Helper T Cell Type 1 and 2 Cytokines Regulate C-C Chemokine ...

Helper T Cell Type 1 and 2 Cytokines Regulate C-C Chemokine Expression in Mouse Pleural Mesothelial Cells KAMAL A. MOHAMMED, NAJMUNNISA NASREEN, MELISSA J. WARD, and VEENA B. ANTONY Division of Pulmonary and Critical Care Medicine, Department of Medicine, Veterans Affairs Medical Center, Indiana University School of Medicine, Indianapolis, Indiana

The recruitment of leukocytes to an area of injury or inflammation site is one of the most fundamental host defenses. Pulmonary tuberculosis is characterized by granulomatous inflammation with an extensive infiltration of mononuclear cells. In tuberculous pleurisy pleural mesothelial cells are exposed to mycobacteria in the pleural space. In this study we demonstrate that mouse pleural mesothelial cells (PMCs), when stimulated with BCG or IFN-g, produced MIP-1a and MCP-1 in vitro. IFN-g enhanced the BCG-mediated MIP-1a and MCP-1 expression in a concentration-dependent manner. The RT-PCR studies also confirmed that both BCG and IFN-g induce chemokine expression. IL-4 inhibited the BCG-mediated MIP-1a and MCP-1 expression in a concentration-dependent manner. The lower concentrations of IL-4 were ineffective; however, at higher concentrations, the inhibitory effect of IL-4 persisted for 24 h and decreased thereafter. BCG stimulation resulted in an increase of IFN-g and IL-4 receptors on PMCs. Our results demonstrate that Th1 and Th2 cytokines may regulate the C-C chemokine expression in PMCs and thus play a biologically important role in mononuclear cell recruitment to the pleural space. Mohammed KA, Nasreen N, Ward MJ, Antony VB. Helper T cell type 1 and 2 cytokines regulate C-C chemokine expression in mouse pleural mesothelial cells. AM J RESPIR CRIT CARE MED 1999;159:1653–1659.

Tuberculosis remains the leading infectious cause of mortality in the world (1). Tuberculous pleural effusions occur in approximately 30% of patients with tuberculosis (2). Tuberculosis is a chronic mycobacterial infection caused by Mycobacterium tuberculosis (MTB); it is characterized morphologically by the formation of granulomas, compact organized collections of cells in infected tissues (3) that protect the host by sequestering invading microbes. MTB infection results in chronic inflammation characterized by the migration of mononuclear cells to the site of infection (4). Macrophage inflammatory protein 1a (MIP-1a) and monocyte chemoattractant protein 1 (MCP-1) (C-C chemokines) are chemotactic for mononuclear cells. MIP-1a, a low molecular weight heparinbinding protein, is known to exert chemotactic and activating effects on phagocytic mononuclear cells (5). MCP-1 is an 8.7kD protein, and has specific chemoattractant and activating activity for monocytes under inflammatory conditions (5). Cytokines secreted by T cells after antigenic stimulation are the determinants of T cell function. On the basis of functional heterogeneity and their predominant cytokine secretion

(Received in original form October 5, 1998 and in revised form December 15, 1998) Supported in part by grants NIH RO1 AI 37454-03 and NIH RO1 AI 41877-02 from the National Institutes of Health. Correspondence and requests for reprints should be addressed to Veena B. Antony, M.D., Veterans Affairs Medical Center, 1481 West 10th Street, 111-P, Indianapolis, IN 46202. E-mail: [email protected]. Am J Respir Crit Care Med Vol 159. pp 1653–1659, 1999 Internet address: www.atsjournals.org

profiles, CD41 helper T (Th) cells have been subdivided into Th1 and Th2 subpopulations. Th1 cells secrete interleukin 2 (IL-2), interferon g (IFN-g), and lymphotoxin and are responsible for the delayed-type hypersensitivity (DTH) reaction, whereas Th2 cells secrete IL-4, IL-5, IL-6, and IL-10 and render B cell help (6). Th1 and Th2 responses are reciprocally cross-regulated by IFN-g, which inhibits Th2 (7), and IL-10, which inhibits the Th1 response (8). Mesothelial cells are metabolically active cells that line the pleura in a continuous monolayer. Chemokine synthesis is induced in various cells by inflammatory stimuli. Pleural mesothelial cells were observed to produce C-C chemokines on stimulation by inflammatory mediators (9, 10); however, the mechanisms of their regulation in MTB infection are still undefined. Studies have attempted to draw a correlation between disease resistance/susceptibility and Th1/Th2 responses, respectively, in parasitic infections (11). However, the extent to which the helper cytokine subsets regulate the inflammatory process is yet to be determined. To delineate whether Th1 and Th2 cytokines have any regulatory role in pleural mesothelial cell (PMC) chemokine expression we probed the effect of IFN-g and IL-4 on PMC chemokine expression in the presence of heat-killed bacillus Calmette-Guérin (BCG) in vitro. In the present study we demonstrate that when mouse pleural mesothelial cells are stimulated in vitro with heatkilled BCG, they express MIP-1a and MCP-1 mRNA and release the protein in a time-dependent manner. IFN-g has an additive effect on the BCG-stimulated C-C chemokine response in PMCs whereas IL-4 has an inhibitory effect. The BCG stimulation resulted in an increase in IFN-g and IL-4 re-

1654

AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE

ceptors on the PMCs. These observations suggest that pleural mesothelial cell production of MIP-1a and MCP-1 is influenced by the Th1 and Th2 cytokines and thus the mononuclear cell migration into the pleural space may also be regulated by their effects.

METHODS Animals, Antibodies, and Reagents C57BL/6 female mice, 6 wk old, were purchased from Harlan Sprague Dawley (Indianapolis, IN) and used in this study. Also purchased were penicillin and streptomycin for cell culture, nonspecific rat IgG (Sigma Chemical Co., St. Louis, MO), rat anti-mouse IFN-g receptor antibody, rat anti-mouse IL-4 receptor antibody, goat anti-rat IgG conjugated to fluorescein isothiocyanate (FITC) (PharMingen, San Diego, CA), bacillus Calmette-Guérin (American Type Culture Collection [ATCC], Rockville, MD), F12K medium (GIBCO Laboratories, Grand Island, NY), and fetal bovine serum (FBS; Harlan Sprague Dawley).

Isolation and Characterization of Mouse Pleural Mesothelial Cells PMCs were obtained by collagenase digestion of visceral and parietal pleura (12). The cells were suspended in F12K culture medium containing 10% FBS and a combination of penicillin (100 U/ml) and streptomycin (100 mg/ml). The cells were plated in 75-cm2 culture flasks and incubated overnight at 378 C in a 5% CO2 atmosphere. The next day nonadherent cells were removed. The medium was changed three times weekly thereafter. The cells grew to confluence in approximately 7–14 d. The mesothelial cells were characterized by the presence of classic cobblestone morphology (13), the absence of factor VIII antigen, and the presence of cytokeratin (14). All cells were used between the second and fourth passages.

Antigenic MIP-1a and MCP-1 Production In Vitro To evaluate the concentration-dependent effect of IFN-g and IL-4 on PMC chemokine expression, PMCs (0.5 3 106/ml) were incubated in the presence of heat-killed BCG (1 3 106 CFU), along with varying concentrations of recombinant mouse IFN-g (50, 100, 250, 500, and 1,000 U/ml) and recombinant mouse IL-4 (5, 10, 20, 40, 80 ng/ml), for 24 h in serum-free medium at 378 C and 5% CO2. The PMC culture medium was collected for MIP-1a and MCP-1 estimation by enzymelinked immunosorbent assay (ELISA), and the cells were saved for total RNA extraction for reverse transcriptase-mediated polymerase chain reaction (RT-PCR). PMCs were also incubated in serum-free medium, in the presence of BCG, BCG 1 IFN-g (500 U/ml), or BCG 1 IL-4 (40 ng/ml), at 378 C in 5% CO2. The cultures were terminated at different time points (6, 12, 24, and 48 h), supernatants were collected, and MIP-1a and MCP-1 levels were measured by sandwich ELISA.

Antigenic MIP-1a and MCP-1 Analysis in PMC Culture Fluids MIP-1a and MCP-1 levels in the PMC culture supernatant were estimated by a sandwich ELISA (Quantikine; R&D Systems, Minneapolis, MN). The procedure followed was that suggested by the manufacturer. Briefly, 50-ml aliquots of PMC culture medium were added to 96-well microtiter plates, coated previously with anti-chemokine polyclonal antibody, and incubated at room temperature (RT) for 2 h. The wells were blocked with 2% bovine serum albumin (BSA) in phosphate-buffered saline (PBS). The chemokines were detected by incubation with peroxidase-conjugated MIP-1a- or MCP-1-specific antibodies at RT for 2 h. The microtiter plates were rinsed with PBS–Tween 20 (0.05% Tween 20 in PBS) and developed with substrate o-phenylenediamine (OPD) plus H2O2. The color intensity was measured at 450 nm with an ELISA reader. The minimum detectable levels of the assay were , 1.5 pg/ml for MIP-1a and , 2.0 pg/ml for MCP-1.

Isolation of RNA and Reverse Transcriptase-mediated Polymerase Chain Reaction Total cellular RNA was isolated from PMCs by using Tri-reagent as reported earlier (10). One microgram of total RNA was reverse tran-

VOL 159

1999

scribed into cDNA. The first strand of cDNA was synthesized in a total volume of 20 ml in the presence of 5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 1 mM dNTPs, RNase inhibitor (1 U/ml), 15 mM primer, and murine leukemia virus (MuLV) reverse transcriptase (2.5 U/ml; Perkin-Elmer Cetus, Norwalk, CT). The reverse transcription was conducted at 428 C for 15 min and the reaction was stopped by incubation at 998 C for 5 min. The cDNA was then amplified using specific primers for mouse b-actin as control. Primers for amplification were synthesized by the phosphoroamidite method with a Beckman (Fullerton, CA) 200 A synthesizer, and they were found to be specific for the chemokine tested and not for any other chemokine family member. The primers used were 59 GGTCGTACCACAGGCATTGTG 39 (sense) and 59 GCAATGCCTGGGTACATGGTG 39 (antisense) for b-actin, 59 GCTTCTCCTACAGCCGGAAG 39 (sense) and 59 ACTCTCAGGCAATCAGTTCCAG 39 (antisense) for MIP-1a (GenBank accession no. M19382), and 59 GTCTCTGTCACGCTTCTGG 39 (sense) and 59 GATCTCTCTCTTGAGCTTGG 39 (antisense) for MCP-1 (GenBank accession no. M57441). The PCR was performed with 5 ml of RT product in a reaction mixture containing 2 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.30), specific oligonucleotide primers (15 mM), and 2.5 U of Taq DNA polymerase (Perkin-Elmer Cetus). The samples were amplified in a thermal cycler (GeneAmp PCR system 9600; Perkin-Elmer Cetus), preheated for 90 s at 958 C. Amplification required 30 cycles, each cycle consisted of denaturation at 958 C for 15 s, primer annealing at 588 C for 30 s, and extension at 728 C for 30 s. (For MIP-1a the annealing and extension were carried out at 648 C for 30 s.) The amplification products were analyzed by agarose gel electrophoresis and their identities were initially confirmed after sequence determination.

Detection of IFN-g and IL-4 Receptor Expression by Flow Cytometry The mesothelial cells were stimulated with heat-killed BCG (1 3 106 CFU/ml) for varying times at 378 C, in a 5% CO2 atmosphere. PMCs stimulated with lipopolysaccharide (LPS) served as positive control. The PMCs were trypsinized and washed three times in PBS with 2.5% BSA and 5 mM sodium azide and incubated for 45 min at 48 C, either in presence of rat anti-mouse IFN-g receptor (IFN-gR) or IL-4 receptor (IL-4R) monoclonal antibody (1 mg/106 cells) or rat IgG isotype. Cells were washed three times and incubated with goat anti-rat IgG– FITC conjugate to detect the antibody bound to the antigen. After incubations the cells were washed three times and fixed in 4% paraformaldehyde. The fluorescence associated with the cells was analyzed by flow cytometry using a FACStar (Becton Dickinson Immunocytometry Systems, Mountain View, CA). Fluorescence data were presented on a log scale and the relative fluorescence intensity was reported by comparing their light scatter characteristics with those of normal cells analyzed in the same experiment.

Statistical Analysis The significance of differences between experimental and control group means was tested with a two-tailed Student’s t test. The difference between group means was tested by Kruskal–Wallis one-way analysis of variance on ranks. A p value , 0.05 was considered significant.

RESULTS Activated PMCs Release C-C Chemokines In Vitro

When PMCs (0.5 3 106/ml) were stimulated with BCG or with BCG 1 IFN-g, they released MIP-1a and MCP-1 antigenic protein in a time-dependent manner (Figures 1A and 1B). At all time points (6 to 48 h), stimulated mesothelial cells released significantly higher (p , 0.001) amounts of MIP-1a and MCP-1 when compared with unstimulated control cultures. The maximal response, seen at 24 h, plateaued thereafter. At all time points studied, cells stimulated with IFN-g and BCG together produced higher levels of chemokine than when stimulated with either IFN-g or BCG alone. Addition of IL-4 in-

Mohammed, Nasreen, Ward, et al.: Chemokine Regulation in Mesothelial Cells

1655

Figure 1. Th1 and Th2 cytokine-mediated regulation of bacillus Calmette-Guérin (BCG)-induced MIP-1a, (A) and MCP-1 (B); production in pleural mesothelial cells. Data at each time point are means 6 SE of six independent experiments. *p , 0.001, †p , 0.05 versus unstimulated cultures (control).

hibited the BCG-induced chemokine response until 24 h; thereafter the inhibitory effect of IL-4 disappeared. BCG Mediates C-C Chemokine mRNA Expression in PMCs

Figures 2A and 2B shows the expression of MIP-1a and MCP-1 mRNA in PMCs treated with BCG, BCG 1 IFN-g, or BCG 1 IL-4 as demonstrated by RT-PCR. BCG alone and BCG 1 IFN-g induced MIP-1a and MCP-1 expression. However, BCG and IFN-g together caused higher mRNA expression. Addition of recombinant mouse IL-4 to the BCG-stimulated cultures resulted in inhibition of the chemokine expression. IFN-g Upregulates BCG-mediated C-C Chemokine Expression in a Concentration-dependent Manner

Figure 3A shows that IFN-g upregulated BCG-induced chemokine expression in mouse pleural mesothelial cells. IFN-g was ineffective at lower concentrations, but at higher concentrations IFN-g potentiated BCG-mediated expression of MIP-1a and MCP-1. IFN-g at 50 U/ml did not induce any significant enhancement; however, at 100 U/ml a marginal increase was noticed. With IFN-g at 250 U/ml the MIP-1a and MCP-1 response significantly increased to 7,496 6 245 and 5,864 6 167 pg/ml, respectively. The MIP-1a and MCP-1 response reached a maximum of 9,147 6 208 and 6,959 6 192 pg/ml, respectively, at 1,000 U/ml. The MIP-1a response was relatively higher than the MCP-1 response. IFN-g was more effective in enhanc-

Figure 2. IFN-g- and IL-4-mediated regulation of bacillus Calmette-Guérin (BCG)-induced expression of MIP-1a and MCP-1 mRNA in pleural mesothelial cells. (A and B) MIP-1a- and MCP-1specific amplification products, respectively, on agarose gels stained with ethidium bromide. Results are representative of four independent experiments. b-Actin served as positive control for the RT-PCR. Lane 1, molecular weight (HaeIII) markers; lane 2, unstimulated; lane 3, BCG exposed; lane 4, BCG 1 IFN-g exposed; lane 5, BCG 1 IL-4 exposed.

ing the chemokine response at higher concentrations. MIP-1a and MCP-1 mRNA expression was also increased at higher concentrations of IFN-g (Figures 4A and 4B). IL-4 Downregulates BCG-mediated Chemokine Expression in PMCs in a Concentration-dependent Manner

BCG alone induced a maximum of 6,279 6 151 and 5,029 6 146 pg/ml of MIP-1a and MCP-1, respectively. IL-4 at low concentration (5 ng/ml) did not cause significant inhibition; however, at 10 ng/ml it significantly inhibited MIP-1a (4,987 6 204 pg/ml) and MCP-1 (3,878 6 185 pg/ml) production (Figure 3B). The MIP-1a and MCP-1 response further declined at an IL-4 concentration of 20 ng/ml. At a 40-ng/ml concentration of IL-4, the MIP-1a and MCP-1 response decreased to 1,489 6 289 and 1,172 6 178 pg/ml, respectively. The MIP-1a and MCP-1 response was further decreased to 1,108 6 169 and 967 6 195 pg/ml, respectively, at an 80-ng/ml concentration of IL-4.

1656


Figure 3. Regulation of bacillus Calmette-Guérin (BCG)-induced MIP-1a and MCP-1 production by (A) IFN-g and (B) IL-4 in pleural mesothelial cells. PMCs were incubated in the presence of varying concentrations of either IFN-g or IL-4 along with BCG for 24 h. Results are means 6 SE of six independent experiments. *p , 0.001, † p , 0.05 versus unstimulated cultures (control).

The difference between the inhibitory effect of 40- and 80-ng/ ml concentrations of IL-4 was insignificant. IL-4 affected BCG-induced chemokine mRNA expression in mouse PMCs (Figures 5A and 5B). At low concentrations IL-4 did not demonstrate any inhibition of PMC chemokine expression. However, at higher concentrations IL-4 inhibited BCG-mediated MIP-1a and MCP-1 mRNA expression. BCG Stimulates IFN-g and IL-4 Receptor Expression in PMCs

PMCs were stimulated with LPS to induce IFN-g and IL-4 receptor expression as a positive control for comparison with BCG-mediated receptor expression. Resting pleural mesothelial cells expressed low levels of IFN-g and IL-4 receptors. When PMCs were stimulated with BCG a significant increase in both IFN-gR and IL-4R was noted (Figure 6). BCG stimulated IFN-gR and IL-4R receptor expression in a time-dependent manner (data not shown). Maximum expression was noticed after 24 h, and the response plateaued thereafter.

DISCUSSION Pleuropulmonary tuberculosis is the most common infectious cause of pleural effusions in several parts of the world. The

VOL 159

1999

Figure 4. Regulation of bacillus Calmette-Guérin (BCG)-induced MIP-1a and MCP-1 mRNA expression by IFN-g in pleural mesothelial cells. (A and B) MIP-1a- and MCP-1-specific amplification products, respectively, on agarose gels stained with ethidium bromide. Results are representative of four independent experiments. b-Actin served as positive control for RT-PCR. Lane 1, molecular weight (HaeIII) markers; lane 2, BCG stimulated; lane 3, BCG 1 IFN-g (50 U/ml) stimulated; lane 4, BCG 1 IFN-g (100 U/ml) stimulated; lane 5, BCG 1 IFN-g (250 U/ml) stimulated; lane 6, BCG 1 IFN-g (500 U/ml) stimulated; lane 7, BCG 1 IFN-g (1,000 U/ml) stimulated.

pleural space is lined with a monolayer of mesothelial cells and PMCs are the first cells to encounter organisms invading the pleural space. Mycobacterial infection results in granulomatous inflammation with a predominant accumulation of mononuclear phagocytes (4). Pleural effusions due to tuberculosis are characterized by the presence of mononuclear cells (15). MIP-1a and MCP-1 are chemotactic for mononuclear phagocytes (5). The recruitment of monocytes to the site of inflammation is crucial to the perpetuation of the inflammatory response. Several locally generated chemokines are responsible for the movement of inflammatory cells from the vascular compartment into the pleural space. In earlier studies we demonstrated that stimulated pleural mesothelial cells release C-C and C-X-C chemokines (9, 10). The chemokines released by PMCs are responsible in part for initiating the inflammatory response that recruits mononuclear cells to the pleural space. The current investigation demonstrates in vitro that Th1derived cytokine IFN-g and the Th2-derived cytokine IL-4 have a regulatory role in MIP-1a and MCP-1 expression in mouse pleural mesothelial cells. Heat-killed mycobacteria were found to enhance MIP-1a and MCP-1 expression in mouse PMCs, and the addition of IL-4 resulted in inhibition of this response. The inhibitory response of IL-4 was concentration dependent. IL-4 at lower concentrations was not effective; however, at 20 ng/ml it significantly inhibited BCG-medi-


Figure 5. Regulation of bacillus Calmette-Guérin (BCG)-induced MIP-1a and MCP-1 mRNA expression by IL-4 in pleural mesothelial cells. (A and B) MIP-1a- and MCP-1-specific amplification products, respectively, on agarose gels stained with ethidium bromide. Results are representative of four independent experiments. b-Actin served as positive control for RT-PCR. Lane 1, molecular weight (HaeIII) markers; lane 2, BCG-stimulated PMCs; lane 3, BCG 1 IL-4 (5 ng/ml) stimulated; lane 4, BCG 1 IL-4 (10 ng/ml) stimulated; lane 5, BCG 1 IL-4 (20 ng/ml) stimulated; lane 6, BCG 1 IL-4 (40 ng/ml) stimulated; lane 7, BCG 1 IL-4 (80 ng/ml) stimulated.

ated chemokine expression. The chemokine response was increased further when PMCs were incubated in presence of IFN-g together with BCG. IFN-g potentiated the chemokine response in a concentration-dependent manner. BCG also induced IFN-g and IL-4 receptor expression on PMCs. Th1 and Th2 cells are known to develop from a common precursor and if the primary stimulation of CD41 cells is accompanied by IL-4, a Th2 cytokine switch is elicited (16); on the other hand, the presence of IL-12 favors the Th1 cell phenotype (17). Evidence suggests that antigen priming in a large population of lymphocytes results into three predominant types of cells: Th1, Th2, and a third type, Th0, which contributes by providing lymphokines of both mature subsets (18). Mycobacterial antigens elicits Th1 effector function (19); in contrast, HIV infection leads to a shift from the Th1 to Th2 cytokine response (20). C-C chemokines are recognized as important mediators in a variety of inflammatory states (5). Mesothelial cells, on activation, produce C-C chemokines (9, 10). The mechanisms whereby the pleural mesothelial responses are regulated in pleural tuberculosis remain unknown. When PMCs were stimulated in vitro with PCG they produced MIP-1a and MCP-1 in a time-dependent manner (Figures 1A and 1B). These observations were further supported by enhanced chemokine mRNA expression as demonstrated by RT-PCR. The chemokine release was detectable as early as 6 h and lasted for up to 48 h. Phagocytosis of M. tuberculosis induced MCP-1 (21) and IL-8 (22) expression in monocytic cells. Mycobacterium tuberculosis induced MIP-1a and MCP-1 production in monocytes and

1657

alveolar macrophages (23), and C-C and C-X-C chemokine levels were elevated in the bronchoalveolar fluid of patients with tuberculosis (24). Besides, the infection of murine macrophages with M. tuberculosis was found to induce chemokine expression (25), which suggests that mycobacteria are capable of inducing chemokine expression. IFN-g is a pleiotropic cytokine secreted by natural killer (NK) and T cells, and it has been found to be essential for the development of protective cell-mediated immunity to tuberculous mycobacterial pathogens. When PMCs were incubated with IFN-g along with BCG an additive effect was noticed in the chemokine response. The additive effect of IFN-g was concentration dependent (Figure 3A). Higher concentrations of IFN-g were more effective in potentiating the chemokine response. This enhanced response was also confirmed at the mRNA level by RT-PCR studies (Figures 4A and 4B). In a similar study, IFN-g was found to potentiate the C-C and C-X-C chemokine expression in peripheral blood monocytes and neutrophils (26). At the site of M. tuberculosis infection, elicited mononuclear cells can become activated and synthesize a number of potent mediators with autocrine and paracrine effector activities (27). Mycobacterium tuberculosis stimulated IFN-g production in human peripheral blood lymphocytes (19). IFN-g was detected in pleural fluid from patients with tuberculosis and IFN-g was selectively concentrated 5- to 30fold in the pleural fluid, compared with blood from the same patients (27). This indicates that in tuberculous pleuritis the IFN-g levels may exceed physiological levels in the pleural compartment. Besides, M. tuberculosis cell wall components were found to enhance IFN-g production in pleural fluid mononuclear cells (19). Thus IFN-g released in response to mycobacterial infection may also amplify the PMC production of MIP-1a and MCP-1. In our studies, addition of IL-4 to BCG-stimulated PMC cultures resulted in a lower yield of chemokines when compared with PMC cultures that were stimulated with BCG alone (Figure 3B). RT-PCR studies also reveal a clear decrease in specific mRNA. Studies have demonstrated that IL-4 destroys the mRNA of inflammatory cytokines at the posttranscriptional level (28). Our results by RT-PCR also suggest that IL-4 inhibits MIP-1a and MCP-1 mRNA expression in a concentration-dependent manner (Figures 5A and 5B). The lower concentration of IL-4 was ineffective in decreasing the chemokine mRNA. The suppressive effect of IL-4 was time dependent, and at 48 h IL-4 lost its inhibitory effect. Other studies have demonstrated that IL-4 downregulates IL-1b and TNF-a in peripheral blood monocytes in inflammatory bowel disease in a dose-dependent manner (29). In human synovial fibroblats IL-4 downregulated and IFN-g enhanced the TNF-a- and IL-b-induced expression of RANTES (30). Besides, IFN-g enhanced MCP-1 expression in renal cortical epithelial cells (31), and in neutrophils it enhanced the LPSmediated expression of MIP-1a, MIP-b, and IL-8 (26). Thus, in several cell types other than PMCs, Th1- and Th2-derived cytokines were found to regulate chemokine expression. In general, the IFN-g receptor is expressed on cell surfaces at low levels; however, certain tumor cell lines such as EL-4 exhibit high levels of IFN-g receptors without stimulation. To delineate the mode of action of IFN-g and IL-4 on BCGinduced chemokine expression, we examined their respective functional receptor expression on PMCs. Flow cytometry studies demonstrated that resting PMCs express moderate amounts of IFN-g and IL-4 receptors. When PMCs were stimulated with BCG, both IFN-g and IL-4 receptor expression was increased significantly, suggesting that BCG, apart from potentiating MIP-1a and MCP-1, was also inducing cytokine receptor expression (Figure 6). Other bacteria, such as Sta-

1658


VOL 159

1999

Figure 6. IFN-g and IL-4 receptor expression in PMCs after 24 h of exposure. Flow cytometric analysis of resting PMCs (serum-free media) and of BCG- or LPS-stimulated PMCs was done with a control nonbinding antibody (isotype), a monoclonal anti-IFN-g receptor (IFN-gR) antibody, or an anti-IL-4 receptor (IL4R) antibody. The horizontal axis measures the surface density of the antigen on a log scale; the vertical axis measures the cell number.

phylococcus aureus, have been reported to increase IL-4 receptor expression in B cells (32). In mice, the lack of a functional IFN-g receptor resulted in an altered cytokine (TNF-a, IL-1a, and IL-6) response to BCG infection, and the IFN-g receptor was found to be essential for the recovery of mice from BCG infection (33). IFN-g enhances IL-4 receptor expression in a murine macrophage cell line and bone marrow-derived macrophages (34), and IL-4 enhances IL-4 receptor expression in resting T and B cells (35). Once the cytokines bind to their respective receptors they are rapidly internalized. As the PMCs express both IFN-g and IL-4 receptors in significant numbers, it may be construed that IFN-g and IL-4, by binding to their receptors on PMCs, are modulating the chemokine expression in PMCs. However, at the later time period (48 h), although the IL-4 receptor was still present, the inhibitory effect of IL-4 was diminished as indicated by protein and mRNA levels. This could be due to inactivation of IL-4 during the longer incubation period in vitro, or it may be due to its rapid metabolism in cells. The significance of this study is that in tuberculous pleuritis mycobacteria induce chemokine release from the mesothelium, resulting in the initiation of pleural inflammation and

subsequent recruitment of mononuclear phagocytes to the pleural space. Pleural mesothelial cell expression of MIP-1a and MCP-1 in mycobacterial infection is regulated, in part, by Th1 and Th2 cytokines and the progress of the pleural infection is likely to depend on the relative levels of Th1 and Th2 cytokines present in the milieu of the pleural space. Acknowledgment : The authors acknowledge the help of Diana L. Baxter (Medical Media, Veterans Affairs Medical Center) for photographic work.

References 1. Bloom, B. R., and C. M. Murray. 1992. Tuberculosis: commentary on reemergent killer. Science 25:1055–1064. 2. Ferrer Sancho, J. 1996. Pleural tuberculosis: incidence, pathogenesis, diagnosis, and treatment. Curr. Opin. Pulm. Med. 2(4):327–334. 3. Dannenberg, A. M., Jr., and G. A. W. Rock. 1994. Pathogenesis of pulmonary tuberculosis: an interplay of tissue damaging and macrophage-activating immune responses—dual mechanisms that control bacillary multiplication. In B. R. Bloom, editor. Tuberculosis: Pathogenesis, Control and Protection. ASM Press, Washington DC. 459–484. 4. Sibille, Y., and H. Y. Reynolds. 1990. Macrophages and polymorphonuclear neutrophils in lung defense and injury. Am. Rev. Respir. Dis. 141: 471–501. 5. Oppenheim, J. J., C. O. Zachariae, N. Mukaida, and K. Matsushima.


6.

7.

8.

9.

10.

11.

12.

13.

14.

15. 16. 17.

18.

19.

20.

1991. Properties of the novel proinflammatory supergene intercrine cytokine family. Annu. Rev. Immunol. 9:617–648. Mosman, T. R., and R. L. Coffman. 1987. Two types of mouse helper T cell clone: implications for immune regulations. Immunol. Today 8: 223–227. Gajewski, T. F., and F. W. Fitch. 1988. Anti-proliferative effect of IFN-g in immune regulation: I. IFN-g inhibits the proliferation of Th2 but not Th1 murine helper T lymphocyte clones. J. Immunol. 140:4245– 4252. Mosman, T. R., and K. W. Morre. 1991. The role of IL-10 in cross regulations of Th1 and Th2 responses. Immunoparasitol. Today 12:A49– A53. Antony, V. B., J. W. Hott, S. L. Kunkel, S. W. Godbey, M. D. Burdick, and R. M. Strieter. 1995. Pleural mesothelial cell expression of C-C (monocyte chemotactic peptide) and C-X-C (interleukin-8) chemokines. Am. J. Repsir. Cell Mol. Biol. 12:581–588. Nasreen, N., D. L. Hartman, K. A. Mohammed, and V. B. Antony. 1998. Talc induced expression of C-C and C-X-C chemokines and intercellular adhesion molecule-1 in mesothelial cells. Am. J. Respir. Crit. Care Med. 158:971–978. Scott, P., P. Natovitz, R. L. Coffman, E. Pearce, and A. Sher. 1988. Immunoregulation of cutaneous leishmaniasis: T-cell lines that transfer protective immunity or exacerbation belong to different T helper subsets and respond to distinct parasite antigens. J. Exp. Med. 168:1675– 1684. Bermudez, E., J. Everitt, and C. Walker. 1990. Expression of growth factor and growth factor receptor RNA in rat pleural mesothelial cells in culture. Exp. Cell Res. 190:91–98. Andrews, P. M., and K. R. Porter. 1973. The ultrastructural morphology and possible functional significance of mesothelial microvilli. Anat. Rec. 177:409–426. Connell, N. D., and J. G. Rheinwald. 1983. Regulation of cytoskeleton in mesothelial cells: reversible loss of keratin and increase in vimentin during rapid growth in culture. Cell 34:245–253. Kamholz, S. L. 1996. Pleural tuberculosis. In W. N. Rom and S. M. Garay, editors. Tuberculosis. Little, Brown & Co., Boston. 483–491. Trinchieri, G. 1993. Interleukin-12 and its role in the generation of Th1 cells. Immunol. Today 14:335–338. Swain, S. L., A. D. Weinberg, M. English, and G. Huston. 1994. IL-4 directs the development of Th-2 like helper effectors. J. Immunol. 145: 3796–3806. Manetti, R., P. Parronchi, M. G. Guidizi, M. P. Piccinni, E. Maggi, G. Trinchieri, and S. Romagnani. 1993. Natural killer cell stimulatory factor interleukin-12 induces T helper type-1 (Th1)-specific immune responses and inhibits the development of IL-4 producing Th cells. J. Exp. Med. 177:1199–1204. Robinson, D. S., S. Ying, I. K. Taylor, A. Wangoo, D. M. Mitchell, A. B. Kay, Q. Hamid, and R. J. Shaw. 1994. Evidence for a Th1-like bronchoalveolar T-cell subset and predominance of interferon-gamma gene activation in pulmonary tuberculosis. Am. J. Respir. Crit. Care Med. 149:989–993. Klein, S. A., J. M. Dobmeyer, T. S. Dobmeyer, M. Pape, O. G. Ottmann, E. B. Helm, D. Hoelzer, and R. Rossol. 1997. Demonstration of the Th1 to Th2 cytokine shift during the course of HIV-1 infection using cytoplasmic cytokine detection on single cell level by flow cytometry. AIDS 11(9):1111–1118.

1659

21. Friedland, J. S., R. J. Shattock, and G. E. Griffin. 1993. Phagocytosis of Mycobacterium tuberculosis or particulate stimuli by human monocytic cells induces equivalent monocyte chemotactic protein-1 gene expression. Cytokine 5(2):150–156. 22. Friedland, J. S., D. G. Remick, R. Shattock, and G. E. Griffin. 1992. Secretion of interleukin-8 following phagocytosis of Mycobacterium tuberculosis by human monocyte cell lines. Eur. J. Immunol. 22:1373– 1378. 23. Sadek, M. I., E. Sada, Z. Toossi, S. K. Schwander, and E. A. Rich. 1998. Chemokines induced by infection of mononuclear phagocytes with mycobacteria and present in lung alveoli during active pulmonary tuberculosis. Am. J. Respir. Cell Mol. Biol. 19:513–521. 24. Kurashima, K., N. Mukaida, M. Fujimura, M. Yasui, Y. Nakazumi, T. Matsuda, and K. Matsushima. 1997. Elevated chemokine levels in bronchoalveolar lavage fluid in tuberculosis patients. Am. J. Respir. Crit. Care Med. 155:1474–1477. 25. Rhoades, E. R., A. M. Cooper, and I. M. Orme. 1995. Chemokine response in mice infected with Mycobacterium tuberculosis. Infect. Immun. 63(10):3871–3877. 26. Kunkel, S. L. 1996. Th1 and Th2 type cytokines regulate chemokine expression. Biol. Signals 5:197–202. 27. Barnes, P. F., S. J. Fong, P. J. Brennan, P. E. Twomey, A. Mazumdar, and R. L. Modlin. 1990. Local production of tumor necrosis factor and IFN-g in tuberculous pleuritis. J. Immunol. 145:149–154. 28. Wang, P., P. Wu, M. I. Siegel, R. W. Egan, and M. M. Billah. 1995. Interleukin (IL)-10 inhibits nuclear factor kappa B (NF-kappa B) activation in human monocytes. IL-10 and IL-4 suppress cytokines synthesis by different mechanisms. J. Biol. Chem. 270(16):9558–9563. 29. Schreiber, S., T. Heinig, U. Panzer, R. Reinking, A. Bouchard, P. D. Stahl, and A. Raedler. 1995. Impaired response of activated mononuclear phagocytes to interleukin-4 in inflammatory bowel disease. Gastroenterology 108(1):21–33. 30. Rathnaswami, P., M. Hachicha, T. J. Schall, and S. R. McColl. 1993. Expression of the cytokines RANTES in human rheumatoid synovial fibroblasts. Differential regulation of RANTES and interleukin-8 genes by inflammatory cytokines. J. Biol. Chem. 268(8):5834–5839. 31. Schmouder, R. L., R. M. Strieter, and S. L. Kunkel. 1993. Interferongamma regulation of human renal cortical epithelial cell-derived monocyte chemotactic peptide-1. Kidney Int. 44(1):43–49. 32. Degiannis, D., N. Hornung, D. Luke-Gustites, J. Raskova, and K. Raska, Jr. 1993. IL-4 receptor expression by SAC-activated B-lymphocytes: its role in B-cell proliferation and the effect of cylcosporine, prednisolone and verapamil. Int. J. Immunopharmacol. 15(7):829–832. 33. Kamijo, R., J. Le, D. Shapiro, E. A. Havell, S. Huang, M. Aguet, M. Bosland, and J. Vilcek. 1993. Mice that lack the interferon-gamma receptor have profoundly altered responses to infection with bacillus Calmette-Guérin and subsequent challenge with lipopolysaccharide. J. Exp. Med. 178(4):1435–1440. 34. Feldman, G. M., and D. S. Finbloom. 1990. Induction and regulation of IL-4 receptor expression on murine macrophage cell lines and bone marrow-derived macrophages by IFN-g. J. Immunol. 145(3):857–859. 35. Renz, H., J. Dominco, and E. W. Gelfand. 1991. IL-4 dependent up-regulation of IL-4 receptor expression in murine T and B cells. J. Immunol. 146(9):3049–3055.