Hepatitis B virus core protein inhibits Fas ... - The FASEB Journal

The FASEB Journal • Research Communication

Hepatitis B virus core protein inhibits Fas-mediated apoptosis of hepatoma cells via regulation of mFas/FasL and sFas expression Wei Liu,*,†,1 Yan-Ting Lin,*,1 Xiao-Li Yan,* Ya-Lan Ding,* Yun-Li Wu,*,† Wan-Nan Chen,*,† and Xu Lin*,†,2 *Key Laboratory of Ministry of Education for Gastrointestinal Cancer, School of Basic Medical Sciences, Fujian Medical University, Minhou, China; and †Key Laboratory of Tumor Microbiology, Department of Medical Microbiology, Fujian Medical University, Minhou, China Hepatitis B virus core protein (HBc) has been implicated in hepatocarcinogenesis through several mechanisms. Resistance of hepatitis B virus (HBV)infected hepatocytes to apoptosis is considered one of the major contributors to the progression of chronic hepatitis to cirrhosis and ultimately to hepatocellular carcinoma. The Fas receptor/ligand (Fas/FasL) system plays a prominent role in hepatocyte death during HBV infection. Here we report that HBc mediates resistance of hepatoma cells to agonistic anti-Fas antibody (CH11)induced apoptosis. When HBc was introduced into human hepatoma cells, the cells became resistant to CH11 cytotoxicity in a p53-dependent manner. HBc significantly down-regulated the expression of p53, total Fas, and membrane-bound Fas at the mRNA and protein levels and reduced FasL mRNA expression. In contrast, HBc upregulated the expression of soluble forms of Fas by increasing Fas alternative mRNA splicing. Mechanistically, HBc-mediated Fas alternative mRNA splicing was associated with up-regulation of polypyrimidine tract-binding protein 1 and down-regulation of Fas-activated serine/ threonine kinase. These results indicated that HBc may prevent hepatocytes from Fas-induced apoptosis by the dual effects of reducing the expression of the proapoptotic form of Fas and enhancing the expression of the antiapoptotic form of the receptor, which may contribute to the survival and persistence of infected hepatocytes during chronic infection.—Liu, W., Lin, Y.-T., Yan, X.-L., Ding, Y.-L., Wu, Y.-L., Chen, W.-N., Lin, X. Hepatitis B virus core protein inhibits Fas-mediated apoptosis of hepatoma cells via regulation of mFas/FasL and sFas expression. FASEB J. 29, 1113–1123 (2015). www.fasebj.org

ABSTRACT

Key Words: p53 • chronic HBV infection • PTBP1 • FASTK Abbreviations: CHAPS, 3-[(3-cholamido-propyl)-dimethylammonio]-1-propanesulfonate; FasL, Fas ligand; FASTK, Fasactivated serine/threonine kinase; HBc, hepatitis B virus core protein; HBV, hepatitis B virus; HCC, hepatocellular carcinoma; HEPES, 4-(2-hydroxyethyl)-1-piperazine ethanesulphonic acid; mFas, membrane-bound Fas; PFT-a, pifithrin-a; premRNA, precursor mRNA; PTBP, polypyrimidine tract-binding protein; sFas, soluble Fas; TIA-1, T-cell intracellular antigen 1; TIAR, TIA-1-related protein; TNFRSF, TNF receptor superfamily

0892-6638/15/0029-1113 © FASEB

HEPATITIS B VIRUS (HBV) infection remains a major health problem worldwide; ;350 million people are chronically infected with HBV and at a high risk of developing hepatitis, cirrhosis, and hepatocellular carcinoma (HCC) (1, 2). However, the molecular mechanisms underlying chronic HBV infection and its pathophysiological processes have not been completely understood. Recent studies have suggested that resistance of HBV-infected hepatocytes to apoptosis is one of major contributors to the development and progression of chronic hepatitis to cirrhosis and ultimately to HCC (3, 4). Apoptosis of hepatocytes during HBV infection is mainly mediated by signaling from members of the TNF protein family including TNF-a, Fas ligand (FasL), and TNF-related apoptosis-inducing ligand (TRAIL) (5, 6). Fas is one of the most prominent and best-characterized death receptors, which on binding of FasL, transmits cell death signals via the death adaptor molecule FADD, which mediates the activation of caspase-8 and subsequent activation of downstream effector caspases such as caspase-3 to trigger apoptosis (7). Similar to TNF-a, FasL induces apoptosis of hepatocytes in both normal liver and in various forms of liver disease. Primary human hepatocytes and liver cells in animal models are hypersensitive to apoptosis induced by FasL or the agonistic anti-Fas antibody (8). In addition to a membrane-bound FasL that mediates apoptosis by interacting with Fas on neighboring cells, Fas-mediated apoptosis may occur in an autocrine or paracrine fashion via a soluble form of the ligand that has been reported to be highly elevated in patients with HBV-related cirrhosis (8). Likewise, Fas has also been observed as a soluble molecules (sFas) in addition to its membrane-associated form (mFas) (9), implying a new layer of complexity in the mechanisms regulating apoptosis. sFas arises from alternatively spliced Fas mRNA, leading to proteins with deletions or disruptions of the single membrane-spanning domain (9). Serum sFas is elevated in patients with fulminant hepatitis B (10) and in cancer patients with HBsAg+ 1

These authors contributed equally to this work. Correspondence: Key Laboratory of Ministry of Education for Gastrointestinal Cancer, School of Basic Medical Sciences, Fujian Medical University, 1 Xueyuan Road, Minhou, Fujian 350108, China. E-mail: [email protected] doi: 10.1096/fj.14-263822 2

1113

hepatocellular carcinoma, systemic lupus erythematosus or B- and T-cell leukemia (11–13). The Fas/FasL apoptotic pathway is strictly controlled at both the receptor and intracellular signaling events. Several studies suggested that Fas transcriptional expression is regulated by p53 in hepatoma cells, and the cross-talk between the p53 and Fas-FasL pathways in modulating apoptosis is clinically important (14–17). A p53-responsive element has been identified within the first intron of the Fas gene, and 3 putative p53-responsive elements are located within the promoter (15). The role of p53 in HBV-dependent regulation of apoptosis remains unclear, and there is evidence that HBV X protein (HBx) regulation of apoptotic pathways can be p53 dependent and independent (18). HBV core protein (HBc) is the major capsid protein of the virus and self-assembles to form the subviral 30 to 32 nm nucleocapsid particles that package the viral polymerase and pregenomic RNA during RNA replication (19, 20). The 21 kDa HBc protein has been detected in both the nuclear and cytoplasmic compartments of hepatocytes infected by HBV (21). HBc is extremely immunogenic (22–24), and for this reason, it has been used for HBV vaccine development. However, HBc may also function as an important mediator of hepatocarcinogenesis through several mechanisms including repression of the human p53 gene via its E2F1 binding site (25). The aim of this study was to determine whether HBc is involved in modulating the Fas/FasL system apoptotic pathway. We report here that HBc inhibits antiFas CH11-induced apoptosis of HepG2 cells by downregulation of mFas and up-regulation of sFas expression. MATERIALS AND METHODS Cell lines and cell culture The human hepatoma cell lines HepG2 (wild-type p53), Huh-7 (mutant p53), and Hep3B (deficient p53) were cultured in DMEM (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum and maintained in a humidified atmosphere containing 5% CO2 at 37°C. Transfection was performed using Lipofectamine 2000 transfection reagent (Invitrogen) according to the manufacturer’s instructions. Plasmid constructs pcDNA3.1/Hygro(+)-HBc (pHBc) was constructed by inserting of a PCR-generated HBc gene (#56 HBV DNA was used as a template, GenBank accession no. AF100309) (26) into the HindIII and NotI sites (New England BioLabs, Beverly, MA, USA) of the plasmid pcDNA3.1/Hygro(+) (Invitrogen). The primers were as follows: forward, 59-CCCAAGCTTGCCACCATGGACATTGACCCGTATAAAGA-39; reverse, 59-ATAAGAATGCGGCCGCCTAACATTGAGATTCCCGA-39. Vector pGL4.10-Fas-activated serine/threonine kinase (FASTK) with the FASTK promoter driving firefly luciferase was constructed by ligating the PCR-generated full-length FASTK promoter (nucleotides 21812 to +108, relative to the transcription start site) into the BglII and HindIII (New England BioLabs) cleaved sites of the luciferase reporter plasmid pGL4.10 Vector (Promega, Madison, WI, USA). Genomic DNA from HepG2 cells was extracted using the DNAzol Reagent (Invitrogen) and used as a template for PCR amplification. The forward and reverse primers used were 59-GAAGATCTTGTGCCTCTCCAGCTCGGTA-39 and 59-CCCAAGCTTGACT CCCCGGGCCCTGCGCA-39, respectively.

1114

Vol. 29

March 2015

Generation of stable HBc-expressing hepatoma cell lines Huh7, HepG2, and Hep3B cells were transfected with pHBc or the empty control vector pcDNA3.1/Hygro(+) and selected in the presence of 400 mg/ml hygromycin for 4 wk. The hygromycinresistant clones were expanded together into cell lines and screened for the extent of HBc protein expression by Western blot analysis. Western blot analysis Cell lysates were prepared using RIPA protein lysis buffer (Pierce Company, Rockford, IL, USA) or the membrane protein extraction kit (Thermo Fisher Scientific, Waltham, MA, USA). A total of 40 mg of protein extracts were quantified and then subjected to electrophoresis on a 12% or 15% SDS-PAGE gel. The proteins were transferred to polyvinylidene difluoride membranes and blocked in Tris-buffered saline containing 5% bovine serum albumin. The specific antibodies used in this study included antiHBc (sc-23947, 1:500 dilution; Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti–b-tubulin (M20005L, 1:1000 dilution; Abmart, Shanghai, China), anti-p53 (K0181-3, 1:1000 dilution; MBL, Nagoya, Japan), anti-Fas/CD95 (MD-11-3, 1:200 dilution; MBL), anti–procaspase-3 (M097-3, 1:1000 dilution; MBL), anti-active caspase-3 (#9664,1:1000 dilution; Cell Signaling Technology, Beverly, MA, USA), anti-polypyrimidine tract-binding protein (PTBP1) (RN011P, recognizing the epitope of PTBP1 N-terminal 46–59 amino acids, 1:1000 dilution; MBL), anti-PTBP1 (#8776, recognizing the epitope of PTBP1 C-terminal residues surrounding Val338, 1:1000 dilution; Cell Signaling Technology), anti-PTBP2 (ab154787, 1:1000 dilution; Abcam, Cambridge, MA, USA), anti-PTBP3/ ROD1 (sc-100845, 1:500 dilution; Santa Cruz Biotechnology), anti-FASTK (PA5-21449, 1:1000 dilution; Thermo Scientific), anti–T-cell intracellular antigen 1 (TIA)1 (RN014P, 1:1000 dilution; MBL), and anti-TIAR (sc-1749, 1:500 dilution; Santa Cruz Biotechnology). Proteins were detected by addition of alkaline phosphatase-conjugated secondary antibody. Visualization of the immunoreactive proteins was performed by addition of CDP STAR reagents (Roche Diagnostics, Mannheim, Germany). The bands were detected by ImageQuant LAS 4000 mini (GE Healthcare, Waukesha, WI, USA). Intensities of band signals were quantified using the densitometric software Quantity One (Bio-Rad, Hercules, CA, USA), and the relative intensities to the internal control of b-tubulin were calculated. Treatment of cells with chemicals and antibodies Fas/CD95 receptor stimulation was performed using the agonistic monoclonal antibody anti-Fas CH11 (SY-001; MBL) at 0.5 mg/ml. To enhance anti-Fas CH11-induced apoptosis, cells were pretreated with the p53 inducer Bleomycin (B5507; SigmaAldrich, St. Louis, MO, USA) at 0.6 mg/ml. To inhibit apoptosis, cells were pretreated with a Fas/CD95 receptor antagonistic monoclonal antibody anti-Fas ZB4 (MD-11-3; MBL) at 1 mg/ml or 5 mM p53 inhibitor pifithrin-a (PFT-a; sc-45050; Santa Cruz Biotechnology). All pretreated cells were then treated with antiFas CH11 at 0.5 mg/ml for an additional 24 h. IgM (M079-3; MBL) was used as a control for anti-Fas CH11, and IgG (M075-3; MBL) was used as a control for anti-Fas ZB4. CCK-8 assay Cells were seeded into 96-well plates at 5 3 103 cells per well and cultured for 16 h. Different concentrations of anti-Fas CH11 (0, 0.1, 0.5, 1, and 5 mg/ml) were added to the medium, and cells were incubated for another 24 h. A Cell Counting Kit 8 (CCK-8; Donjindo, Kumamoto, Japan) was used to detect the viability of the different cell lines. The absorbance (A) at the wavelength of

The FASEB Journal x www.fasebj.org

LIU ET AL.

TABLE 1. Primers used for real-time and semiquantitative RT-PCR analysis in the study Primer name

For quantitative real-time PCR p53F p53R FasLF FasLR FASTKF FASTKR PTBP1F PTBP1R PTBP2F PTBP2R PTBP3F PTBP3R GAPDHF GAPDHR For semiquantitative RT-PCR P1 P2 P3 P4 P5

Sequences (59 → 39)

TAACAGTTCCTGCATGGGCGGC AGGACAGGCACAAACACGCACC GCAGCCCTTCAATTACCCAT CAGAGGTTGGACAGGGAAGAA CTGATTGTGCGTCGCTACCTC ACTGTACTTGCAGCGGGCAC CGGACCGTTTATCATGAGCA GAGCTTCCGGATGTGGATC AATGAAGAGATGGTTACGCCC GGCAAGTTGTGATTGGTTTCC CCATTGGATTTCCTCAAGCTA AGGTGATTGTGAGAGGACCAA TGCACCACCAACTGCTTAGC AGCTCAGGGATGACCTTGCC TGAAGGACATGGCTTAGAAGTG GGTGCAAGGGTCACAGTGTT TTGTGTGATGAAGGACATGGCT CTCTTCACCCAAACAATTAGTGGAA TCCTTTCTGTGCTTTCTGCATGT

450 nm was measured using a microplate reader (Bio-Tek, Winooski, VT, USA); cell viability (%) = (mean A value of the experimental group/mean A value of the control group) 3 100%.

Applications

For p53 amplification For FasL amplification For FASTK amplification For PTBP1 amplification For PTBP2 amplification For PTBP3 amplification For GAPDH amplification

For total Fas amplification For mFas amplification For sFas amplification, combined with P3

sFas and mFas mRNA levels were calculated as ratios of sFas or mFas PCR products signals over that of the GAPDH. Fas splicing assay

TUNEL assay Cells were seeded into 6-well plates at 5 3 105 cells per well and treated with proapoptotic chemicals or/and antibodies. Apoptotic cells were labeled using a DeadEnd Fluorometric TUNEL System kit (Promega) according to the manufacturer’s instructions. For quantification of apoptosis, 5 microscopic fields were randomly selected at high-power magnification (3200), and the average counts of TUNEL-positive cells were calculated under a fluorescence microscope (Zeiss, Oberkochen, Germany). Quantitative real-time PCR analysis Total RNA was extracted using the TRIzol reagent (Invitrogen) and transcribed to cDNA using an ExScript RT-PCR kit (Takara, Tokyo, Japan). Quantitative real-time PCR was performed in an Mx3000P Real-Time PCR System (Agilent Technologies, Palo Alto, CA, USA) with the SYBR Premix Ex TaqTM kit (Takara) following the manufacturer’s instructions. The GAPDH gene was used as the reference gene, and relative mRNA levels were calculated using the 22DDCt method. The paired forward and reverse primers are listed in Table 1. Semiquantitative RT-PCR analysis of mFas and sFas Transcribed cDNA was used as a template for PCR amplification. The paired primers P1 and P2 were used for total Fas amplification and P3 and P5 for mFas/sFas amplification; primers sequences are listed in Table1. PCR products were analyzed on a 2.5% agarose gel by electrophoresis and ethidium bromide staining. A digital image of the gel was obtained using a SynGene apparatus (SynGene, San Diego, CA, USA) and the SynGene GeneSnap software (version 4.00.00). Individual band intensities were quantitated using the densitometric software Quantity One (Bio-Rad Laboratories). The

HBc INHIBITS Fas-MEDIATED APOPTOSIS OF HEPATOCYTES

The Fas splicing reporter construct pCMV56-Fas with the human sequences of the Fas receptor from exon 5 to position 44 of exon 7 (Fas minigene) inserted into pCMV56 expression vector was kindly provided by Christopher W. J. Smith and J. Valca’rcel (27, 28). Cells were seeded into 6-well plates at 5 3 105 cells per well and transfected with 0.2 mg Fas splicing reporter alone or in combination with 0.6 mg/ml bleomycin. Forty-eight hours after transfection, total RNA was extracted using the TRIzol reagent (Invitrogen) and quantified by measuring the optical density at 260 nm after treatment with RNase-free DNaseI (Promega). One microgram of total RNA was reverse transcribed using primer PT2 and reverse transcriptase (Takara) in accordance with the manufacturer’s protocol. One tenth of the cDNA was amplified by PCR using oligonucleotides PT1 and PT2 (29). After 25 cycles, the products were analyzed on 2.5% agarose gels. Gels were scanned on a digital imaging system, and the band intensity was acquired. The primer sequences were as follows: PT1, 59-GTCGACGACACTTGCTCAAC-39; PT2, 59AAGCTTGCATCGAATCAGTAG-39. ELISA for sFas sFas in cell culture supernatants was detected using a human sFas ELISA Kit (R&D Systems, Minnesota, MN, USA) according to the manufacturer’s instructions. The absorbance of each well was measured at 450 nm using a microplate reader (Bio-Rad Laboratories). The concentration of sFas was calibrated from a dose-response curve based on reference standards. Caspase-3 activity assay Cytosolic extracts were prepared using lysis buffer (50 mM HEPES [4-(2-hydroxyethyl)-1-piperazine ethanesulphonic acid], pH 7.4, 5 mM CHAPS (3-[(3-cholamido-propyl)-dimethylammonio]-1-

1115

Figure 1. HBc transfection decreases the sensitivity of hepatoma cells to agonistic antiFas CH11-induced apoptosis. A) Expression of HBc in HepG2-pcDNA3.1 and HepG2-pHBc cells assessed by Western blot analysis. B) Cell viability determined by CCK-8 assay 24 h after HepG2-pcDNA or HepG2-pHBc cells were treated with increasing concentrations of antiFas CH11. Values are mean 6 SD, n = 5. C) TUNEL staining performed on HepG2-pcDNA or HepG2-pHBc cells treated with anti-Fas CH11 for 24 h with or without pretreatment with antagonistic anti-Fas ZB4. D) Quantification of apoptotic cells stained with TUNEL and expressed as the percentage of TUNEL-positive cells among the total number of HepG2pcDNA3.1 or HepG2-pHBc cells counted. Values are shown as the mean 6 SD, n = 5. *P , 0.05.

propanesulfonate), 5 mM DTT) and quantified by a Bradford Protein Assay Kit (Cat#23200; Thermo Fisher Scientific). Equal amounts of proteins were measured for their caspase-3 activity using a Caspase-3 activity Assay Kit (Cat#4800; MBL) according to the manufacturer’s instructions. This assay is based on the spectrophotometric detection of the chromophore, pNA, after cleavage from the Ac-DEVD-pNA substrate. The absorbance of each well was then measured at 405 nm using a microplate reader (BioTek). The activity of caspase-3 was calibrated from a dose-response curve based on reference standards. Dual-luciferase reporter assay HepG2-pcDNA3.1 or HepG2-pHBc cells were transfected with 0.2 mg pGL4.10-FASTK reporter plasmid and 0.2 mg of the Renilla luciferase expression vector pRL-TK. The cells were harvested 48 h after transfection. Intracellular luciferase activity was detected in 20 mg of cell lysate using the Dual-Luciferase Reporter Assay System (Promega) following the manufacturers’ recommendations. The firefly luciferase activity was normalized against the Renilla reniformis luciferase activity of the cotransfected pRL-TK to control for variations in transfection efficiency. The relative luciferase units were obtained by comparison with the pGL4.10-FASTK in HepG2-pcDNA3.1, which was set to 1. Luminescence measurement was carried out on a luminometer (Orion II Microplate Luminometer; Berthold Detection Systems, Pforzheim, Germany). Statistical analysis

transfected with empty vector pcDNA3.1/Hygro(+) or HBc-expressing pcDNA3.1-HBc, and tested their sensitivity to agonistic anti-Fas antibody CH11 known to kill cells by the process of apoptosis. The successful expression of HBc was confirmed by Western blot analysis using an antibody that detects the core antigen of HBV (Fig. 1A). A CCK-8 assay was used to determine whether the overexpression of HBc could modulate cellular sensitivity to CH11. The CH11 concentration-survival curves showed that HepG2 cells expressing HBc (HepG2-pHBc) were less sensitive to the cytotoxic effect of CH11 compared with the empty vector-transfected cells (HepG2-pcDNA3.1) (Fig. 1B). To determine whether the increased viability of HepG2-pHBc cells was due to less induction of apoptosis, we assessed the frequency of apoptotic cells using the TUNEL assay. As shown in Fig. 1C, D, a marginal but significant decrease in the number of apoptotic cells after CH11 treatment was observed in HepG2-pHBc population compared with the control HepG2-pcDNA3.1 (12.6 6 1.5% vs. 19.4 6 3.3%, P , 0.05). Notably, pretreatment with antagonistic antiFas ZB4 completely abolished the proapoptotic effects of CH11, and there was no significant difference in the apoptosis rate between HepG2-pHBc and HepG2-pcDNA3.1 cells (P . 0.05). These results indicate that HBc is able to decrease the sensitivity of HepG2 cells to CH11-induced apoptosis and likely to act as an inhibitor of Fas/FasLinduced apoptosis of hepatocytes.

The apoptosis rates were analyzed by a x2 test. mRNA and protein levels were analyzed by ANOVA.

HBc regulation of Fas-mediated apoptosis is p53 dependent

RESULTS HBc reduces the sensitivity of hepatoma cells to anti-Fas CH11-induced apoptosis To investigate the role of HBc as a regulator of apoptosis, we generated HepG2 (wild-type p53) sublines stably 1116

Vol. 29

March 2015

The Fas receptor was previously identified as a direct transcriptional target of p53 in a variety of cancer cell lines including hepatoma cells (14, 30). Therefore, we examined whether HBc inhibition on Fas-mediated apoptosis was through a p53-dependent mechanism by using 2


LIU ET AL.

Figure 2. Effect of HBc on Fas-mediated apoptosis is p53 dependent. A, B) Western blot analysis confirming the expression of HBc in Huh7 and Hep3B cells transfected with pHBc or the empty vector pcDNA3.1/Hygro(+). C, D) Cell viability determined by a CCK-8 assay 24 h after Huh7-pcDNA3.1 and Huh7-pHBc, or Hep3B-pcDNA3.1 and Hep3B-pHBc cells were treated with increasing concentrations of anti-Fas CH11. Values are mean 6 SD, n = 5. E) TUNEL staining performed on Huh7-pcDNA3.1 and Huh7-pHBc, or Hep3B-pcDNA3.1 and Hep3B-pHBc cells treated with anti-Fas CH11 for 24 h. F) Quantification of apoptotic cells stained with TUNEL and expressed as the percentage of the number of TUNEL-positive cells among the total number of Huh7pcDNA3.1, Huh7-pHBc, Hep3B-pcDNA3.1, or Hep3B-pHBc cells counted. Values are mean 6 SD, n = 5. G) TUNEL staining performed on HepG2-pcDNA3.1 or HepG2-pHBc cells treated with anti-Fas CH11 for 24 h with or without pretreatment with PFT-a or bleomycin. DMSO served as the vehicle control. H) Quantification of apoptotic cells stained with TUNEL and expressed as percentage of TUNEL-positive cells among the total number of HepG2-pcDNA3.1 or HepG2-pHBc cells counted. Values are shown as mean 6 SD, n = 5. *P , 0.05.

human hepatoma cell lines Huh7 and Hep3B, which represent p53 mutant (31) and p53 null (32) status, respectively. Huh7 and Hep3B cells were stably transfected with pcDNA3.1-HBc or control plasmid pcDNA3.1/ Hygro(+) and Western blotting analysis demonstrated that Huh7-pHBc and Hep3B-pHBc transfected with pcDNA3.1-HBc could steadily express HBc (Fig. 2A, B). Interestingly, in the absence of p53, CH11 treatment did not produce effective and differential cytotoxicity to either Huh7-pHBc or Hep3B-pHBc cells as determined by a CCK-8 assay (Fig. 2C, D) or TUNEL assay (Fig. 2E, F). To further ascertain the central role of p53 in Fas-mediated apoptosis, p53 wild-type HepG2-pcDNA3.1 and HepG2pHBc cells were treated with the p53 inhibitor PFT-a or the p53 inducer bleomycin followed by exposure to CH11 and then assayed by TUNEL staining. As expected, pretreatment with PFT-a fully abrogated CH11-induced apoptotic cell death regardless of the presence of HBc, whereas bleomycin substantially augmented the frequency of apoptotic cells with the effect being greater in the HepG2-pcDNA3.1 than the HepG2-pHBc cells (Fig. 2G, H). Taken together, these


results clearly indicated that reduction of Fas-mediated apoptosis by HBc was p53 dependent. HBc down-regulates the expression of p53, Fas, and FasL Given the observation that HBc attenuated CH11-induced and Fas-mediated apoptosis, which was dependent on p53, and that HBc could transcriptionally repress p53 expression (25), the relative expression of p53, Fas, and FasL in HepG2-pcDNA3.1 and HepG2-HBc cells on bleomycin treatment was quantified by qRT-PCR and Western blot analysis. Exposure of HepG2-pcDNA3.1 and HepG2-HBc cells to bleomycin resulted in enhanced expression of p53 at both the mRNA (Fig. 3A) and protein levels (Fig. 3B, C), indicating the effectiveness of the treatment. However, the augmentation was less pronounced in HepG2-pHBc cells compared with that in HepG2-pcDNA3.1 cells. Similar results were obtained with FasL and total Fas mRNA levels (Fig. 3D, E) and mFas at both the mRNA (Fig. 3F) and

1117

Figure 3. Effect of HBc on p53, mFas, and FasL expression. A) Quantitative real-time PCR analysis of p53 mRNA levels in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells. B) Representative Western blot showing the effect of HBc transfection on p53 protein levels with or without the influence of bleomycin. C) Histogram showing the mean level of the p53 protein determined from three independent experiments expressed as the fold change relative to that in untreated HepG2pcDNA3.1 control cells after normalization to b-tubulin. D) Quantitative real-time PCR analysis of FasL mRNA levels in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells. E) Quantitative real-time PCR analysis of total Fas mRNA levels in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells. Primer P1 is located in exon 3/4 of the Fas gene and primer P2 is located in exon 4. F) Quantitative real-time PCR analysis of mFas mRNA levels in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells. Primer P3 is located in exon 3/4 of Fas gene and primer P4 is located in exon 6. G) Representative Western blot showing the effect of HBc transfection on mFas protein levels with or without the influence of bleomycin. H) Histogram showing the mean level of the mFas protein determined from 3 independent experiments expressed as the fold change relative to that in untreated HepG2-pcDNA3.1 control cells after normalization to b-tubulin. *P , 0.05.

protein levels (Fig. 3G, H). The FasL protein was not detectable in HepG2 by Western blot analysis (data not shown). These data suggested that a major component of the effect of HBc on p53 and Fas/FasL expression is at the transcriptional level.

1118

Vol. 29

March 2015

HBc enhances the expression of sFas sFas arising from alternatively spliced Fas mRNA is a soluble form of Fas lacking exon 6 and acts as an inhibitor of Fas-mediated apoptosis signaling (33). Therefore, we went


LIU ET AL.

Figure 4. HBc enhances sFas expression. A) Expression of sFas in the culture medium of untreated or bleomycin-treated HepG2pcDNA3.1 and HepG2-pHBc cells measured by ELISA. B) Semiquantitative RT-PCR analysis of total Fas, mFas, and sFas mRNA levels in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells. The PCR product using primers P1 and P2 represents total Fas, whereas the PCR products using P3 and P5 (located in exon 7) represent mFas and sFas varied by size. C) Histogram summarizing the results of 3 semiquantitative RT-PCR analyses of sFas mRNA levels expressed as the fold change relative to that in untreated HepG2-pcDNA3.1 control cells. D) Representative agarose gel image showing the accumulation of alternatively spliced transcripts in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells transfected with pCMV56-Fas vector containing human Fas genomic sequences (exons 5–7). RNAs were analyzed by quantitative RT-PCR using primers PT1 and PT2 as described in Materials and Methods, and the products were analyzed on agarose gels (expected size: 230 bp for exon 6 inclusion and 167 bp for exon 6 skipping). E) The ratio of exons 5+7 to exons 5+6+7 amplification products, equivalent to the ratio of sFas to (sFas+mFas) RNA, was determined densitometrically on the band intensity from 3 independent experiments in the pCMV56-Fas transfected, bleomycin-treated, or untreated HepG2-pcDNA3.1 and HepG2pHBc cells. *P , 0.05.

further to evaluate the effects of HBc on sFas expression in the context of bleomycin treatment. Figure 4A showed that in the absence of bleomycin, the level of sFas in the culture medium of HepG2-pHBc cells as measured by ELISA was higher than that in HepG2-pcDNA3.1 cells (P , 0.05). Treatment of the cells with bleomycin further increased the sFas levels (P , 0.05). This was confirmed by semiquantitative PCR analysis. Although total Fas and mFas mRNA levels decreased in HepG2-pHBc cells compared with HepG2-pcDNA3.1 cells (Fig. 4B, C) with or without bleomycin treatment, the expression of HBc in HepG2pHBc cells did increase sFas mRNA levels. A Fas splicing HBc INHIBITS Fas-MEDIATED APOPTOSIS OF HEPATOCYTES

assay was also performed in cells transfected with Fas splicing reporter construct pCMV56 containing the human Fas receptor sequences spanning from exon 5 to position 44 of exon 7. The results showed that relative mRNA levels of Fas exon 5/7 (representative of sFas) to Fas exon 5–7 in HepG2-HBc were significantly elevated compared with those in HepG2-pcDNA3.1 cells, and treatment of bleomycin reduced the magnitude of this effect (Fig. 4D, E). These data support the notion that HBc enhances the expression of sFas via increasing transcripts of an alternatively spliced variant that specifically encodes the soluble form of the receptors. 1119

Figure 5. Regulatory mechanisms of Fas alternative mRNA splicing by HBc. A) Representative Western blot showing PTBPs protein levels in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells. The first panel was blotted with an anti-PTBP1 antibody recognizing the epitope of PTBP1 C-terminal residues surrounding Val338. The second panel was blotted with an anti-PTBP1 antibody recognizing the epitope of PTBP1 N-terminal 46–59 amino acids. B) Histogram summarizing the results of 3 independent experiments expressed as the fold change relative to that in the untreated control cells after normalization to b-tubulin. C) Quantitative real-time PCR analysis of PTBPs mRNA levels in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells. D) Representative Western blot showing the levels of procaspase-3 and active caspase-3 in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells. E) Histogram summarizing the mean level of the active caspase-3 determined from 3 independent experiments expressed as the fold change relative to that in the untreated HepG2-pcDNA3.1 control cells after normalization to b-tubulin. F) Measurements of caspase-3 enzymatic activity determined from 3 independent experiments expressed (continued on next page)

1120

Vol. 29

March 2015


LIU ET AL.

Mechanisms of Fas alternative mRNA splicing regulation by HBc Mechanistically, Fas alternative premRNA splicing is known to be regulated by antagonistic effects of the RNAbinding proteins on exon definition including PTBP, TIA1, and TIA-1-related (TIAR) proteins (27–29). We first examined the effects of HBc on PTBP expression in HepG2-pHBc and HepG2-pcDNA3.1 cells with or without bleomycin treatment. The PTBP family consists of 3 members including PTBP1, PTBP2, and PTBP3 (34). As shown in Fig. 5A, B, in the absence of bleomycin, HepG2pHBc cells expressed higher levels of PTBP1 protein compared with HepG2-pcDNA3.1 cells (P , 0.05), but there was no significant difference in the expression of PTBP2 or PTBP3 between the 2 lines. In the presence of bleomycin, expression of PTBP1 in HepG2-pHBc cells was sustained higher than in HepG2-pcDNA3.1, whereas overall magnitude was reduced in both cell lines. Interestingly, mRNA expression levels of all the PTB isoforms remained unchanged between HepG2-pHBc and HepG2-pcDNA3.1 cells either treated or untreated with bleomycin (Fig. 5C). Because PTBP1 cleavage is a general apoptotic event dependent on caspase activity and caspase-3 is known to be responsible for PTBP1 cleavage during apoptosis (35), we were interested in evaluating whether caspase-3 also contributed to the regulation of p53-dependent Fas-mediated apoptosis by HBc. As shown in Fig. 5D, E, the steady-state levels of active caspase-3 were significantly reduced in HepG2-pHBc cells compared with the control cells. Less activation of caspase-3 was also seen in HepG2-pHBc cells following exposure to bleomycin compared with that in HepG2-pcDNA3.1, although bleomycin elevated the caspase-3 level in both cells. Consistently, the changes in the protein levels of active caspase-3 were accompanied by a proportional alterations in the enzyme activity of caspase-3 (Fig. 5F). Because of the fact that HBc can function as a transcriptional repressor of p53 (25) and p53 could induce the release of mitochondrial cytochrome c to facilitate the activation of caspase-3 (36), it is conceivable that HBc increases the level of PTBP1 through suppression of 53 to reduce caspase-3 activation for PTBP1 cleavage. FASTK is known to interact and synergize with TIA-1/ TIAR proteins to regulate Fas alternative splicing, and depletion of FASTK leads to skipping of Fas exon 6 from endogenous Fas transcripts (37). Thus, we finally analyzed the expression of FASTK, TIA-1, and TIAR for a possible link to HBc as Fas splicing regulators. Indeed, HBc inhibited FASTK expression with the levels of TIA-1 and TIAR unaffected, whereas treatment of bleomycin had no effect on the expression (Fig. 5G, H). Furthermore, a reduction in the FASTK mRNA level was also observed in HepG2-pHBc cells compared with the control HepG2-

pcDNA3.1 cells (Fig. 5I), indicating that HBc may regulate FASTK gene expression at the transcriptional level. To this end, cells were transfected with a FASTK promoter-driven luciferase reporter construct pGL4.10-FASTK to evaluate changes in possible HBc-regulated promoter activation. As shown in Fig. 5J, HBc-expressing HepG2-pHBc cells demonstrated a significant decrease in reporter gene activity relative to HepG2-pcDNA cells (Fig. 5J). Taken together, these results implied that HBc might selectively suppress FASTK transcripts independent of p53 to block the synergistic effects of FASTK with TIA-1/TIAR in Fas splicing. DISCUSSION Hepatocyte apoptosis, which is mainly induced by death receptor ligands such as TNF-a and FasL, is implicated in several experimental and human liver diseases including viral hepatitis, fulminant and chronic hepatic failure, and HCC (38). Therefore, identification of pro- and antiapoptotic pathways related to death receptor-mediated hepatocyte apoptosis would contribute importantly to understanding of the pathophysiological role of apoptosis in major liver diseases. HBc has been shown to prevent hepatocytes from TRAIL-induced apoptosis (4); however, a role for HBc in Fas-mediated apoptosis in hepatocytes has not been documented. Here, we demonstrated for the first time that the HBc is a strong survival factor capable of protecting cells from anti-Fas antibody-induced apoptosis through the p53-dependent Fas/FasL signaling pathway. We also showed that HBc can act as a Fas alternative splicing regulator to increase the expression of sFas, a known inhibitor of Fas signaling. Given that the Fas ligand receptor system plays a central role in the pathogenesis of chronic HBV infection in human (8) and in the development of inflammatory liver disease in transgenic mice (39), it is reasonable to speculate that HBc expression may contribute to HBV chronicity by increasing the resistance of infected hepatocytes to Fas-mediated cell killing. In this study, we discovered that HBc significantly protected HepG2 cells from anti-Fas CH11-evoked cytotoxicity. It is noteworthy that an anti-Fas blocking antibody completely neutralized the effect of CH11-induced apoptosis, further attesting to the pivotal role of the Fas signaling pathway in the hepatocyte apoptosis. The finding that there was no differential cytotoxicity of CH11 between HBcand empty vector-transfected Huh7 or Hep3B cells, both of which are deficient in p53 function, suggests a requirement of p53 in mediating the cell protection afforded by HBc, which was further confirmed in p53 wild-type HepG2 cells treated with a p53 inhibitor or p53 inducer. The possibility that HBc may function as a gene regulatory protein arises from its arginine-rich C-terminal

as the fold change relative to that in the untreated HepG2-pcDNA3.1 control cells. G) Representative Western blot showing the levels of FASTK, TIA-1, and TIAR in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells. H) Histogram summarizing the mean levels of FASTK, TIA-1, and TIAR protein determined from 3 independent experiments expressed as the fold change relative to that in the untreated HepG2-pcDNA3.1 control cells after normalization to b-tubulin. I) Quantitative realtime PCR analysis of FASTK mRNA levels in untreated or bleomycin-treated HepG2-pcDNA3.1 and HepG2-pHBc cells. J) Transcriptional regulation of FASTK by HBc. HepG2-pcDNA3.1 or HepG2-pHBc cells were cotransfected with pGL4.10-FASTK containing the FASTK promoter sequence and the Renilla luciferase expression vector pRL-TK. The level of promoter activity was evaluated 48 h after transfection by measuring the luciferase activity normalized for variations in transfection efficiency and expressed as the fold change relative to the untreated HepG2-pcDNA3.1 cells. Values are shown as the mean 6 SD, n = 5. *P , 0.05.


1121

properties, including the presence of nucleic acid–binding motifs (40), nuclear localization signals (41), and phosphorylation sites (42). Several studies have suggested that HBc had the ability to bind to a large number of human gene promoters and could disrupt normal host gene expression. For example, HBc has been shown to be a transcriptional repressor of the human p53 gene through the transcription factor E2F1 binding site in the p53 promoter (25). More recently, whole-genome chromatin immunoprecipitation microarray analysis revealed that HBc could disrupt the expression of 3100 human genes by binding to promoter regions (43). The presence of functional wildtype p53 is closely associated with efficient induction of Fasmediated apoptosis in many tumor cell lines types (14). Intriguingly, up-regulation of the Fas receptor only occurred in hepatoma cell line HepG2 with intact p53 but not in Huh7 and HepB3 cells with mutated and null p53, respectively (44). We found that forced expression of HBc in HepG2 cells resulted in a significant reduction in the p53 level that was accompanied by a decrease of total Fas and mFas expression. Treatment of the p53 inducer bleomycin up-regulated the expression of total and membrane-bound Fas receptors in both HepG2-pHBc and HepG2-pcDNA3.1 cells with the effects being less prominent in HepG2-pHBc cells. Although we cannot exclude the possibility that HBc may also directly suppress Fas transcription, it is tempting to suggest a model in which HBc serves as a transcriptional repressor of p53, which in turn regulates Fas expression at the transcriptional level. It may be worth noting that HBc expression also significantly inhibited the expression of the FasL mRNA level in HepG2-pHBc cells irrespective of bleomycin treatment. However, the molecular mechanisms responsible for HBc-mediated FasL expression and the role of FasL suppression by HBc in HBV-infected hepatocytes remain to be determined. An important addition from this study to the current knowledge concerning the biological function of HBc is its previously unrecognized role in regulating the expression of soluble forms of the Fas receptor. Up-regulation of sFas by HBc was supported by several lines of evidence in the current study. First, we observed that HBc could increase sFas protein levels in the culture of HepG2-pHBc cells. To verify that the increased protein level is a direct result of enhanced transcriptions of sFas gene, we designed PCR primers to amplify the region between the third and seventh exon of Fas mRNA for differentiation of sFas (exon 6 skipping) from mFas (exon 6 inclusion). The semiquantitative RT-PCR analysis revealed that HBc expression increased sFas mRNA levels while decreasing mFas mRNA levels. Furthermore, Fas splicing assay was performed in HepG2-pHBc and the control HepG2-pcDNA3.1 cells transfected with the Fas reporter construct pCMV56-Fas that allows analysis of transcripts specifically from the expression vector (27). It is clear that transfection of pCMV56Fas into HepG2-pHBc cells resulted in a substantial change in the ratio between alternatively spliced products with an increase in the form that skips exon 6. To gain further insights into molecular mechanisms that might contribute to the up-regulation of sFas by HBc, we investigated the expression and correlation of PTBPs, FASTK, TIA-1, and TIAR, all of which are known to regulate Fas alternative splicing. Although the PTBP1 level was increased only to a moderate extent in the HBc-expressing 1122

Vol. 29

March 2015

cells (Fig. 5A), it appeared sufficient to account for the substantial effects on Fas exon 6 skipping (Fig. 4D). It has been reported that PTBP1 recruitment to the URE6 silencer element induces Fas exon 6 skipping (29), and cleavage of PTBP1 by active caspase-3 is a general event during apoptosis induced by p53 and many proapoptotic chemical agents (35, 36, 45). In keeping with this, we found that an increase in PTBP1 expression in HepG2-pHBc cells was accompanied by a significant reduction in the cleaved forms of PTBP1 because of less caspase-3 activation. A previous study established that FASTK promotes the inclusion of Fas exon 6 through synergistic effects with TIA-1/TIAR (37). Consistent with the notion that increased sFas expression may be associated with reduced FASTK activity leading to skipping of exon 6 from endogenous Fas transcripts, we found that HBc did suppress both FASTK promoter activity and expression levels. Although the total TIA-1 and TIAR protein levels appeared unaffected, the level of phosphorylation that reflects the activity of TIA1/TIAR needs to be determined once antibodies against phosphorylated forms of TIA1/TIAR become commercially available. Interestingly, treatment with bleomycin did not alter the effect of HBc on FASTK expression, indicating that HBc regulation of FASTK is independent of p53. It should be recognized that Fas splicing regulation during early apoptosis is also linked to caspase-mediated cleavage of U2AF65. Both U2AF65 and its N-terminal fragment arising from caspasemediated cleavage can contribute to Fas exon 6 skipping (46). However, whether U2AF65 plays a role in HBc-related Fas splicing remains to be clarified and explored. In summary, to the best of our knowledge, this report is the first demonstration to date that hepatitis B viral core protein serves to restrain p53-dependent Fas-mediated apoptosis of hepatocytes by repressing the expression of both mFas and FasL at the transcriptional level and increasing sFas expression by facilitation of Fas alternative splicing. Our results suggest that HBc may prevent hepatocytes from apoptosis induced by Fas/FasL system, thus contributing to the survival and persistence of infected hepatocytes toward the development of chronic HBV infection. The authors thank Drs. Christopher W. J. Smith and J. Valca’rcel for providing pCMV56-Fas vector. This work was supported by grants from State Key Project Specialized for Infectious Diseases (2012ZX10002002-004-006 and 2013ZX10002006-002-002), Key Program of Scientific Research (09ZD004), and Program for Innovative Research Team in Science and Technology from Fujian Medical University (FMU-RT001).

REFERENCES 1. Lok, A. S., Heathcote, E. J., and Hoofnagle, J. H. (2001) Management of hepatitis B: 2000—summary of a workshop. Gastroenterology 120, 1828–1853 2. Kew, M. C. (2010) Epidemiology of chronic hepatitis B virus infection, hepatocellular carcinoma, and hepatitis B virus-induced hepatocellular carcinoma. Pathol. Biol. (Paris) 58, 273–277 3. Bortolami, M., Kotsafti, A., Cardin, R., and Farinati, F. (2008) Fas / FasL system, IL-1beta expression and apoptosis in chronic HBV and HCV liver disease. J. Viral Hepat. 15, 515–522 4. Du, J., Liang, X., Liu, Y., Qu, Z., Gao, L., Han, L., Liu, S., Cui, M., Shi, Y., Zhang, Z., Yu, L., Cao, L., Ma, C., Zhang, L., Chen, Y., and Sun, W. (2009) Hepatitis B virus core protein inhibits TRAIL-induced apoptosis of hepatocytes by blocking DR5 expression. Cell Death Differ. 16, 219–229


LIU ET AL.

5. Kondo, T., Suda, T., Fukuyama, H., Adachi, M., and Nagata, S. (1997) Essential roles of the Fas ligand in the development of hepatitis. Nat. Med. 3, 409–413 6. Liang, X., Liu, Y., Zhang, Q., Gao, L., Han, L., Ma, C., Zhang, L., Chen, Y. H., and Sun, W. (2007) Hepatitis B virus sensitizes hepatocytes to TRAIL-induced apoptosis through Bax. J. Immunol. 178, 503–510 7. Guicciardi, M. E., and Gores, G. J. (2009) Life and death by death receptors. FASEB J. 23, 1625–1637 8. Galle, P. R., Hofmann, W. J., Walczak, H., Schaller, H., Otto, G., Stremmel, W., Krammer, P. H., and Runkel, L. (1995) Involvement of the CD95 (APO-1/Fas) receptor and ligand in liver damage. J. Exp. Med. 182, 1223–1230 9. Cascino, I., Fiucci, G., Papoff, G., and Ruberti, G. (1995) Three functional soluble forms of the human apoptosis-inducing Fas molecule are produced by alternative splicing. J. Immunol. 154, 2706–2713 10. Rivero, M., Crespo, J., Fábrega, E., Casafont, F., Mayorga, M., Gomez-Fleitas, M., and Pons-Romero, F. (2002) Apoptosis mediated by the Fas system in the fulminant hepatitis by hepatitis B virus. J. Viral Hepat. 9, 107–113 11. Jodo, S., Kobayashi, S., Nakajima, Y., Matsunaga, T., Nakayama, N., Ogura, N., Kayagaki, N., Okumura, K., and Koike, T. (1998) Elevated serum levels of soluble Fas/APO-1 (CD95) in patients with hepatocellular carcinoma. Clin. Exp. Immunol. 112, 166–171 12. Jodo, S., Kobayashi, S., Kayagaki, N., Ogura, N., Feng, Y., Amasaki, Y., Fujisaku, A., Azuma, M., Yagita, H., Okumura, K., and Koike, T. (1997) Serum levels of soluble Fas/APO-1 (CD95) and its molecular structure in patients with systemic lupus erythematosus (SLE) and other autoimmune diseases. Clin. Exp. Immunol. 107, 89–95 13. Knipping, E., Debatin, K.-M., Stricker, K., Heilig, B., Eder, A., and Krammer, P. H. (1995) Identification of soluble APO-1 in supernatants of human B- and T-cell lines and increased serum levels in B- and T-cell leukemias. Blood 85, 1562–1569 14. Müller, M., Strand, S., Hug, H., Heinemann, E.-M., Walczak, H., Hofmann, W. J., Stremmel, W., Krammer, P. H., and Galle, P. R. (1997) Drug-induced apoptosis in hepatoma cells is mediated by the CD95 (APO-1/Fas) receptor/ligand system and involves activation of wild-type p53. J. Clin. Invest. 99, 403–413 15. Müller, M., Wilder, S., Bannasch, D., Israeli, D., Lehlbach, K., Li-Weber, M., Friedman, S. L., Galle, P. R., Stremmel, W., Oren, M., and Krammer, P. H. (1998) p53 activates the CD95 (APO-1/ Fas) gene in response to DNA damage by anticancer drugs. J. Exp. Med. 188, 2033–2045 16. Fridman, J. S., and Lowe, S. W. (2003) Control of apoptosis by p53. Oncogene 22, 9030–9040 17. Haupt, S., Berger, M., Goldberg, Z., and Haupt, Y. (2003) Apoptosis - the p53 network. J. Cell Sci. 116, 4077–4085 18. Rawat, S., Clippinger, A. J., and Bouchard, M. J. (2012) Modulation of apoptotic signaling by the hepatitis B virus X protein. Viruses 4, 2945–2972 19. Jeong, H., Cho, M. H., Park, S. G., and Jung, G. (2014) Interaction between nucleophosmin and HBV core protein increases HBV capsid assembly. FEBS Lett. 588, 851–858 20. Shim, H. Y., Quan, X., Yi, Y. S., and Jung, G. (2011) Heat shock protein 90 facilitates formation of the HBV capsid via interacting with the HBV core protein dimers. Virology 410, 161–169 21. Li, H. C., Huang, E. Y., Su, P. Y., Wu, S. Y., Yang, C. C., Lin, Y. S., Chang, W. C., and Shih, C. (2010) Nuclear export and import of human hepatitis B virus capsid protein and particles. PLoS Pathog. 6, e1001162 22. Milich, D. R., and McLachlan, A. (1986) The nucleocapsid of hepatitis B virus is both a T-cell-independent and a T-celldependent antigen. Science 234, 1398–1401 23. Yin, Y., Wu, C., Song, J., Wang, J., Zhang, E., Liu, H., Yang, D., Chen, X., Lu, M., and Xu, Y. (2011) DNA immunization with fusion of CTLA-4 to hepatitis B virus (HBV) core protein enhanced Th2 type responses and cleared HBV with an accelerated kinetic. PLoS ONE 6, e22524 24. Chen, X., Li, M., Le, X., Ma, W., and Zhou, B. (2004) Recombinant hepatitis B core antigen carrying preS1 epitopes induce immune response against chronic HBV infection. Vaccine 22, 439–446 25. Kwon, J. A., and Rho, H. M. (2003) Transcriptional repression of the human p53 gene by hepatitis B viral core protein (HBc) in human liver cells. Biol. Chem. 384, 203–212 26. Chen, W. N., Chen, J. Y., Lin, W. S., Lin, J. Y., and Lin, X. (2010) Hepatitis B doubly spliced protein, generated by a 2.2 kb doubly spliced hepatitis B virus RNA, is a pleiotropic activator protein mediating its effects via activator protein-1- and CCAAT/ enhancer-binding protein-binding sites. J. Gen. Virol. 91, 2592–2600


27. Förch, P., Puig, O., Kedersha, N., Mart´ınez, C., Granneman, S., Séraphin, B., Anderson, P., and Valcárcel, J. (2000) The apoptosis-promoting factor TIA-1 is a regulator of alternative pre-mRNA splicing. Mol. Cell 6, 1089–1098 28. Robinson, F., Jackson, R. J., and Smith, C. W. (2008) Expression of human nPTB is limited by extreme suboptimal codon content. PLoS One 3, e1801 29. Izquierdo, J. M., Majós, N., Bonnal, S., Mart´ınez, C., Castelo, R., Guigó, R., Bilbao, D., and Valcárcel, J. (2005) Regulation of Fas alternative splicing by antagonistic effects of TIA-1 and PTB on exon definition. Mol. Cell 19, 475–484 30. Fukazawa, T., Fujiwara, T., Morimoto, Y., Shao, J., Nishizaki, M., Kadowaki, Y., Hizuta, A., Owen-Schaub, L. B., Roth, J. A., and Tanaka, N. (1999) Differential involvement of the CD95 (Fas/APO-1) receptor/ligand system on apoptosis induced by the wild-type p53 gene transfer in human cancer cells. Oncogene 18, 2189–2199 31. Hsu, I. C., Tokiwa, T., Bennett, W., Metcalf, R. A., Welsh, J. A., Sun, T., and Harris, C. C. (1993) p53 gene mutation and integrated hepatitis B viral DNA sequences in human liver cancer cell lines. Carcinogenesis 14, 987–992 32. Ponchel, F., Puisieux, A., Tabone, E., Michot, J. P., Fröschl, G., Morel, A. P., Frébourg, T., Fontanière, B., Oberhammer, F., and Ozturk, M. (1994) Hepatocarcinoma-specific mutant p53-249ser induces mitotic activity but has no effect on transforming growth factor beta 1-mediated apoptosis. Cancer Res. 54, 2064–2068 33. Cheng, J., Zhou, T., Liu, C., Shapiro, J. P., Brauer, M. J., Kiefer, M. C., Barr, P. J., and Mountz, J. D. (1994) Protection from Fasmediated apoptosis by a soluble form of the Fas molecule. Science 263, 1759–1762 34. Spellman, R., Llorian, M., and Smith, C. W. (2007) Crossregulation and functional redundancy between the splicing regulator PTB and its paralogs nPTB and ROD1. Mol. Cell 27, 420–434 35. Back, S. H., Shin, S., and Jang, S. K. (2002) Polypyrimidine tractbinding proteins are cleaved by caspase-3 during apoptosis. J. Biol. Chem. 277, 27200–27209 36. Schuler, M., Bossy-Wetzel, E., Goldstein, J. C., Fitzgerald, P., and Green, D. R. (2000) p53 induces apoptosis by caspase activation through mitochondrial cytochrome c release. J. Biol. Chem. 275, 7337–7342 37. Izquierdo, J. M., and Valcárcel, J. (2007) Fas-activated serine/ threonine kinase (FAST K) synergizes with TIA-1/TIAR proteins to regulate Fas alternative splicing. J. Biol. Chem. 282, 1539–1543 38. Hatano, E. (2007) Tumor necrosis factor signaling in hepatocyte apoptosis. J. Gastroenterol. Hepatol. 22(Suppl 1), S43–S44 39. Nakamoto, Y., Guidotti, L. G., Pasquetto, V., Schreiber, R. D., and Chisari, F. V. (1997) Differential target cell sensitivity to CTLactivated death pathways in hepatitis B virus transgenic mice. J. Immunol. 158, 5692–5697 40. Hatton, T., Zhou, S., and Standring, D. N. (1992) RNA- and DNA-binding activities in hepatitis B virus capsid protein: a model for their roles in viral replication. J. Virol. 66, 5232–5241 41. Eckhardt, S. G., Milich, D. R., and McLachlan, A. (1991) Hepatitis B virus core antigen has two nuclear localization sequences in the arginine-rich carboxyl terminus. J. Virol. 65, 575–582 42. Liao, W., and Ou, J. H. (1995) Phosphorylation and nuclear localization of the hepatitis B virus core protein: significance of serine in the three repeated SPRRR motifs. J. Virol. 69, 1025–1029 43. Guo, Y., Kang, W., Lei, X., Li, Y., Xiang, A., Liu, Y., Zhao, J., Zhang, J., and Yan, Z. (2012) Hepatitis B viral core protein disrupts human host gene expression by binding to promoter regions. BMC Genomics 13, 563 44. Nakamura, M., Nagano, H., Sakon, M., Yamamoto, T., Ota, H., Wada, H., Damdinsuren, B., Noda, T., Marubashi, S., Miyamoto, A., Takeda, Y., Umeshita, K., Nakamori, S., Dono, K., and Monden, M. (2007) Role of the Fas/FasL pathway in combination therapy with interferon-a and fluorouracil against hepatocellular carcinoma in vitro. J. Hepatol. 46, 77–88 45. Vakifahmetoglu, H., Olsson, M., Orrenius, S., and Zhivotovsky, B. (2006) Functional connection between p53 and caspase-2 is essential for apoptosis induced by DNA damage. Oncogene 25, 5683–5692 46. Izquierdo, J. M. (2008) Fas splicing regulation during early apoptosis is linked to caspase-mediated cleavage of U2AF65. Mol. Biol. Cell 19, 3299–3307 Received for publication September 4, 2014. Accepted for publication November 3, 2014.

1123