinflammatory and anti-apoptotic activities of CagA could be accounted for by a C-terminal domain of CagA distinct from the EPIYA motif and named conserved repeat responsible for phosphorylation-independent activity (CRPIA). They concluded that the CRPIA motif is important for sustaining cancer-associated transcriptional activation during chronic H. pylori infection. The authors suggested that synthetic CRPIA motif-derivative peptides greatly suppressed the proinflammatory response, a major pathogenic feature of H. pylori infection of the gastric epithelium and a major cause of gastric diseases, including gastric cancer.
2.7 Interleukin-8 induction
IL-8, a member of the CXC chemokine family, which was originally identified as a potent chemo-attractant for neutrophils and lymphocytes, induces not only cell proliferation and migration, but also angiogenesis (Sugimoto et al., 2010). IL-8 is secreted by several cell types, including monocytes, fibroblasts, endothelial cells, and epithelial cells. The primary function of IL-8 is thought to serve as a potent inflammatory mediator attracting and activating polymorphonuclear leukocytes, neutrophils in particular. Transcription of the IL-8 gene encodes for a protein of 99 amino acids that is subsequently processed to yield a signaling competent protein of either 77 amino acids in non immune cells or 72 amino acids in monocytes and macrophages (Waugh and Wilson 2008). IL-8 is produced by gastric epithelial cells during H. pylori infection, particularly by the cagPAI-positive strains (Yamaoka et al., 1999). Since H. pylori appears to contact only the surface of the gastric epithelium, the secretion of IL-8 by the gastric epithelium may be important in initiating and response to this bacterium (Baggiolini et al., 1994). In addition, IL-8 protein levels are 10-fold higher in gastric cancer than in normal gastric tissue, and directly correlate with the vascularity of the tumors (figure 2.6). The transfection of gastric cancer cells with the IL-8 gene enhances their tumorigenesis and angiogenesis in the gastric wall of nude mice. Increased IL-8 levels may amplify the inflammatory response to H. pylori by recruiting neutrophils and monocytes, thereby resulting in an advanced degree of gastritis, which ultimately predisposes to the development of gastric cancer (Sugimoto et al., 2010).
21
Figure 2.6 The role of IL-8 signaling in the tumor microenvironment (Waugh and Wilson 2008).
IL-8 could directly or indirectly damage the surface epithelial cells leading to loss of microvilli, irregularity of the luminal border and vacuolation. Zaidi and coworkers (2009) studied the effect of the chemical agent (resveratrol) on H. pyloriinduced IL-8 secretion and reported that the up regulation of IL-8 by H. pylori may lead to free-radical generation and the release of proteolytic enzymes from activated neutrophils ultimately affecting mucosal integrity. They claimed that IL-8 secretion is usually regulated by the transcription factor NF-кB and H. pylori is known to induce IL8 expression via activating NF-кB pathway in gastric epithelial cells. Since resveratrol
22 is an inhibitor of NF-кB, its suppressive effect on IL-8 secretion may correlates with its NF-кB inhibitory activity.
The mystery of the IL-8 inducing effector function was recently resolved by the finding that H. pylori peptidoglycan is sufficient to induce the proinflammatory response in a cagPAI-dependent manner through activation of the intracellular innate immune receptor Nod1 (Viala et al., 2004). In another study the cagE gene of the cagPAI that is essential for the proper function of H. pylori T4SS, it was found that strains lacking cagE do not induce either IL-8 secretion or CagA mediated host cell cytoskeletal rearrangement in gastric epithelial cells (Kranzer et al., 2005).
Heat inactivation, formalin inactivation, sonication and freezing-thawing of H. pylori seems to affect IL-8 production. Sharma et al. (1995) reported that heatinactivated H. pylori did not induce IL-8 production in AGS and similarly Crabtree et al. (1994) showed reduced IL-8 production in ST42 epithelial cells. In contrast to the innate cytokine responses, bacterial viability and a fully functional cagPAI seems to be important for the activation of epithelial cells.
Reyes-Leon et al. (2007) compared three groups of H. pylori isolates, intact cagPAI, partially deleted cagPAI (cagA negative), and cagPAI negative to analyze their ability to induce IL-8 secretion. They reported a wide diversity in the IL-8 levels among the cagPAI-positive that ranged from 1500 pg/ml. On the other hand, the cagPAI-negative isolates and partially deleted cagPAI (cagA-negative) induced IL-8 levels below 200 pg/ml in all cases. These results showed that negative or weak IL-8 induction in cagPAI positive isolates might be due to specific modifications in the CagA sequence. Brandt et al. (2005) recently reported that among cagPAI-positive strains there are high and low IL-8 inducers, and this variability was associated with the number of EPIYA motifs and the amino acid residues surrounding these motifs, stressing the need for CagA to induce IL-8 in epithelial cells. In another study Backert et al. (2004) have detected low IL-8 inducers in cagPAI-negative strains and in strains with a cagPAI defect, favoring the concept that at least two pathways of H. pylori – induced IL-8 induction may exist, a cagPAI-dependent pathway (high inducers) and a cagPAI-independent pathway (low inducers).
23 Another study showed that IL-8 expression plays a role in the induction of apoptosis by epithelial cells that is limited to strains of H. pylori bearing the cagPAI (Censini et al., 1996). The viability of H. pylori and strain variations may differentially affect apoptosis and IL-8 induction. H. pylori may interact with surface molecules in order to stimulate the various responses in gastric epithelial cells (Fan et al., 1998).
In one study, Zhang et al. (2009) examined the kinetics of IL-8 production and CagA status in AGS cells infected with H. pylori. They observed that the kinetics of IL8 production induced by the wild type Eastern type CagA was faster and greater compared to that by Western type CagA. The highest levels were detected at approximately 48h and 12h in Western type CagA and Eastern CagA, respectively. The isogenic cagA-disrupted mutants showed a lower level of IL-8 production than the corresponding parent strains over all. According to their results at 48h (late phase), there was no significant difference in IL-8 production induced by wild-type and cagA mutant strains. In addition, they also demonstrated that IL-8 level reduced tremendously in the early phase of the wild-type strains exposed to low pH that was restored by the addition of urea. These data suggest that the acid pH exerts an effect on the kinetics of H. pyloriinduced IL-8 production in CagA-dependent manner and urea was necessary for the effective induction of IL-8.
2.8 Hummingbird Phenotype
The net effects of CagA phosphorylation include reorganization of the actin cytoskeleton, increased cell proliferation, motility and activation of inflammatory cells, and mitogenic gene transcription. The morphological changes induced by CagA in the AGS gastric epithelial cell line have been termed “hummingbird” phenotype and are reminiscent of the responses of many epithelial cell types to hepatocyte growth factor stimulation (Kim et al., 2010). CagA translocation has been reported to be accompanied by a dramatic elongation of the infected AGS cells (Higashi et al., 2002; Selbach et al., 2003; Moese et al., 2004; Backert and Meyer 2006). This spindle-like morphology of the infected cells is termed as the hummingbird phenotype with the presence of thin, needle-like protrusions of 20 µm to 70 µm in length. Moese et al. (2004) observed that the establishment of the hummingbird phenotype in infected AGS cells was obtained 2 hours post infection. They also reported that this elongation phenotype was mainly
24 dependent on the presence of CagA translocation (Bourzac and Guillemin 2005). This phenotype may reflect an epithelial to mesenchymal transitions towards a more invasive state though this has not been formally proven. Numerous other cellular effects consequent to CagA translocation have been described, but not all require CagA phosphorylation (Backert and Selbach 2008).
2.9 Tissue Culture Cell Line
For in vitro cell studies, it is essential to choose an appropriate model such that it is able to accurately reflect the results of infection in vivo. For this reason, tissue culture cell lines of gastric origin are commonly chosen for H. pylori studies (Nilius et al., 1994). Clyne and Drumm in 1993 found out that H. pylori strains PU3, PU4, PU5, PU6 and 136292 bound better to gastric cells than to colonic or duodenal cells. Their findings also suggested that the bacteria exhibited similar tropism for gastric cells in vivo and in vitro. This is followed by Nishihara et al.‟s findings (1999) and later by Kaji et al. (2002) and Zhang et al. (2005) who reported that H. pylori binds well to AGS cells (ATCC-1739, USA), a gastric epithelial cell line which was derived from fragments of a tumor resected from a patient with adenocarcinoma who had received no prior therapy.
25 1
CHAPTER III
MATERIALS AND METHODS
3.1 Patients
Fifty-three patients attended the endoscopy unit at the Istanbul Teaching Hospital were enrolled in this study. Gastric biopsies from the antrum for rapid urease test (RUT), culture and PCR were collected to detect the presence or absence of H. pylori. The presence of H. pylori was considered positive when detected by either one of the above test. Of the 53 patients 38 (Gastritis=16, Duodenal ulcers=13, Gastric ulcer=9) (16 females) were found infected with H. pylori. The age range of these patients was between 19-78 years (average 40).Those who had received antibiotics, non-steroidal anti-inflammatory drugs, steroids or proton pump inhibitors at least 1 month prior to endoscopy were excluded. An informed written consent was obtained from all patients. The study was approved by the ethical committees of both Fatih University and the Istanbul Teaching Hospital. After endoscopic examination, gastric biopsy specimens from the antrum for rapid urease test (RUT), culture and PCR were collected to detect the presence or absence of H. pylori.
3.2 Rapid urease test (RUT)
The RUT is a qualitative assay based on the detection of H. pylori urease activities. Biopsy specimen was submerged into the test tube and examined for color change from yellow to pink that occur within few minutes to several hours.
25
26 3.3 Isolation and culture of H. pylori strains Antral biopsy specimens were homogenized under sterile conditions in 100 µl of sterile 0.9% saline solution using a homogenizer (Ultra –Turrax T25, IKA, Canada, USA). The homogenate was then inoculated onto Columbia blood agar plates containing 5% horse blood (Salubris A.S.,Turkey) and incubated in a 5% CO2 incubator at 37ºC for 5-7 days. The bacterial cultures were harvested using sterile loop, placed in 1 ml phosphate buffer saline (PBS) and then centrifuged at 6000 x g for 10 minutes at 4°C. The cell pellet was then washed with PBS, H. pylori cells were harvested from culture plates, suspended into 1 ml of Brucella Broth supplemented with 20% glycerol and stored at -80°C until used. The identification of the H. pylori colonies were done using gram stain, catalase test and oxidase test. Subsequently, a single-colony isolate was selected from each culture for cloning and further characterization.
3.4 Gram staining
The bacterial smears were air-dried and heat fixed. The smears were stained with crystal violet for 1 min followed by 1 min with iodine, rinsed off the stain with alcohol and washed under running water. The smears were then counterstained with safranin for 30s and then washed with water. The slides were blotted dry and viewed at 1000X magnification. The presence of Gram-negative spiral shaped bacilli bacteria is an indicative of H. pylori.
3.5 Catalase Test
A colony of the bacterial isolate was smeared onto a glass slide and a droplet of 3% hydrogen peroxide (Merck, Germany) was added to the smear. A positive result was characterized by the presence of effervescence. Effervescences (oxygen bubbles) were observed when H. pylori culture was inoculated into hydrogen peroxide reagent. The reason of that H. pylori possesses catalase which decomposed hydrogen peroxides into water and oxygen.
27 3.6 Oxidase Test
A strip of filter paper was dipped into 1% oxidase reagent (tetra-methylphenylenediame dihydrochloride) (Sigma, USA). With a sterile toothpick, bacterial colony was transferred onto the reagent soaked filter paper. Typical H. pylori shows a positive purple color patch developed at the site of the smear within few minutes. A positive reaction confirms the presence of H. pylori as the Oxidase enzyme oxidizes the tetra-methyl-phenylenediame dihydrochloride to form a colored compound (indophenol blue).
3.7 Extraction of genomic DNA
H. pylori colonies grown on Colombia blood agar medium were harvested and genomic DNA was extracted using the QIAamp DNA Mini Kit (Qiagen Co., Hilden, Germany) according to the manufacturer‟s protocol.
-
Bacterial cells (25 mg) was placed in a 1.5 ml microcentrifuge tube and 180 μl Buffer ATL was added (The volume of Buffer ATL should be increased proportionally if the weight of the bacterial cells is larger than 25 mg).
-
20 μl Proteinase K was added, mixed by vortexing and incubated at 56°C overnight in a shaking water bath until the tissue was completely lysed. Lysis time varies depending on the type of tissue processed. Lysis is usually complete in 1-3 h and lysis overnight is possible.
-
The 1.5 ml microcentrifuge tube was centrifuged briefly to remove drops from inside of the lid.
-
200 μl Buffer ATL was added to the sample, mixed by pulse-vortexing for 15 s, and incubated at 70°C for 10 min. The 1.5 ml microcentrifuge tube was centrifuged briefly to remove drops from inside the lid.
-
A 200 μl ethanol (96-100%) was added to the sample, and mixed by pulsevortexing for 15 s. After mixing, 1.5 ml microcentrifuge tube was centrifuged briefly to remove drops from inside the lid.
-
The all mixtures from step 5 were carefully applied to the QIAamp Spin Column (in a 2 ml collection tube) without wetting the rim. The cap was closed, and
28 centrifuged at 8000 rpm for 1 min. Then, the QIAamp Spin Column was placed in a clean 2 ml collection tube (provided), and the collection tube containing the filtrate was discarded. -
The QIAamp Spin Column was carefully opened and 500 μl Buffer AW1 was added without wetting the rim. The cap was closed, and centrifuged at 8000 rpm for 1 min. The QIAamp Spin Column was placed in a clean 2 ml collection tube (provided), and the collection tube containing the filtrate was discarded.
-
The QIAamp Spin Column was carefully opened and 500 μl Buffer AW2 was added without wetting the rim. The cap was closed and centrifuged at 14000 rpm for 3 min.
-
The QIAamp Spin Column was placed in a clean 1.5 ml microcentrifuge tube (not provided), and the collection tube containing the filtrate was discarded. The QIAamp Spin Column was carefully opened and 200 μl Buffer AE was added. Then it was incubated at room temperature for 5 min and centrifuged at 8000 rpm for 1 min.
-
The step 9 was repeated 2 times more.
-
DNA was stored at -20°C.
3.8 PCR
The presence of H. pylori was further confirmed by PCR using the forward primer ureC (5‟-AAGCTTTTAGGGGTGTTAGGGGTTT-3′) and reverse primer ureC (5′-AAGCTACTTTCTAACACTAACGC-3′)
that
detects
the
urease
C
gene.
Amplification of the cagA 3‟ variable region was performed using forward primer cag2 (5‟-GGAACCCTAGTCGGTAATG-3‟) and reverse primer cag4 (5‟-ATCTTTGAGCT TGTCTATCG-3‟) resulting in generation of fragments varying from 450 to 850 bp (Table 3.1) (Argent et al., 2005). The forward primer cagA28F (5‟-TTCTCAAAGGAG CAATTGGC-3‟) and reverse primers cagAP1C (5‟-GTCCTGCTTTCTTTTTATTAAC TTKAGC-3‟), cagA-P2CG (5‟-TTTAGCAACTTGAGCGTAAATGGG-3‟), cagAP2TA (5‟-TTTAGCAACTTGAGTATAAATGGG-3‟) and cagA-P3E (5‟-ATCAATTG TAGCGTAAATGGG-3‟) were used to amplify the EPIYA motif encoding sequences A, B, C and D, respectively (Salih et al., 2010). For detection of the cagE gene, forward primer 101 (5‟-TTGAAAACTTCAAGGATAGGATAGAGC-3‟) and reverse primer 102 (5‟- GCCTAGCGTAATATCACCATTACCC-3‟), for detection of the cagM gene,
29 forward primer cag5 (5‟-ACAAATACAAAAAAGAAAAAGAGGC-3‟) and reverse primer cag6 (5‟-ATTTTCAACAAGTTAGAAAAAGCC-3‟), for detection of the cagT gene forward primer cagF1 (5‟-ATGAAAGTGAGAGCAAGTGT-3‟) and reverse primer cagR1 (5‟-TCACTTACCACTGAGCAAAC-3‟) were used (Table 3.1). A reaction mixture of 25 µl containing 0.2 mM concentrations of each dNTP (Fermentas), a 15 pmol concentration of the forward primer (BioBasic, Canada) 15 pmol concentration of the reverse primer (BioBasic, Canada),
1U of Taq DNA
polymerase (Fermentas) and 100 ng of genomic DNA, 1X Taq Buffer (Fermentas) and ultra pure water.
Table 3.1 Specific primers used to identify H. pylori, cag PAI genes and EPIYA motifs in this study. Detection
Primer
Primer Sequence (5’3’)
ureCF
GGAACCCTAGTCGGTAATG
ureCR
ATCTTTGAGCTTGTCTATCG
cagA
cag2
GGAACCCTAGTCGGTAATG
(3’ end)
cag4
ATCTTTGAGCTTGTCTATCG
101
TTGAAAACTTCAAGGATAGGATAGAGC
102
GCCTAGCGTAATATCACCATTACCC
cag5
ACAAATACAAAAAAGAAAAAGAGGC
cag6
ATTTTCAACAAGTTAGAAAAAGCC
cagF1
ATGAAAGTGAGAGCAAGTGT
cagR1
TCACTTACCACTGAGCAAAC
cagA-28F
TTCTCAAAGGAGCAATTGGC
cagA-P1C
GTCCTGCTTTCTTTTTATTAACTTKAGC
EPIYA B
cagA-P2CG
TTTAGCAACTTGAGCGTAAATGGG
(Argent et al., 2005)
EPIYA C
cagA-P2TA
TTTAGCAACTTGAGTATAAATGGG
(Argent et al., 2005)
EPIYA D
cagA-P3E
ATCAATTGTAGCGTAAATGGG
(Argent et al., 2005)
ureC
cagE
cagM
cagT
EPIYA A
Reference (Douraghi et al., 2009)
(Argent et al., 2005)
(Douraghi et al., 2009)
(Mattar et al., 2007)
Kidd et al., 2001)
(Argent et al., 2005)
Amplification conditions were optimized in thermocycler (TC-512 Gradient Thermal Cycler, UK) as follows: initial denaturation for 90s at 95°C was followed by 35 cycles of denaturation at 95°C for 30s, annealing at 57°C for 60s, and 72°C for 30s and a final extension at 72°C for 5 min. PCR products (10 μl of each sample) were
30 separated by electrophoresis through 1.5% agarose gels, stained with SyberSafe (Invitrogen Corporation, USA) for 2h at 60 V and then examined under UV illumination (Argent et al., 2005).
3.9 Agarose Gel Electrophoresis
3.9.1 Preparation of the gel
-
A 1.5% agarose gel was used to detect PCR products.
-
0.75 g of agarose (Sigma, St. Louis, USA) was mixed with 50 ml of 0.5X Trisborate EDTA (TBE) buffer.
-
Then it was heated until boiling.
-
The gel was cooled to 40°C and 5 μl SyberSafe DNA gel stain (Invitrogen Corporation, USA) was added.
-
The gel was then poured and a comb was placed in the gel.
3.9.2 Loading
-
10 μl PCR product was mixed with 2 μl bromophenol blue as a tracking dye.
-
10 μl PCR product was then put in each slot.
-
1 μl of a 100 bp DNA Ladder (MBI Fermentas, Hanover, MD, USA) was mixed with 1 μl deionized water and 1 μl bromophenol blue. Then 5 μl of this mix was put into the side slot as a molecular marker.
-
The gel was run at 95 V in 0.5X TBE buffer for 50 min.
-
The gel was placed in Gel Doc 2000 (BioRad, Milan, Italy) apparatus and the bands were detected under UV transilluminator.
3.10 AGS cell culture
The AGS cell line (ATCC CRL-1739, USA) was used for coculture study and detection of IL-8 secretion and tyrosine phosphorylation. The cells were grown in 75cm2 flasks (Greiner Bio-One GmbH, Germany) with DMEM/Ham‟s F-12 nutrient mixture (Biochrom KG, Berlin) supplemented with 10% heat-inactivated fetal bovine serum (10% FBS) (Biochrom AG, Berlin) at 37°C in a 5% CO2 atmosphere for 48h. In
31 order to continue to grow AGS cells subcultures were done when the cells were at 7080% confluency.
3.10.1 AGS Cell Culture Protocol
-
The medium and all solution are placed in water bath at 37ºC for 20 min before used.
-
The frozen AGS cells were thawed in 37ºC water bath for 1 minute.
-
17 ml DMEM/Ham‟s F-12 medium was put into the 75 cm2 cell culture flask (Greiner Bio-One GmbH, Germany) by means of automatic pipet.
-
2ml FBS (10%) was added to flask and then AGS cells were added and were mixed gently.
-
The cells were incubated at 37ºC at in a 5% CO2 atmosphere for 48h.
-
48h later AGS cells were reached to 70-80% confluent and the cells were subcultured.
-
Beginning of the subculture procedure the preparation of the cabinet and the materials which are used during the culture was mentioned above.
-
The medium was discarded from the 75 cm2 cell culture flask (Greiner Bio-One GmbH, Germany).
-
The cells were washed with 10 ml prewarmed PBS (Biochrom AG, Berlin) solution.
-
After removing the PBS the cells were trypsinized with prewarmed 8 ml of 0,2% Trypsin/EDTA (Biochrom AG, Berlin) solution for 5 minutes in 5% CO2 incubator.
-
The cells were observed under the microscope (Nikon MM 400/800 inverted microscope, Japan) to see the whether the cells are detached or not. If not, the flask was shook gently till the cells detached.
-
As the cells become circular in shape, they were neutralized trypsin with 2ml of FBS.
-
Neutralized cells were transferred into a 15 ml centrifuge tube (Greiner Bio-One GmbH, Germany).
-
The tubes were centrifuged at 2000 rpm for 3 minutes at RT.
32 -
After centrifuge, the supernatant was discarded but some was left average 0.5 ml at the bottom. Then the pellet was mixed by means of finger and 4.5 ml of DMEM was added.
-
The cells were centrifuged for the second time the same as the step 16.
-
After centrifuge, the supernatant was discarded and 1ml was left at the bottom. Then the pellet was mixed by means of finger.
-
20 μl mixed sample was taken for counting.
-
After completing work all equipment and material were disinfected before removing from the cabinet. Inside the cabinet work surfaces was cleaned with 70% ethanol and wiped dry with tissue.
-
The cabinet was sanitized with 30 min UV light.
3.10.2 Viable Cell Counting Procedure
-
The hemocytometer was prepared, the mirror-like polished surface was carefully cleaned with lens paper and ethanol.
-
The cover slip was also cleaned. The cover slip was placed over the counting surface prior to adding the cell suspension.
-
The cells were diluted 1:1 in Trypan Blue (Sigma, Germany) in a microcentrifuge tube. (20 μl cell suspensions + 20 μl 0.4% Trypan Blue Solution).
-
The solution was allowed to sit for 5-15 min. Trypan blue stains non-viable (dead) cells.
-
10 μl of the mixture was placed in both wells of hemocytometer and the cover slip was centered on the hemocytometer and the mixture was injected in the well underneath the cover slip.
-
The counting chamber was then placed on the microscope stage and the counting grid was brought into focus at low power then was adjusted 10x power during the counting.
-
Both sides of the hemocytometer were counted while looking through the microscope.
-
Count all squares on each side of the hemocytometer. If cells are on the border outlining each square, only the cells were counted on the top and left border of the square.
33 -
Finally, the calculations were done in order to determine the number of cells per milliliter.
3.10.3 Calculation of cells
Average Number of Cells Average number of cells/mm2
Dilution Factor
=
=2
Number of cells per milliliter
x
x
x
x Dilution Factor x
3
0,1 mm = volume of 1 square -4
3
Simplified Calculation
-4
10 cm = 10 ml
Number of cells / mm2 x 2 x 104 = cells / ml
Example of a calculation
Total viable cells
:
69
+
59
=
128
Total dead cells
:
4
+
3
=
7
Total cells
:
128
+
7
=
135
Cells/ml = average cell count per square x dilution factor x 104 =
[(69 + 59) / 2] x 2 x 104
=
1,28x106 cells/ml
% Cell viability = (Total viable cells / Total cells) x 100 =
(128 / 135) x 100
=
94,8 % viable cells
34 3.11 Coculture with H. pylori The AGS cells were grown for 48h at 37ºC. When the cells reached 70-80% confluency, they were washed two times with PBS and then trypsinized for 3-5 min. After trypsinizing the cells, FBS was added and the cells were placed into a centrifuge tube and centrifuged at 3000 RPM for 3 min. After first centrifugation, the supernatant was discarded and fresh DMEM/Ham‟s F-12 was added and centrifuged for the second time at the same speed for 3 min. After centrifugation, the supernatant was discarded and fresh DMEM/Ham‟s F-12 was added again and the AGS cells were counted by means of the hemocytometer. The number and the amount of cells were calculated. The AGS cells (2x105/ml) were seeded into six well plates. However, at this time, serumfree DMEM/Ham‟s F-12 medium was added, and cells were incubated for an additional 24h.
H. pylori, which were grown onto Colombia blood agar plates for 5-7 days at 37ºC, a single colony was reseeded on a plate and incubated for additional 24h. After 24h later, H. pylori colonies were harvested and resuspended in serum-free DMEM/Ham‟s F-12 medium. Bacteria were counted by using the spectrophotometer (UV-1240 Shimadzu Spectrophotometer, Japan) to reach an optical density of 0.1 at 600 nm. Then the number of H. pylori was calculated according to McFarland standards (2x108 CFU/ml). After that, AGS cells in six-well plates were cocultured with H. pylori (2x107 CFU/ml) at a multiplicity of infection (MOI) of 100:1 in serum-free, antibioticfree DMEM/Ham‟s F-12 medium for up to 48h.
3.12 ELISA After coculture for 6 h, a 100 µl of cell culture supernatant was collected and stored at -80°C until it was tested for IL-8 induction. The amount of IL-8 in each sample was measured by an enzyme-linked immunosorbent assay (ELISA), using an OptEIA human IL-8 kit (Invitrogen Corporation, Camarillo, USA) following the manufacturer‟s instructions.
35 3.12.1 Human IL-8/NAP-1 Immunoassay Kit Content (Catalog # KHC0081: 1 plate)
Reagents Hu IL-8 Standard, recombinant Hu IL-8 Refer to vial label for
96 Test Kit 2 vials
quantity and reconstitution volume. Standard Diluent Buffer. Contains 8 mM sodium azide; 25 ml per
1 bottle
bottle. Hu IL-8 Antibody-Coated Wells, 96 wells per plate. Hu IL-8 Biotin Conjugate (Biotin-labeled anti-IL-8). Contains 8 mM
1 plate 1 bottle
sodium azide; 6 ml per bottle. Streptavidin-Peroxidase (HRP), (100x) concentrate. Contains 1.3
1 vial
mM thymol; 0.125 ml per vial. Streptavidin-Peroxidase (HRP) Diluent. Contains 0.05% Proclin®
1 bottle
300 ; 25 ml per bottle. 1 bottle 1 bottle 3 bottles Wash Buffer Concentrate (25x); 100 ml per
1 bottle
bottle. Stabilized Chromogen, Tetramethylbenzidine (TMB); 25 ml per
1 bottle
bottle. Stop Solution; 25 ml per bottle.
1 bottle
Plate Covers, adhesive strips
3
3.12.2 ELISA Protocol The ELISA test was performed according to the manufacturer‟s instructions.
All reagents were allowed to reach room temperature before use and all liquid reagents were gently mixed prior to use. -
50 μL of the Standard Diluent Buffer was added to zero wells. Well(s) reserved for chromogen blank should be left empty.
-
50 μL of standards, samples or controls were added to the appropriate microtiter wells
36 -
50 μL of biotinylated anti-IL-8 (Biotin Conjugate) Solution was pipetted into each well except the chromogen blank(s). Tap gently on the side of the plate to mix.
-
Plate was covered with a plate cover and incubated for 1 hour and 30 minutes at room temperature.
-
Solution was thoroughly aspirated or decanted from wells and discarded the liquid then wells were washed 4 times.
-
100 μL Streptavidin-HRP Working Solution was added to each well except the chromogen blank(s).
-
Plate was covered with a plate cover and incubated for 30 minutes at room temperature.
-
Solution was thoroughly aspirated or decanted from wells and discarded the liquid then wells were washed 4 times.
-
100 μL of Stabilized Chromogen was added to each well. The liquid in the wells began to turn blue.
-
Then it was incubated for 30 minutes at room temperature in the dark.
-
100 μL of Stop Solution was added to each well. Tap side of plate gently to mix. The solution in the wells should change from blue to yellow.
-
The absorbance of each well was read at 450 nm having blanked the plate reader against a chromogen blank composed of 100 μL each of Stabilized Chromogen and Stop Solution.
-
Finally, a graph was drawn according to the results of absorbance.
3.13 Statistical analysis
The Chi-square test with Yates correction and the Fisher exact test were used for the analysis of data. Significance was defined as P value of 85%, irrespective of the disease state or ethnicity. The cagPAI was shown to be divided into 2 regions the 5‟ (cag-II) region and the 3‟ (cag-I) region. The cag-II region encompasses the genes from the left to the right 5-18 and the cagT gene while the cag-I region encompasses the genes from the left to the right cagP, cagO, cagM, cagN, cagL, cagI, cagH, cagG, cagF, cagE, cagD, cagC, cagB, and cagA (Kidd et al. 2001). Among these several genes of the cag-I region mainly cagE, cagM and cagA and few genes of the cag-II region in particular the cagT gene were mostly studied (Kidd et al. 2001, Kauser et al. 2004). In this study the selection of the cagPAI genes (cagM, cagE, cagA) was based on the fact that these genes span the entire cag-I region from the left to the right side and we included only the cagT gene of the cag-II region since its absence was shown to be an indicator for the deletion of the entire cag-II region. It was reported earlier that the entire cag-II region was found deleted in 23% of gastritis isolates and 8% of peptic ulceration isolates (Kidd et al. 2001). In addition, the function of these genes were mostly studied and reported by other investigators (Kauser et al. 2004, Kidd et al. 2001). We found out that isolates with intact cagPAI were more frequently associated with DU while partial deletions were detected more frequently among isolates from
67 62 gastritis patients. Kidd et al. (2001) indicated that the functionally important elements of the cag-I region (cagA and cagM) were present in the majority of strains, irrespective of the disease status. In one study it was shown that 96% of isolates had deletions in the cag-II region while 59% had deletions in the cag-I region. A 97% of isolates from patients with peptic ulceration and 92% from patients with gastric adenocarcinoma were cagT+ compared to 64% of isolates from patients with gastritis. These results suggest that the presence of a cagT may be an alternate marker for the cag-II region (Kidd et al. 2001). The role of the cagPAI in the induction of IL-8 was also studied. Mizushima et al. (2002) reported that strains with partially deleted cagPAI had reduced IL-8 induction despite the presence of cagE, which is essential for IL-8 induction. Nilsson et al. (2003) showed that the presence of an intact cagPAI correlates with the induction of IL-8 production in AGS cells while partial deletions render the organism less pathogenic. Coculture of AGS cells with intact cagPAI isolates secreted more IL-8 than those with partial or complete deletion of the cagPAI. Nguyen et al. (2010) in their study on Vietnamese patients found out those H. pylori isolates with partially deleted cagPAI lack the ability to induce IL-8 secretion and the hummingbird phenotype in gastric cells. Previous studies showed that the intactness of the cagPAI correlates significantly with the induction of IL-8 and that strains with partially deleted cagPAI had reduced IL-8 secretion. We have found in our study that strains with an intact cagPAI induced more IL-8 secretion than partially deleted strains. Also the presence of cagA gene appeared to be an important factor in the induction of IL-8 as compared to cagA-negative strains. CagA was shown to be a key determinant for the induction of NF-kB activation during H. pylori infection (Brandt et al., 2005; Kim et al., 2006) H. pylori infection of epithelial cells induces the production of various chemokines, including IL-8, and that much of this induction depends on a functional cagA gene (El-Etr et al., 2004; Guillemin et al., 2002). Suzuki et al. (2009) indicated that CagA-induced IL-8 mRNA expression and protein production depended on the presence of the tyrosineindependent motifs (CRPIA) in a long-term H. pylori infection (up to 24 h). Kim et al. (2006) reported that there is a direct CagA effect on IL-8 induction by gastric epithelial cells.
68 63 In conclusion, we found that the intactness of the cagPAI in isolates from gastritis patients, DU and GU patients is not conserved. The possession of the cagA gene appeared to play an important role in the induction of IL-8 and the morphological changes of the AGS cells. An increase in the number of the EPIYA-C motifs had noticeable effect on the formation of the hummingbird phenotype. The possession of the cagPAI genes was also found to play an important role in the pathogenesis of DU but not GU or gastritis. Higher deletion frequencies of the cagT and cagM did not seem to affect the induction of morphological changes of the AGS cells.
69
REFERENCES
Acosta, N., A. Quiroga, et al. (2010). "Helicobacter pylori CagA protein polymorphisms and their lack of association with pathogenesis." World J Gastroenterol 16(31): 3936-43. Amieva, M. R., R. Vogelmann, et al. (2003). "Disruption of the epithelial apicaljunctional complex by Helicobacter pylori CagA." Science 300(5624): 1430-4. Angelini, A., T. Tosi, et al. (2009). "Expression of Helicobacter pylori CagA domains by library-based construct screening." FEBS J 276(3): 816-24. Argent, R. H., J. L. Hale, et al. (2008). "Differences in Helicobacter pylori CagA tyrosine phosphorylation motif patterns between western and East Asian strains, and influences on interleukin-8 secretion." J Med Microbiol 57(Pt 9): 1062-7. Argent, R. H., M. Kidd, et al. (2004). "Determinants and consequences of different levels of CagA phosphorylation for clinical isolates of Helicobacter pylori." Gastroenterology 127(2): 514-23. Argent, R. H., Y. Zhang, et al. (2005). "Simple method for determination of the number of Helicobacter pylori CagA variable-region EPIYA tyrosine phosphorylation motifs by PCR." J Clin Microbiol 43(2): 791-5. Atherton, J. C. (1998). "H. pylori virulence factors." Br Med Bull 54(1): 105-20. Atherton, J. C. and M. J. Blaser (2009). "Coadaptation of Helicobacter pylori and humans: ancient history, modern implications." J Clin Invest 119(9): 2475-87. Backert, S. and T. F. Meyer (2006). "Type IV secretion systems and their effectors in bacterial pathogenesis." Curr Opin Microbiol 9(2): 207-17. Backert, S., S. Moese, et al. (2001). "Phosphorylation of tyrosine 972 of the Helicobacter pylori CagA protein is essential for induction of a scattering phenotype in gastric epithelial cells." Mol Microbiol 42(3): 631-44. Backert, S. and M. Naumann (2010). "What a disorder: proinflammatory signaling pathways induced by Helicobacter pylori." Trends Microbiol 18(11): 479-86.
64
70 65
Backert, S., T. Schwarz, et al. (2004). "Functional analysis of the cag pathogenicity island in Helicobacter pylori isolates from patients with gastritis, peptic ulcer, and gastric cancer." Infect Immun 72(2): 1043-56. Backert, S. and M. Selbach (2008). "Role of type IV secretion in Helicobacter pylori pathogenesis." Cell Microbiol 10(8): 1573-81. Backert, S., N. Tegtmeyer, et al. (2010). "The versatility of Helicobacter pylori CagA effector protein functions: The master key hypothesis." Helicobacter 15(3): 16376. Backert, S., E. Ziska, et al. (2000). "Translocation of the Helicobacter pylori CagA protein in gastric epithelial cells by a type IV secretion apparatus." Cell Microbiol 2(2): 155-64. Baggiolini, M., B. Moser, et al. (1994). "Interleukin-8 and related chemotactic cytokines. The Giles Filley Lecture." Chest 105(3 Suppl): 95S-98S. Baghaei, K., L. Shokrzadeh, et al. (2009). "Determination of Helicobacter pylori virulence by analysis of the cag pathogenicity island isolated from Iranian patients." Dig Liver Dis 41(9): 634-8. Bauer, B., S. Moese, et al. (2005). "Analysis of cell type-specific responses mediated by the type IV secretion system of Helicobacter pylori." Infect Immun 73(8): 464352. Bijlsma, J. J., B. Waidner, et al. (2002). "The Helicobacter pylori homologue of the ferric uptake regulator is involved in acid resistance." Infect Immun 70(2): 60611. Blomstergren, A., A. Lundin, et al. (2004). "Comparative analysis of the complete cag pathogenicity island sequence in four Helicobacter pylori isolates." Gene 328: 85-93. Bourzac, K. M. and K. Guillemin (2005). "Helicobacter pylori-host cell interactions mediated by type IV secretion." Cell Microbiol 7(7): 911-9. Brandt, S., T. Kwok, et al. (2005). "NF-kappaB activation and potentiation of proinflammatory responses by the Helicobacter pylori CagA protein." Proc Natl Acad Sci U S A 102(26): 9300-5. Cendron, L., M. Couturier, et al. (2009). "The Helicobacter pylori CagD (HP0545, Cag24) protein is essential for CagA translocation and maximal induction of interleukin-8 secretion." J Mol Biol 386(1): 204-17.
71 66 Censini, S., C. Lange, et al. (1996). "cag, a pathogenicity island of Helicobacter pylori, encodes type I-specific and disease-associated virulence factors." Proc Natl Acad Sci U S A 93(25): 14648-53. Cornelis, G. R. and H. Wolf-Watz (1997). "The Yersinia Yop virulon: a bacterial system for subverting eukaryotic cells." Mol Microbiol 23(5): 861-7. Couturier, M. R., E. Tasca, et al. (2006). "Interaction with CagF is required for translocation of CagA into the host via the Helicobacter pylori type IV secretion system." Infect Immun 74(1): 273-81. Covacci, A. (2000). "Helicobacter pylori pathogenicity: the bacterium and the host." Eur J Gastroenterol Hepatol 12(9): 1050-2. Covacci, A., J. L. Telford, et al. (1999). "Helicobacter pylori virulence and genetic geography." Science 284(5418): 1328-33. Desaphy, J. F., A. De Luca, et al. (2004). "Different flecainide sensitivity of hNav1.4 channels and myotonic mutants explained by state-dependent block." J Physiol 554(Pt 2): 321-34. Eaton, K. A., D. Kersulyte, et al. (2001). "Role of Helicobacter pylori cag region genes in colonization and gastritis in two animal models." Infect Immun 69(5): 2902-8. El-Etr, S. H., A. Mueller, et al. (2004). "Phosphorylation-independent effects of CagA during interaction between Helicobacter pylori and T84 polarized monolayers." J Infect Dis 190(8): 1516-23. Fan, X., S. E. Crowe, et al. (1998). "The effect of class II major histocompatibility complex expression on adherence of Helicobacter pylori and induction of apoptosis in gastric epithelial cells: a mechanism for T helper cell type 1mediated damage." J Exp Med 187(10): 1659-69. Fock, K. M. and T. L. Ang (2010). "Epidemiology of Helicobacter pylori infection and gastric cancer in Asia." J Gastroenterol Hepatol 25(3): 479-86. Fujikawa, A., D. Shirasaka, et al. (2003). "Mice deficient in protein tyrosine phosphatase receptor type Z are resistant to gastric ulcer induction by VacA of Helicobacter pylori." Nat Genet 33(3): 375-81. Galan, J. E. and A. Collmer (1999). "Type III secretion machines: bacterial devices for protein delivery into host cells." Science 284(5418): 1322-8. Guillemin, K., N. R. Salama, et al. (2002). "Cag pathogenicity island-specific responses of gastric epithelial cells to Helicobacter pylori infection." Proc Natl Acad Sci U S A 99(23): 15136-41.
72 67 Hatakeyama, M. (2004). "Oncogenic mechanisms of the Helicobacter pylori CagA protein." Nat Rev Cancer 4(9): 688-94. Hatakeyama, M. (2006). "The role of Helicobacter pylori CagA in gastric carcinogenesis." Int J Hematol 84(4): 301-8. Hatakeyama, M. (2008). "Linking epithelial polarity and carcinogenesis by multitasking Helicobacter pylori virulence factor CagA." Oncogene 27(55): 7047-54. Hatakeyama, M. (2008). "[Oncogenic mechanism of Helicobacter pylori]." Nihon Rinsho Meneki Gakkai Kaishi 31(3): 132-40. Hatakeyama, M. (2008). "SagA of CagA in Helicobacter pylori pathogenesis." Curr Opin Microbiol 11(1): 30-7. Hatakeyama, M. (2009). "Helicobacter pylori and gastric carcinogenesis." J Gastroenterol 44(4): 239-48. Higashi, H., R. Tsutsumi, et al. (2002). "Biological activity of the Helicobacter pylori virulence factor CagA is determined by variation in the tyrosine phosphorylation sites." Proc Natl Acad Sci U S A 99(22): 14428-33. Higashi, H., R. Tsutsumi, et al. (2002). "SHP-2 tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA protein." Science 295(5555): 683-6. Ishikawa, S., T. Ohta, et al. (2009). "Stability of Helicobacter pylori CagA oncoprotein in human gastric epithelial cells." FEBS Lett 583(14): 2414-8. Jafari, F., L. Shokrzadeh, et al. (2008). "vacA genotypes of Helicobacter pylori in relation to cagA status and clinical outcomes in Iranian populations." Jpn J Infect Dis 61(4): 290-3. Jimenez-Soto, L. F., S. Kutter, et al. (2009). "Helicobacter pylori type IV secretion apparatus exploits beta1 integrin in a novel RGD-independent manner." PLoS Pathog 5(12): e1000684. Jones, K. R., Y. M. Joo, et al. (2009). "Polymorphism in the CagA EPIYA motif impacts development of gastric cancer." J Clin Microbiol 47(4): 959-68. Kanada, R., T. Uchida, et al. (2008). "Genotyping of the cagA gene of Helicobacter pylori on immunohistochemistry with East Asian CagA-specific antibody." Pathol Int 58(4): 218-25. Kauser, F., A. A. Khan, et al. (2004). "The cag pathogenicity island of Helicobacter pylori is disrupted in the majority of patient isolates from different human populations." J Clin Microbiol 42(11): 5302-8.
73 68 Kawamura, O., M. Murakami, et al. (2003). "Relationship between gastric disease and deletion of cag pathogenicity island genes of Helicobacter pylori in gastric juice." Dig Dis Sci 48(1): 47-53. Keates, A. C., S. Tummala, et al. (2008). "Helicobacter pylori infection stimulates plasminogen activator inhibitor 1 production by gastric epithelial cells." Infect Immun 76(9): 3992-9. Kidd, M., A. J. Lastovica, et al. (2001). "Conservation of the cag pathogenicity island is associated with vacA alleles and gastroduodenal disease in South African Helicobacter pylori isolates." Gut 49(1): 11-7. Kim, S. S., V. E. Ruiz, et al. (2011). "Helicobacter pylori in the pathogenesis of gastric cancer and gastric lymphoma." Cancer Lett. Kranzer, K., L. Sollner, et al. (2005). "Impact of Helicobacter pylori virulence factors and compounds on activation and maturation of human dendritic cells." Infect Immun 73(7): 4180-9. Kumar, S., A. Kumar, et al. (2010). "Diversity in the cag pathogenicity island of Helicobacter pylori isolates in populations from North and South India." J Med Microbiol 59(Pt 1): 32-40. Kurashima, Y., N. Murata-Kamiya, et al. (2008). "Deregulation of beta-catenin signal by Helicobacter pylori CagA requires the CagA-multimerization sequence." Int J Cancer 122(4): 823-31. Kusters, J. G., A. H. van Vliet, et al. (2006). "Pathogenesis of Helicobacter pylori infection." Clin Microbiol Rev 19(3): 449-90. Kwok, T., D. Zabler, et al. (2007). "Helicobacter exploits integrin for type IV secretion and kinase activation." Nature 449(7164): 862-6. Leunk, R. D., P. T. Johnson, et al. (1988). "Cytotoxic activity in broth-culture filtrates of Campylobacter pylori." J Med Microbiol 26(2): 93-9. Lim, J. W. and H. Kim (2011). "Role of protease-activated receptor-2 on cell death and DNA fragmentation in Helicobacter pylori-infected gastric epithelial cells." J Transl Med 8: 85. Lim, J. W., K. H. Kim, et al. (2009). "alphaPix interacts with Helicobacter pylori CagA to induce IL-8 expression in gastric epithelial cells." Scand J Gastroenterol 44(10): 1166-72. Lima, V. P., M. A. de Lima, et al. (2010). "The relationship between Helicobacter pylori genes cagE and virB11 and gastric cancer." Int J Infect Dis 14(7): e613-7.
74 69 Lima, V. P., I. J. Silva-Fernandes, et al. (2011). "Prevalence of Helicobacter pylori genotypes (vacA, cagA, cagE and virB11) in gastric cancer in Brazilian's patients: An association with histopathological parameters." Cancer Epidemiol. Matteo, M. J., G. Granados, et al. (2007). "Helicobacter pylori cag pathogenicity island genotype diversity within the gastric niche of a single host." J Med Microbiol 56(Pt 5): 664-9. McClain, M. S., C. L. Shaffer, et al. (2009). "Genome sequence analysis of Helicobacter pylori strains associated with gastric ulceration and gastric cancer." BMC Genomics 10: 3. Mimuro, H., T. Suzuki, et al. (2002). "Grb2 is a key mediator of Helicobacter pylori CagA protein activities." Mol Cell 10(4): 745-55. Mizushima, T., T. Sugiyama, et al. (2002). "Decreased adherence of cagG-deleted Helicobacter pylori to gastric epithelial cells in Japanese clinical isolates." Helicobacter 7(1): 22-9. Moese, S., M. Selbach, et al. (2004). "Helicobacter pylori induces AGS cell motility and elongation via independent signaling pathways." Infect Immun 72(6): 36469. Monstein, H. J., A. Karlsson, et al. (2010). "Application of PCR amplicon sequencing using a single primer pair in PCR amplification to assess variations in Helicobacter pylori CagA EPIYA tyrosine phosphorylation motifs." BMC Res Notes 3: 35. Murata-Kamiya, N. (2011). "Pathophysiological functions of the CagA oncoprotein during infection by Helicobacter pylori." Microbes Infect. Murata-Kamiya, N., K. Kikuchi, et al. (2010). "Helicobacter pylori exploits host membrane phosphatidylserine for delivery, localization, and pathophysiological action of the CagA oncoprotein." Cell Host Microbe 7(5): 399-411. Muyskens, J. B. and K. Guillemin (2011). "Helicobacter pylori CagA Disrupts Epithelial Patterning by Activating Myosin Light Chain." PLoS One 6(3): e17856. Nguyen, L. T., T. Uchida, et al. (2008). "Helicobacter pylori virulence and the diversity of gastric cancer in Asia." J Med Microbiol 57(Pt 12): 1445-53. Nguyen, L. T., T. Uchida, et al. (2010). "Clinical relevance of cagPAI intactness in Helicobacter pylori isolates from Vietnam." Eur J Clin Microbiol Infect Dis 29(6): 651-60.
75 70 Nilius, M., G. Bode, et al. (1994). "Adhesion of Helicobacter pylori and Escherichia coli to human and bovine surface mucus cells in vitro." Eur J Clin Invest 24(7): 454-9. Nilsson, C., A. Sillen, et al. (2003). "Correlation between cag pathogenicity island composition and Helicobacter pylori-associated gastroduodenal disease." Infect Immun 71(11): 6573-81. Nishiya, D., T. Shimoyama, et al. (2004). "Genes inside the cagPAI of Helicobacter pylori are not associated with gastric cancer in Japan." Hepatogastroenterology 51(57): 891-4. Odenbreit, S., J. Puls, et al. (2000). "Translocation of Helicobacter pylori CagA into gastric epithelial cells by type IV secretion." Science 287(5457): 1497-500. Oldani, A., M. Cormont, et al. (2009). "Helicobacter pylori counteracts the apoptotic action of its VacA toxin by injecting the CagA protein into gastric epithelial cells." PLoS Pathog 5(10): e1000603. Pacheco, A. R., J. L. Proenca-Modena, et al. (2008). "Involvement of the Helicobacter pylori plasticity region and cag pathogenicity island genes in the development of gastroduodenal diseases." Eur J Clin Microbiol Infect Dis 27(11): 1053-9. Panayotopoulou, E. G., D. N. Sgouras, et al. (2011). "CagA and VacA polymorphisms are associated with distinct pathological features in Helicobacter pylori-infected adults with peptic ulcer and non-peptic ulcer disease." J Clin Microbiol 48(6): 2237-9. Pansegrau, W. and E. Lanka (1996). "Enzymology of DNA transfer by conjugative mechanisms." Prog Nucleic Acid Res Mol Biol 54: 197-251. Patra, R., S. Chattopadhyay, et al. "Intact cag pathogenicity island of Helicobacter pylori without disease association in Kolkata, India." Int J Med Microbiol 301(4): 293-302. Pattis, I., E. Weiss, et al. (2007). "The Helicobacter pylori CagF protein is a type IV secretion chaperone-like molecule that binds close to the C-terminal secretion signal of the CagA effector protein." Microbiology 153(Pt 9): 2896-909. Peek, R. M., Jr., H. P. Wirth, et al. (2000). "Helicobacter pylori alters gastric epithelial cell cycle events and gastrin secretion in Mongolian gerbils." Gastroenterology 118(1): 48-59.
76 71 Perez, H. A., A. E. Escudero Millan, et al. (2004). "[Risk factors associated to upper gastrointestinal bleeding in non intensive care units]." Rev Fac Cien Med Univ Nac Cordoba 61(2): 7-12. Poppe, M., S. M. Feller, et al. (2007). "Phosphorylation of Helicobacter pylori CagA by c-Abl leads to cell motility." Oncogene 26(24): 3462-72. Queiroz, D. M., R. P. Cunha In Memoriam, et al. (2010). "Helicobacter pylori virulence factors as tools to study human migrations." Toxicon. Reyes-Leon, A., J. C. Atherton, et al. (2007). "Heterogeneity in the activity of Mexican Helicobacter pylori strains in gastric epithelial cells and its association with diversity in the cagA gene." Infect Immun 75(7): 3445-54. Rieder, G., J. L. Merchant, et al. (2005). "Helicobacter pylori cag-type IV secretion system facilitates corpus colonization to induce precancerous conditions in Mongolian gerbils." Gastroenterology 128(5): 1229-42. Salih, B. A., B. K. Bolek, et al. (2010). "DNA sequence analysis of cagA 3' motifs of Helicobacter pylori strains from patients with peptic ulcer diseases." J Med Microbiol 59(Pt 2): 144-8. Schmidt, H. M., K. L. Goh, et al. (2009). "Distinct cagA EPIYA motifs are associated with ethnic diversity in Malaysia and Singapore." Helicobacter 14(4): 256-63. Schmidt, H. M., S. Andres, et al. (2010). "The cag PAI is intact and functional but HP0521 varies significantly in Helicobacter pylori isolates from Malaysia and Singapore." Eur J Clin Microbiol Infect Dis 29(4): 439-51. Schneider, S., C. Weydig, et al. (2008). "Targeting focal adhesions:Helicobacter pylorihost communication in cell migration." Cell Commun Signal 6: 2. Selbach, M., S. Moese, et al. (2002). "Src is the kinase of the Helicobacter pylori CagA protein in vitro and in vivo." J Biol Chem 277(9): 6775-8. Selbach, M., S. Moese, et al. (2003). "The Helicobacter pylori CagA protein induces cortactin dephosphorylation and actin rearrangement by c-Src inactivation." EMBO J 22(3): 515-28. Sgouras, D. N., E. G. Panayotopoulou, et al. (2009). "CagA and VacA polymorphisms do not correlate with severity of histopathological lesions in Helicobacter pylori-infected Greek children." J Clin Microbiol 47(8): 2426-34. Shokrzadeh, L., K. Baghaei, et al. (2010). "Analysis of 3'-end variable region of the cagA gene in Helicobacter pylori isolated from Iranian population." J Gastroenterol Hepatol 25(1): 172-7.
77 72 Sicinschi, L. A., P. Correa, et al. (2010). "CagA C-terminal variations in Helicobacter pylori strains from Colombian patients with gastric precancerous lesions." Clin Microbiol Infect 16(4): 369-78. Sugimoto, M., Y. Yamaoka, et al. (2010). "Influence of interleukin polymorphisms on development of gastric cancer and peptic ulcer." World J Gastroenterol 16(10): 1188-200. Suzuki, M., H. Mimuro, et al. (2009). "Helicobacter pylori CagA phosphorylationindependent function in epithelial proliferation and inflammation." Cell Host Microbe 5(1): 23-34. Takata, S., M. Ito, et al. (2009). "Pathogenetic role of the tyrosine-phosphorylated CagA EPIYA sequence of Helicobacter pylori in histological gastritis in Japanese patients." J Gastroenterol 44(5): 405-11. Terradot, L. and G. Waksman (2011). "Architecture of the Helicobacter pylori Cag-type IV secretion system." FEBS J 278(8): 1213-22. Truong, B. X., V. T. Mai, et al. (2009). "Diverse characteristics of the CagA gene of Helicobacter pylori strains collected from patients from southern vietnam with gastric cancer and peptic ulcer." J Clin Microbiol 47(12): 4021-8. Viala, J., C. Chaput, et al. (2004). "Nod1 responds to peptidoglycan delivered by the Helicobacter pylori cag pathogenicity island." Nat Immunol 5(11): 1166-74. Waugh, D. J. and C. Wilson (2008). "The interleukin-8 pathway in cancer." Clin Cancer Res 14(21): 6735-41. Wen, S. and S. F. Moss (2009). "Helicobacter pylori virulence factors in gastric carcinogenesis." Cancer Lett 282(1): 1-8. Wessler, S. and S. Backert (2008). "Molecular mechanisms of epithelial-barrier disruption by Helicobacter pylori." Trends Microbiol 16(8): 397-405. Xia, Y., Y. Yamaoka, et al. (2009). "A comprehensive sequence and disease correlation analyses for the C-terminal region of CagA protein of Helicobacter pylori." PLoS One 4(11): e7736. Xiang, Z., S. Censini, et al. (1995). "Analysis of expression of CagA and VacA virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that CagA is not necessary for expression of the vacuolating cytotoxin." Infect Immun 63(1): 94-8.
78 73 Xu, S., C. Zhang, et al. (2010). "Effector prediction in host-pathogen interaction based on a Markov model of a ubiquitous EPIYA motif." BMC Genomics 11 Suppl 3: S1. Yamaoka, Y. (2009). "Helicobacter pylori typing as a tool for tracking human migration." Clin Microbiol Infect 15(9): 829-34. Yamaoka, Y., H. M. El-Zimaity, et al. (1999). "Relationship between the cagA 3' repeat region of Helicobacter pylori, gastric histology, and susceptibility to low pH." Gastroenterology 117(2): 342-9. Yamaoka, Y., M. Kita, et al. (1997). "Induction of various cytokines and development of severe mucosal inflammation by cagA gene positive Helicobacter pylori strains." Gut 41(4): 442-51. Yamaoka, Y., T. Kodama, et al. (1999). "Relation between clinical presentation, Helicobacter pylori density, interleukin 1beta and 8 production, and cagA status." Gut 45(6): 804-11. Zaidi, S. F., K. Ahmed, et al. (2009). "Effect of resveratrol on Helicobacter pyloriinduced interleukin-8 secretion, reactive oxygen species generation and morphological changes in human gastric epithelial cells." Biol Pharm Bull 32(11): 1931-5. Zhang, Y., H. Takeuchi, et al. (2009). "Relationship of IL-8 production and the CagA status in AGS cells infected with Helicobacter pylori exposed to low pH and activating transcription factor 3 (ATF3)." Microbiol Res 164(2): 180-90.
