Fujian Key Laboratory of Tumor Microbiology, Fujian Medical University, Fuzhou, China. ABSTRACT: Hepatitis B virus core protein (HBc) is expressed ...
THE
JOURNAL
• RESEARCH •
www.fasebj.org
Hepatitis B virus core protein promotes hepatocarcinogenesis by enhancing Src expression and activating the Src/PI3K/Akt pathway Wei Liu,*,†,1,2 Teng-Fei Guo,*,1 Zhen-Tang Jing,‡ Zhi Yang,*,† Lei Liu,*,† Yuan-Ping Yang,*,† Xu Lin,‡ and Qiao-Yun Tong*,†,3
*Institute of Digestive Disease, China Three Gorges University, Yichang, China; †Department of Gastroenterology of Yichang Central People’s Hospital, Yichang, China; and ‡Fujian Key Laboratory of Tumor Microbiology, Fujian Medical University, Fuzhou, China
Hepatitis B virus core protein (HBc) is expressed preferentially in hepatitis B virus (HBV)–associated hepatocellular carcinoma (HCC). HBc can function as an oncogene arising from its gene regulatory properties, but how it contributes functionally to hepatocarcinogenesis remains unclear. In this study, we determined the molecular and functional roles of HBc during HBV-associated hepatocellular tumorigenesis. HBc increased tumor formation of hepatoma cells. Moreover, expression of HBc specifically promoted proliferation of hepatoma cells in vitro. Mechanistic investigations revealed that these effects were caused by activation of the Src/PI3K/Akt pathway through proximal switch from inactive Src to the active form of the kinase by HBc. HBc-mediated sarcoma (Src) kinase activation was associated with down-regulation of C-terminal Src kinase (Csk). In addition, HBc enhances Src expression by activation of alternative Src 1A promoter in an Sp1 transcription factor-dependent manner. Proliferation induced by stable HBc expression was associated with increased G1–S cell cycle progression mediated by Src kinase activation. HBc-induced cellular proliferation and tumor formation were reversed by administration of the Src inhibitor saracatinib. Together, our findings suggest that HBc promotes tumorigenesis of hepatoma cells by enhancing the expression of total Src and the active form of the kinase and subsequently activates Src/ PI3K/Akt signaling pathway, revealing novel insights into the underlying mechanisms of HBV-associated hepatocarcinogenesis.—Liu, W., Guo, T.-F., Jing, Z.-T., Yang, Z., Liu, L., Yang, Y.-P., Lin, X., Tong, Q.-Y. Hepatitis B virus core protein promotes hepatocarcinogenesis by enhancing Src expression and activating the Src/PI3K/Akt pathway. FASEB J. 32, 3033–3046 (2018). www.fasebj.org
ABSTRACT:
KEY WORDS:
proliferation
•
cell cycle
•
Csk
•
Sp1
•
survival signaling
Hepatitis B virus (HBV) infection remains a major health problem worldwide; ;350 million people are chronically infected with HBV who are at a high risk of developing hepatitis, cirrhosis, and hepatocellular carcinoma (HCC) (1, 2). However, the molecular mechanisms underlying chronic HBV infection and its pathophysiological processes have not been completely understood. Recent studies have suggested that abnormally ABBREVIATIONS: Akt, protein kinase B; ChIP, chromatin immunoprecip-
itation; Csk, C-terminal Src kinase; H&E, hematoxylin and eosin; HBc, hepatitis B virus core protein; HBV, hepatitis B virus; HCC, hepatocellular carcinoma; hnRNP K, heterogeneous nuclear ribonucleoprotein K; MATK, megakaryocyte-associated tyrosine kinase; PTP, protein tyrosine phosphatase; siRNA, small interfering RNA; Src, sarcoma 1
These authors contributed equally to this work. Correspondence: Institute of Digestive Disease, China Three Gorges University, 8 Daxue Road, Yichang 443000, China. E-mail: liuwei@ctgu. edu.cn 3 Correspondence: Institute of Digestive Disease, China Three Gorges University, 8 Daxue Road, Yichang 443000, China. E-mail: ycxhnk@ctgu. edu.cn 2
doi: 10.1096/fj.201701144R
0892-6638/18/0032-3033 © FASEB
accelerated proliferation of HBV-infected hepatocytes is one of the major contributors to the development and progression of chronic hepatitis to HCC (3). Progression from chronic hepatitis B to HCC involves direct effects of the virus protein on the cellular function of infected hepatocytes, as well as indirect effects through the process of inflammation, regeneration, and cirrhosis because of HBV infection (4). Extensive studies over past years have identified aberrant activation of major signaling cascades such as the PI3K/protein kinase B (Akt) pathway, the Raf/MEK/ ERK pathway, the WNT/b-catenin pathway, and the hepatocyte growth factor/c-mesenchymal epithelial transition factor pathway involved in the pathogenesis of HCC (5, 6). Abrupt alterations that occur in liver tissues with HBV infection cause significant changes in several cellular signaling, including the WNT/b-catenin, p53, the retinoblastoma protein, MAPK, and NF-kB pathways, and alter gene expression resulting in hepatoma formation because of increased proliferation and cell-cycle progression (4). As a dominant nonreceptor tyrosine kinase activated in HCC, 3033
abnormal sarcoma (Src) signaling activation conferred by HBV has been reported to participate in HCC (7–9). However, the interaction between Src signal activation and HBc expression during HBV infection has not been characterized. Regarding the effect of viral protein expression on hepatocellular malignant transformation, HBc proteins have been found to be expressed massively in infected tissues. HBc is the major capsid protein of the virus and selfassembles to form the subviral 30–32 nm nucleocapsid particles that package the viral polymerase and pregenomic RNA during RNA replication (10, 11). The 21 kDa HBc protein has been detected in both the nuclear and cytoplasmic compartments of hepatocytes infected by HBV (12). Many studies have provided evidence that HBc is extremely immunogenic (13–15), and for this reason, it has been used for the HBV vaccine development. However, HBc may also function as an important mediator of hepatocarcinogenesis through several mechanisms including repression of the proapoptotic p53 and promotion of apoptosis resistance (16–18). In this study, we sought to determine the direct oncogenic function of HBc expression in HBV-associated hepatocarcinogenesis. In our present investigation, HBc expression promoted tumorigenesis of hepatoma cells dependent on Src/PI3K/Akt signal activation in vitro and in vivo, which may shed a new light on the molecular mechanisms underlying HBV-associated hepatocarcinogenesis and provide a promising therapeutic target for patients with HCC with chronic HBV infection. MATERIALS AND METHODS
CC-39; reverse, 59-ATAAGAATGCGGCCGCTCACAGGTGCAGCTCGTGGG-39. The promoter driving firefly luciferase containing Src 1a(pGL4.10-Src 1a), Src 1A (pGL4.10-Src 1A), and Sp1 (pGL4.10Sp1) was constructed by ligation of the PCR-generated respective minimal promoter into the KpnI- and XhoI (New England Biolabs)-cleaved sites of the luciferase reporter plasmid pGL4.10 vector (Promega, Madison, WI, USA) (19–21). Genomic DNA from HepG2 cells was extracted by use of DNAzol Reagent (Thermo Fisher Scientific) and used as a template for PCR amplification. The forward and reverse primers used were 59-CGG GGTACC GGCCAGTAA AGGCCTTTAG ACATGTCTAA-39 and 59-CGGCTCGAGCAACAGCAG AAGCCAGCCTGG GCTGGT-39 for Src 1a, 59-CGG GGTACC CTCAGGTCAAGGCTAAAGTCCAAGG CCTGG-39 and 59-CGGCTCGAGG ACGGGCAGAC GGCGGCCTGG CCGCTCCGG-39 for Src 1A, 59-CGGGGTACCGGCACC TAACACGGTA GGCAGTCAGC-39 and 59-CGGCTCGAGCATGGTGGCAG CTGAGGGACA AGCTCAAGG-39 for Sp1. pGL4.10-Src 1A-Sp1mut including 2 binding-site mutations for Sp1 (19) was synthesized chemically by Sangon Biotech (Shanghai, China). All plasmid constructs were confirmed by DNA sequencing. pRep-HBV harboring 1.2-unit lengths of the HBV genome and control empty plasmid pRep-Sal have been described (22). The pRep-HBV-HBc(2) plasmid contains the HBc initiation codon ATG to ACG. The mutant was generated by sitedirected mutagenesis (23). Generation of stable HBc-expressing hepatoma cell lines The Huh7, HepG2, and Hep3B cells were transfected with HBc or the empty control of pcDNA3.1/Hygro+ and selected in the presence of 400 mg/ml hygromycin for 4 wk. The hygromycinresistant clones were expanded together into cell lines and screened for the extent of HBc protein expression by Western blot analysis.
Cells and tumor tissues The human hepatoma cell lines HepG2, Huh7, and Hep3B were cultured in DMEM (Thermo Fisher Scientific, Waltham, MA, USA), supplemented with 10% fetal bovine serum (FBS) and maintained in a humidified atmosphere containing 5% CO2 at 37°C. Transfection was performed using Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. Surgically resected HBV-associated HCC tissues were obtained from 4 patients who underwent surgical resection at The First Affiliated Hospital of Fujian Medical University. The study protocol had all the appropriate approvals by the institutional review board and regulatory authorities. All patients had given informed written consent.
Plasmids transfection and RNA interference Transient transfections with various plasmids were performed as published (17). Small interfering RNAs (siRNAs) against SRC gene-Src siRNA (sc-36555; Santa Cruz Biotechnology, Dallas, TX, USA), siRNAs against AKT1/2 gene-Akt1/2 siRNA (sc-43609; Santa Cruz Biotechnology), siRNAs against Sp1 gene-Sp1 siRNA (sc-29487; Santa Cruz Biotechnology), and corresponding control siRNA (sc-37007; Santa Cruz Biotechnology) were transfected into Huh7 cells in 6-well plates using the X-tremeGene siRNA Transfection Reagent (Roche Applied Science, Penzberg, Germany) according to manufacturer’s instructions. The gene silencing effect was confirmed by Western blot analysis and RT-PCR at 48 h after transfection.
Plasmid constructs The plasmid containing HBc (pcDNA3.1-HBc) was constructed as described elsewhere (17). pcDNA3.1-Src and pcDNA3.1Akt plasmids, the kinase-dead mutant Src-K295M plasmid, and the dominant–negative mutant Akt-K179M plasmid were kindly provided by Dr. Jian-Xin Gu (Key Laboratory of Medical Molecular Virology, Fudan University, Shanghai, China). pcDNA3.1-Csk was constructed by inserting PCR-generated Csk cDNA into the HindIII and NotI sites (New England Biolabs, Beverly, MA, USA) of the plasmid pcDNA3.1/Hygro+ (Thermo Fisher Scientific). Genomic DNA from HepG2 cells was extracted with the DNAzol Reagent (Thermo Fisher Scientific) and used as a template for PCR amplification. The primers were as follows: forward, 59-CCCAAGCTTGCCACCATGTCAGCAATACAGG 3034
Vol. 32
June 2018
Western blot analysis Cell lysates and tissues were prepared using RIPA protein lysis buffer (Thermo Fisher Scientific). A total of 40 mg protein extracts were quantified and then subjected to electrophoresis on a 10 or 12% SDS-PAGE gel. The proteins were transferred to PVDF membranes and blocked in Tris-buffered saline containing 5% bovine serum albumin. The specific antibodies used in this study included anti-HBc (sc-23947, 1:500) and anti-Sp3 (sc-644, 1:500; both from Santa Cruz Biotechnology); and anti-b-tubulin (2128,1: 1000), anti-Src (2109,1:1000), anti-Sp1 (9389,1:1000), anti-hnRNP K (9081, 1:1000), anti-pSrc Tyr416 (6943, 1:1000), anti-pSrc Tyr527 (2105, 1:1000), anti-Csk (4980, 1:1000), anti-AKT (4691,
The FASEB Journal x www.fasebj.org
LIU ET AL.
1:1000), anti-pAKT (Ser473) (4060, 1:1000), anti-PCNA (13110, 1:1000), anti-Cyclin A2 (4656, 1:1000), anti-Cyclin B1 (4138, 1:1000), anti-Cyclin D1 (2978, 1:1000), anti-Cyclin E1 (4129, 1:1000), anti-p21 (2947, 1:1000), anti-p27 (3686, 1:1000), antiCDK2 (2546, 1:1000), anti-CDK4 (12790, 1:1000), and antiCDK6 (3136, 1:1000) (all from Cell Signaling Technology, Beverly, MA, USA). Proteins were detected by addition of alkaline phosphatase (AP)–conjugated secondary antibody. Visualization of the immunoreactive proteins was performed by addition of CDP Star reagents (Roche Diagnostics, GmbH, Mannheim, Germany). The bands were detected by ImageQuant LAS 4000 Mini (GE Healthcare, Waukesha, WI, USA). Intensities of band signals were quantified using the densitometric software Quantity One (Bio-Rad, Hercules, CA, USA), and the relative intensity to internal control of b-tubulin was calculated. Colony formation assay, cell proliferation assay, anchorage-independent growth in soft agar assay, and cell cycle analysis A colony formation assay, cell proliferation assay, anchorageindependent growth in soft agar assay, and cell cycle analysis were performed according to published protocols (8, 24). Tumor xenograft experiments and saracatinib (AZD0530) treatment Tumor xenograft experiments in nude mice were performed (8). The specific Src inhibitor saracatinib (Selleck Chemicals, Houston, TX, USA) was dissolved with DMSO for 5 mg/ml additive stock solution. Saracatinib gavage solution or vehicle control gavage solution was prepared freshly by combining saracatinib additive stock solution or DMSO with corn oil at a ratio of 95% corn oil:5% DMSO. Nude mice with a subcutaneous tumor xenograft were fed the saracatinib solution or vehicle control solution daily at a dose of 25 mg/kg body weight in vehicle corn oil via oral gavage for 4 wk after hepatoma cell subcutaneous injection. Tumor morphology Tumor sections from subcutaneous tumor xenografted nude mice were fixed in 4% formalin and embedded in paraffin according to standard methods. Paraffin-embedded tissues were sectioned (5 mm) and stained with hematoxylin and eosin (H&E) for morphologic analysis. Real-time quantitative PCR analysis Total RNA was extracted using Trizol reagent (Thermo Fisher Scientific) and transcripted into cDNA by using the ExScript RTPCR Kit (Takara, Kyoto, Japan). Quantitative real-time PCR was performed in the Mx3000P Real-Time PCR System (Agilent Technologies, Santa Clara, CA, USA) with the SYBR Premix Ex TaqTM kit (Takara), according to the manufacturer’s instructions. The glyceraldehyde-3-phosphate dehydrogenase gene was used as a reference gene, and relative mRNA levels were calculated using the 22DDCt method. The forward and reverse primers used were 59-AGCACAGGACAGACAGGCTACA-39 and 59-CGTCTGGTGATCTTGCCAAAATA-39 for Src, 59-CCAAGTGCAGCAGGATGGTT-39 and 59-ACCCAGAGCTGCTGATCGTG-39 for Sp1, 59-GGCCATCCGGTACAGAATGT-39 and 59-GTACAGAAGCCGCTCAGCCT-39 for Csk, and 59-TGCACCACCAACTGCTTAGC-39and 59-AGCTCAGGGATGACCTTGCC-39 for glyceraldehyde-3-phosphate dehydrogenase. HBC PROMOTES SRC-MEDIATED HEPATOCARCINOGENESIS
Dual-luciferase reporter assay Cells were transfected with 0.2 mg pGL4.10-promoter reporter plasmid and 0.2 mg of the Renilla luciferase expression vector pRL-TK. The cells were harvested 48 h after the transfection. A total of 20 mg of cell lysate was used for the detection of intracellular luciferase activity by the Dual-Luciferase Reporter Assay System (Promega), according to manufacturer’s recommendations. The firefly luciferase activity was normalized against the Renilla reniformis luciferase activity of the cotransfected pRL-TK to control for variations in transfection efficiency. Luminescence measurement was obtained on a luminometer (Orion II microplate luminometer; Berthold Detection Systems, Pforzheim, Germany). All assays were performed at least in triplicate. Coimmunoprecipitation assay Lysates from HepG2 cells were immunoprecipitated with HBc or Src antibodies and protein A/G agarose (Santa Cruz Biotechnology) at 4°C overnight. The immune complexes were eluted and subjected to Western blot analysis with the HBc or Src antibodies. Chromatin immunoprecipitation assay A chromatin immunoprecipitation (ChIP) assay was performed according to the X-ChIP protocol (Abcam, Cambridge MA, USA). For immunoprecipitation, sonicated cell lysates were incubated with anti-Sp1 or anti-Flag M2 (the same amount of normal IgG as control) antibodies for protein-DNA binding detection. Bound target DNA fractions were analyzed by PCR with the paired primers 59-GGCGGAGTGGGAGGCGGGGC-39 (sense) and 59- GCGCGAGCTGGGAGGAGGGG -39 (antisense), which amplified the region containing Sp1 binding sites. Immunohistochemistry Tissues were fixed in 4% neutral-buffered formalin, processed, then embedded in paraffin and cut into 5 mm sections. Tissues sections were deparaffinized and rehydrated. Endogenous peroxidase was blocked in 3% H2O2 in PBS for 10 min. After blocking nonspecific sites with 1.5% blocking serum in PBS for 1 h at room temperature, tissue sections were incubated 1 h at room temperature with the respective antibody. After a 30 min reaction with a biotinylated secondary antibody, slides were washed with PBS and incubated with streptavidin conjugated with horseradish peroxidase for 10 min. The reaction was then revealed with 3,39-diaminobenzidine. The slides were mounted with Eukitt (EMS, Hatfield, PA, USA) and observed with an BX60 microscope (Olympus, Shinjuku, Japan). Images were captured with IPE6.0 software. Study approval All work performed with animals was in accordance with and approved by the Institutional Animal Care and Use Committee at the Fujian Medical University. Statistical analysis Experimental data were presented as means 6 SD or SEM of at least 3 independent replicates through analyzing with Prism 5 (GraphPad Software, La Jolla, CA, USA), and assessing 3035
comparisons between different groups by the Student’s t test or 1-way ANOVA. Significance was set at P , 0.05.
RESULTS HBc expression promotes tumor formation of hepatoma cells in vivo and in vitro To elucidate the effect of HBc expression on tumor formation in vivo, tumor xenograft experiments were performed in nude mice with Huh7, HepG2, and Hep3B cells stably transfected with HBc. Stable HBc expression compared with control Huh7, HepG2, and Hep3B cells was confirmed by Western blot analysis (Fig. 1A). Tumor
xenograft experiments showed that HBc expression significantly accelerated overall tumor growth compared with the control group, as assessed by the tumor volume (Fig. 1B). After tumor xenograft (4 wk), nude mice were euthanized, and subcutaneous tumor tissues were examined. Notably, HBc stably expressing hepatoma cells showed increased tumor growth (Fig. 1C) compared with control cells, as determined through tumor photography and weight measurement (Fig. 1D). H&E staining showed more aggressive tumor growth in HepG2-HBc cells than in HepG2-pcDNA3.1 cells in nude mice (Fig. 1E). To further assess the oncogenic effect of HBc expression on hepatocarcinogenesis, a colony formation assay, soft agar assay, and cell proliferation assay were performed in Huh7,
B
A
2
Huh7-HBc
HBc β-tubulin
C
Tumor volume (cm3)
Huh7-pcDNA3.1
Huh7-pcDNA3.1
HepG2-HBc
1.5
HepG2-pcDNA3.1
*
Hep3B-HBc
*
Hep3B-pcDNA3.1
1
* 0.5
0 0
3
6
9
12
15
18
21
24
27
Time (days)
Huh7-HBc
HepG2-HBc
Hep3B-pcDNA3.1
Tumor weight (g)
HepG2-pcDNA3.1
D
2
pcDNA3.1
* 1.5
HBc
*
1
*
0.5
Hep3B-HBc 0
Huh7
E
HepG2-pcDNA3.1
HepG2
Hep3B
HepG2-HBc
Tumor Tumor
Figure 1. HBc expression promotes tumor formation of hepatoma cells in nude mice. A) Western blot analysis was assessed to confirm stable HBc expression in Huh7, HepG2, and Hep3B cells. B) In vivo subcutaneous tumor growth curves of HBcexpressing hepatoma cells and control cells (n = 5). *P , 0.05 vs. control cells. C ) Images of all 5 harvested subcutaneous tumors from 5 nude mice of each group. D) Total tumor weight from each group of mice was calculated and shown. *P , 0.05. E ) H&E stained images of representative subcutaneous tumors. 3036
Vol. 32
June 2018
The FASEB Journal x www.fasebj.org
LIU ET AL.
HepG2, and Hep3B cells after stable transfection with HBc. HBc expression was found to promote significant colony formation (Fig. 2A–D) and proliferation (Fig. 2E) of Huh7, HepG2, and Hep3B cells. A similar result was obtained with HepG2 cells transfected with 1.2-unit lengths of the HBV genome (pRep-HBV), showing the enhanced cellular proliferation compared to control (Fig. 2F, G). Transfection of the HBc mutant pRep-HBV-HBc(2) into HepG2 reduced cellular proliferation compared to cells transfected with pRep-HBV. These data show that HBc expression could promote tumor formation of hepatoma cells in vivo and in vitro. HBc expression activates the Src/PI3K/Akt signaling pathway in hepatoma cells To characterize the mechanistic signaling pathway underlying tumor formation induced by HBc expression in hepatoma cells, a cell proliferation assay was performed in HBc-expressing Huh7 and HepG2 cells after treatment with small-molecule inhibitors against Src (PP2; saracatinib), PI3K (LY294002; Wortmannin), ERK (PD98059), MEK (U0126), p38/MAPK (SB203580), and NF-kB (PDTC, BAY117082). No significant change in the proliferation ratio was observed after PD98059, U0126, SB203580, PDTC, and BAY117082 treatment compared with DMSO treatment in Huh7-HBc and HepG2-HBc cells (Fig. 2H, I). However, a considerable inhibition of the proliferation ratio was noted after PP2, saracatinib, LY294002, and Wortmannin treatment compared with DMSO treatment in Huh7-HBc and HepG2-HBc cells. Moreover, Western blot analysis showed that the total Src level and the active phosphorylation level of Src(Tyr416) and Akt(Ser473) were much higher in Huh7-HBc cells than in Huh7pcDNA3.1 cells (Fig. 3A), indicating that HBc expression could activate Src and Akt signals in hepatoma cells. Together, these results clearly indicated that both Src and PI3K/Akt signaling pathways may be involved in tumor formation induced by HBc expression. To further illuminate the regulatory relationship between Src and PI3K/Akt signals activation induced by HBc expression, Western blot analysis was performed in Huh7 cells after Src and PI3K/Akt signal inhibition. To assess RNA interference knockdown effect on Src and Akt signals activation, siRNAs against Src and against Akt were prepared and transfected into Huh7 cells to evaluate their knockdown efficiency by using qPCR (data not shown) and Western blot analysis. Specific Src inhibitor PP2 treatment or Src siRNA cotransfection reversed increased the phosphorylation level of Akt(Ser473) in Huh7-HBc cells, suggesting that HBc promotes PI3K/Akt activation through the Src signaling pathway (Fig. 3A, B). To clarify the functional role of Src tyrosine kinase activation in HBc-induced Akt activation, kinase dead mutant Src K295M plasmid cotransfection was used to compete with endogenous Src tyrosine kinase activity. Inhibition of Src tyrosine kinase activation mediated by Src K295M plasmid transfection could dramatically reverse the upregulated phosphorylation level of Akt(Ser473) in Huh7HBc cells (Fig. 3C). However, blockade of PI3K activity with its specific inhibitor LY294002, which could significantly HBC PROMOTES SRC-MEDIATED HEPATOCARCINOGENESIS
down-regulate the increased Akt(S473) phosphorylation level, had no effect on the enhanced Src(Tyr416) phosphorylation level induced by HBc expression (Fig. 3D). Consistent with the aforementioned phenomenon, both inhibition of endogenic Akt expression with Akt siRNA transfection and prohibition of endogenic Akt kinase activity with dominant–negative mutant Akt K179M plasmid transfection decreased the Akt(Ser473) phosphorylation level without an effect on the Src(Tyr416) phosphorylation level in Huh7-HBc cells (Fig. 3E, F). In addition, HBc overexpression significantly increased total Src and pSrc (Tyr416) levels in a dose-dependent manner (Fig. 3G). The changes of phosphorylated Src relative to total Src were calculated (Fig. 3H). These results show that HBc expression could induce PI3K/Akt activation via inducing Src tyrosine kinase activity in hepatoma cells. HBc enhances Src expression by activating alternative Src 1A promoter in an Sp1-dependent manner It has been reported that elevated total Src expression was associated with HCC (25, 26). HBc appears to have the most pathogenic potential. To evaluate the effect of HBc on Src gene expression, multiple HBc stably expressing hepatoma cells were used. The result showed that the expression of HBc significantly increased the Src mRNA and protein levels in Huh7, HepG2, and Hep3B cells (Fig. 4A, B), indicating that HBc may regulate Src gene expression at the transcriptional level. Alternative promoters allow for increased spatial and temporal diversity in expression patterns for a single gene. The human Src gene, encoding the nonreceptor Src tyrosine kinase, is regulated by 2 alternative promoters separated by ;1 kb. Both Src 1a and 1A promoters were identified recently, resulting in 2 different Src transcripts that are identical in coding capacity, but differ in their 59 noncoding extremity (19, 20). However, none suitable qPCR primers could be designed to distinguish the 2 Src transcripts regulated by HBc. To this end, cells were transfected with an Src promoter-driven luciferase reporter construct pGL4.10-Src 1a or pGL4.10Src 1A, to evaluate changes in possible HBc-regulated promoter activation. HBc-expressing Huh7-HBc and HepG2-HBc cells demonstrated a significant increase in Src 1A rather than 1a reporter gene activity, relative to respective control cells (Fig. 4C, D). Mechanistically, Sp1 and hnRNPK are capable of transactivating the SRC1A promoter, whereas Sp3 can repress Sp1-dependent transactivation, presumably through binding site competition (19, 27). To further investigate the mechanism underlying HBc-enhanced Src transcription, we examined whether HBc could directly affect the expression of Sp1, Sp3, and hnRNP K. We found that ectopic expression of HBc in hepatoma cells increased Sp1 mRNA and protein levels but caused no significant changes in Sp3 or hnRNP K expression (Fig. 4E, F). Furthermore, Huh7-HBc and HepG2-HBc cells demonstrated a significant increase in Sp1 reporter gene activity relative to respective control cells (Fig. 4G). HBc could not physically interact with endogenous Sp1, Sp3, and hnRNP K by coimmunoprecipitation assay (data not shown). 3037
Figure 2. HBc expression promotes oncogenesis in hepatoma cells. A) Effect of HBc overexpression on the colony formation of hepatoma cells. B) Quantification of colonies. *P , 0.05, vs. control. C ) Soft agar formation assay for hepatoma cells stably transfected with empty vector and HBc plasmid. D) Quantification of colonies. *P , 0.05 vs. control. E ) Cell proliferation assay for hepatoma cells stably transfected with empty vector and HBc plasmid. *P , 0.05 vs. control. F ) Expression of HBc in HepG2pRep HBV and HepG2-pRep HBV HBc(2) cells were assessed by Western blot analysis. G) Cell proliferation assay in HepG2 cells. *P , 0.05 vs. control. H, I ) Cell proliferation assay for hepatoma cells stably transfected with empty vector and HBc plasmid, after treatment for 24 h with DMSO, PP2 (10 mM), saracatinib (1 mM), LY294002 (50 mM), Wortmannin (10 nM), PD098059 (50 mM), U0126 (20 mM), SB203580 (10 mM), PDTC (10 mM), and BAY117082 (10 mM). *P , 0.05. 3038
Vol. 32
June 2018
The FASEB Journal x www.fasebj.org
LIU ET AL.
A
B
C
-
-
+
-
DMSO
-
-
+
-
NC siRNA
-
-
+
-
Src WT
-
-
-
+
PP2
-
-
-
+
Src siRNA
-
-
-
+
Src K295M
pSrc (Tyr416)
pSrc (Tyr416) pSrc (Tyr416)
Src
Src
Src
pAKT (Ser473)
pAKT (Ser473)
pAKT (Ser473)
AKT
AKT
AKT
β-tubulin
β-tubulin
β-tubulin
D
E
-
+ -
+
DMSO LY294002
-
-
+ -
-
NC siRNA Akt siRNA
-
+ -
+
Akt WT Akt K179M
pSrc (Tyr416)
pSrc (Tyr416)
pSrc (Tyr416)
Src
Src
Src
pAKT (Ser473)
pAKT (Ser473)
pAKT (Ser473)
AKT
AKT
AKT
β-tubulin
β-tubulin
β-tubulin
G HBc
+
H
6
-
pSrc (Tyr416)
5
pSrc (Tyr416)
Src
HBc β-tubulin
Relative density
-
F
Src
4 3
HepG2
2 1 0 0
0.5
1
2
4
HBc (μg)
Figure 3. HBc expression activates Src/PI3K/Akt signaling pathway in hepatoma cells. A) Western blot analysis for HBc-expressing Huh7 cells during treatment for 24 h with PP2 (10 mM). B) Western blot analysis for HBc-expressing Huh7 cells transiently transfected with empty vector, nonsilencing (NS) siRNA, or Src siRNA. C) Western blot analysis for HBc-expressing Huh7 cells transiently transfected with empty vector, Src wild-type (WT) plasmid or Src K295M plasmid. D) Western blot analysis for HBc-expressing Huh7 cells during treatment for 24 h with LY294002 (50 mM). E) Western blot analysis for HBc-expressing Huh7 cells transiently transfected with empty vector, nonsilencing (NS) siRNA, or Akt siRNA. F) Western blot analysis for HBc-expressing Huh7 cells transiently transfected with empty vector, Akt WT plasmid, or Akt K179M plasmid. G) Western blot analysis for HepG2 cells transiently transfected with different doses of HBc plasmid. H) The changes of phosphorylated Src relative to total Src cumulative data from 3 experiments are shown.
To test whether HBc binds Src gene promoter, we performed a ChIP assay in HepG2-HBc cells with specific antibodies against Sp1 and FLAG-tagged HBc and PCR, HBC PROMOTES SRC-MEDIATED HEPATOCARCINOGENESIS
using the primers to amplify the fragments within the Src promoter region corresponding to the Sp1 binding sites. The ChIP data indicated that the antibody to FLAG for 3039
A
pcDNA3.1 IgG
1
pcDNA3.1
I
0
Huh7
HepG2
D 2
*
Huh7
HepG2
pGL4.10
*
1
pcDNA3.1
HepG2
pGL4.10-Src 1A
Huh7
*
2
*
1
0
pcDNA3.1 + -
HBc + -
HBc +
HBc
HepG2
pGL4.10
E
NC siRNA-Sp1
pGL4.10-Src 1A Huh7
J
0
Huh7
Huh7 Relative luciferase activity
HBc
pGL4.10-Src 1α Relative luciferase activity
Hep3B
*
2
Relative Src mRNA level
Relative luciferase activity
HepG2
HepG2
pGL4.10
HBc anti-Sp1
H
1
Huh7
Huh7
HBc IgG
*
pcDNA3.1 anti-Sp1
* *
pcDNA3.1 IgG
HBc
0
C
HepG2
pGL4.10-Sp1
HBc input
Relative Src mRNA level
pcDNA3.1 2
Huh7
pcDNA3.1 input
B
0
HBc IgG
β-tubulin
pcDNA3.1 HBc
1
HBc anti-FLAG
Src
*
*
2
pcDNA3.1 anti-FLAG
Relative luciferase activity
G
*
1
0
pcDNA3.1
HBc
HBc Sp1
Sp1
Src Sp3 β-tubulin hnRNP K β-tubulin
Relative Sp1 mRNA level
F
pcDNA3.1 2
*
*
NC
K
HepG2
HBc
*
1
pGL4.10
pGL4.10 -Src1A -Sp1mut
GA2
Luc
GC1
GA2
Luc
pcDNA3.1
pGL4.10 -Src1A 0
HepG2
HBc
Luc
GC1
0
Huh7
NC siRNA-Sp1
3
6
9
12
15
Relative luciferase activity
Hep3B
Figure 4. HBc enhances Src expression by activating alternative Src 1A promoter in an Sp1-dependent manner. A, B) mRNA and protein levels of Src in HepG2, Huh7, and Hep3B cells infected with HBc. *P , 0.05. C, D) Transcriptional regulation of Src 1a or Src 1A by HBc. Huh7 and HepG2 cells expressing HBc were cotransfected with pGL4.10-Src 1a or Src 1A containing the Src 1a or Src 1A promoter sequence and the Renilla luciferase expression vector pRL-TK. The level of promoter activity was evaluated (continued on next page)
3040
Vol. 32
June 2018
The FASEB Journal x www.fasebj.org
LIU ET AL.
capture of the FLAG-tagged HBc did not immunoprecipitate the corresponding Src promoter region, but enhanced the ability of Sp1 binding Src promoter region (Fig. 4H). To confirm that HBc-induced Src expression was mediated through Sp1, we knocked down the expression of Sp1 transcription factor in Huh7-pcDNA3.1 or Huh7-HBc cells and measured the Src 1A promoter activity. Knockdown of Sp1 reduced the HBc-mediated Src 1A luciferase activities (Fig. 4I). Meanwhile, the expression of Src at both the mRNA and protein (Fig. 4J) levels was also reduced significantly. To further determine whether Sp1 were involved in HBc-related Src gene transcription, we introduced Src 1A promoter mutations in the binding sites for Sp1. We found that mutations at Sp1 binding site significantly decreased the HBc-induced promoter activity (Fig. 4K). These data suggest that Sp1 is essential for HBc-mediated Src 1A promoter activation and Src transcription.
HBc activates Src tyrosine kinase activity by switching inactive pSrc (Tyr527) to active pSrc (Tyr416) Src tyrosine kinase activity is regulated by tyrosine phosphorylation at 2 distinct sites, Tyr416 and Tyr527, with opposite effects (28). Phosphorylation of Tyr416 in the activation loop of the kinase domain up-regulates enzyme activity, whereas phosphorylation of Tyr527 in the carboxyterminal tail renders the enzyme inactive (29). Elevated Src kinase activity induced by increased pSrc (Tyr416) and decreased pSrc (Tyr527) was associated with a poor patient survival, implying that activated Src contributes to malignant transformation of hepatocytes (9, 30, 31). The expression of HBc significantly increased pSrc (Tyr416) but decreased the pSrc (Tyr527) protein levels in hepatoma cells, mouse xenograft tumor tissues, and clinical samples (Fig. 5A–C), indicating that HBc may regulate Src tyrosine kinase activity through control of its phosphorylation state. To further investigate the mechanism underlying HBc-enhanced Src activity, we examined whether HBc could directly affect the expression of upstream Src protein tyrosine kinases and phosphatases (29). It has been reported that inactivated Tyr527 phosphorylation of Src is mainly catalyzed by Csk (32). Furthermore, we found that ectopic expression of HBc in hepatoma cells decreased Csk mRNA and protein levels (Fig. 5D, E), but
caused no significant changes in MATK, PTPN1, PTPN6, PTPN11, PTPRA, and PTPRG expression (data not shown). To confirm that HBc-induced Src phosphorylation is mediated through Csk, Csk was overexpressed in Huh7-HBc cells and Src phosphorylation was performed. Csk overexpression reduced the HBc-mediated Src activation (Fig. 5F). Furthermore, HBc did not physically interact with endogenous Src in a coimmunoprecipitation assay (Fig. 5G, H). These data suggest that HBc may activate Csk-dependent Src tyrosine kinase activity by the dual effects of reducing the expression of the inactive form of Src and enhancing the expression of the active form of the kinase. HBc expression promotes hepatoma cellular proliferation and G1–S cell cycle progression through Src activation To further characterize the potential oncogenic role of HBc-induced Src kinase activation in hepatoma cells, we examined cellular proliferation rate and cell cycle status after Src signal suppression in HepG2-HBc cells. Western blot analysis for the proliferative cell marker PCNA (Fig. 6A) and a cell proliferation assay (Fig. 6B) showed that increased cellular proliferation of HepG2-HBc cells was reversed by endogenous Src kinase inhibition with kinase dead mutant Src K295M cotransfection. Furthermore, flow cytometric analysis of cell cycle status revealed that induced G1–S cell cycle progression of HepG2-HBc cells was also reversed by Src kinase inhibition with Src K295M cotransfection (Fig. 6C, D). Western blot analysis for cell cycle regulators showed that, despite no alteration with CDK2 and CDK6 protein levels after HBc expression, increased Cyclin D1, Cyclin E1, and CDK4 protein levels, along with decreased p21 and p27 were reversed by cotransfection with Src K295M in HepG2-HBc cells (Fig. 6E). These results indicate that HBc expression could promote Src-mediated cellular proliferation and G1–S cell cycle progression in hepatoma cells. Saracatinib administration inhibits tumor formation induced by HBc expression To further determine whether Src signal activation induced by HBc expression could be used as a novel molecular therapeutic target in HBV-associated hepatocarcinogenesis,
48 h after transfection by measuring the luciferase activity normalized for variations in transfection efficiency and expressed as the fold change relative to the untreated Huh7 and HepG2 cells. Data are means 6 SD (n = 5). *P , 0.05. E ) Protein levels of Sp1, Sp3, or hnRNP K in HepG2, Huh7, and Hep3B cells infected with HBc. F ) mRNA levels of Sp1 in HepG2, Huh7, and Hep3B cells infected with HBc. *P , 0.05. G) Transcriptional regulation of Sp1 by HBc. Huh7 and HepG2 HBc-expressing cells were cotransfected with pGL4.10-Sp1 containing the Sp1 promoter sequence and the Renilla luciferase expression vector pRL-TK. Data are means 6 SD (n = 5). *P , 0.05. H ) ChIP assays were performed to confirm the interaction of HBc with the promoter region of Src. Lysates of HepG2 cells transfected with pcDNA3.1-HBc underwent ChIP with antibodies against FLAG-tagged HBc and Sp1. PCR was conducted with immunoprecipitated DNA. Primers covered the Sp1 binding site. An empty vector and an isotype control IgG served as external and internal controls, respectively. I ) Luciferase activities were measured in HBc-expressing Huh7 cells cotransfected with pGL4.10-Src 1A (0.2 mg/well) and Sp1 siRNA (100 nM) or control siRNA (NC; 100 nM). J ) Expression of Src was detected by qPCR and Western blot analysis in HBc-expressing Huh7 cells transfected with control siRNA (NC; 100 nM) or Sp1 siRNA (100 nM). Data are means 6 SD of 3 independent experiments after being normalized to Huh7-HBc. *P , 0.05. K ) Luciferase activities were measured in HBc-expressing HepG2 cells transfected with empty vector or 0.2 mg/well pGL4.10-Src 1A or pGL4.10-Src 1A-Sp1mut. HBC PROMOTES SRC-MEDIATED HEPATOCARCINOGENESIS
3041
A
Mouse Xenograft Tumor Tissues
B HBc
pSrc (Tyr416) pSrc (Tyr527)
Src
HepG2-pcDNA3.1
pSrc (Tyr416) pSrc (Tyr527) Src
HepG2-HBc
β-tubulin
C Case 1 NT
HCC
Case 2
Case 3
Case 4
NT
NT
NT
HCC
HCC
D
HCC
pSrc (Tyr416) Csk
pSrc (Tyr527)
β-tubulin Src
HBc
β-tubulin
E Relative Csk mRNA level
pcDNA3.1
*
1
F + -
HBc
*
+ -
*
+
pcDNA3.1 Csk pSrc (Tyr416) pSrc (Tyr527)
Src
0.5
Csk
G
Huh7 pcDNA3.1
HepG2
H
HBc
WB：Src HepG2
β-tubulin
Hep3B pcDNA3.1
HepG2
0
WB：HBc
HBc
WB：HBc WB：Src
Figure 5. HBc enhances Src tyrosine kinase activity by switching inactive pSrc (Tyr527) to active pSrc (Tyr416). A) Western blot analysis of HBc-expressing Huh7, HepG2, or Hep3B cells. B) Mouse xenograft tumor tissues detected by immunohistochemistry assay. Original magnification, 3400. C ) Western blot analysis showing the protein levels of phosphorylated and total Src in HCC tissues and the corresponding noncancerous tissues from 4 randomly chosen patients. D, E ) mRNA and protein levels of Csk in HepG2, Huh7, and Hep3B cells infected with HBc. *P , 0.05. F ) Expression of phosphorylated and total Src was detected by Western blot in HBc-expressing HepG2 cells transfected with pcDNA3.1 or pcDNA3.1-Csk. G, H ) Interaction between HBc and Src, as determined by coimmunoprecipitation assay. HBc was immunoprecipitated with anti-HBc antibody, and Src was detected by Western blot analysis with specific antibodies. Reciprocal coimmunoprecipitation was performed with Src antibodies, and HBc was detected by Western blot analysis with anti-HBc antibody. Normal IgG served as a control.
3042
Vol. 32
June 2018
The FASEB Journal x www.fasebj.org
LIU ET AL.
D
A -
-
+
-
Src WT
-
-
-
+
Src K295M
Cell Cycle Distribution (%)
100%
PCNA Src β-tubulin
B
80%
60%
G2/M S
40%
G0/G1
20%
0%
pcDNA3.1
1
HBc
HepG2-pcDNA3.1
HBc+Src HBc+Src WT K295M
HepG2-HBc
Absorbance at 450 nm
HepG2-HBc+Src WT
*
HepG2-HBc+Src K295M
*
0.5
E
0 0
24
48
HepG2-pcDNA3.1
-
+
-
Src WT
-
-
-
+
Src K295M
72
Time (hours)
C
-
Cyclin D1 HepG2-HBc
Cyclin E1 p21 p27 CDK2 CDK4 CDK6
HBc + Src WT
HBc + Src K295M Src β-tubulin
Figure 6. HBc expression promotes cellular proliferation and G1–S cell cycle progression via Src activation in hepatoma cells. A) Western blot analysis for HepG2 cells after transfection with empty vector, HBc plasmid, or cotransfected HBc plasmid with Src wild-type (WT) plasmid or Src K295M plasmid together. B) Cell proliferation assay for Huh7 cells. *P , 0.05. C, D) Analysis for cell cycle status of HepG2 cells. E ) Western blot analysis for HBc-expressing HepG2 cells transiently transfected with empty vector, Src WT plasmid or Src K295M plasmid.
cell proliferation rate and tumor formation were assessed in HBc stably expressing Huh7 and HepG2 cells after a specific Src inhibitor saracatinib treatment, which was used to suppress Src kinase activity. Results of the cell proliferation assay showed that saracatinib HBC PROMOTES SRC-MEDIATED HEPATOCARCINOGENESIS
treatment significantly attenuated the promotion of hepatoma cellular proliferation induced by Huh7-HBc and HepG2-HBc cells (Fig. 7A, B). More important, tumor xenograft experiments in nude mice showed that oral saracatinib administration inhibited tumor 3043
B
A pcDNA3.1+DMSO
1
pcDNA3.1+DMSO
1
pcDNA3.1+Saracatinib
Absorbance at 450 nm
Absorbance at 450 nm
pcDNA3.1+Saracatinib HBc+DMSO
0.8
*
HBc+Saracatinib 0.6
Huh7
*
0.4
0.2
0
0.8
HBc+DMSO
HepG2
0.2
24
48
72
0
24
Time (hours)
D
2
2
Tumor weight (g)
1.6
pcDNA3.1+Saracatinib HBc+Saracatinib
0.8
72
Huh7
HBc+DMSO
1.2
48
Time (hours)
pcDNA3.1+DMSO
Tumor volume (cm3)
*
0.4
0 0
C
*
HBc+Saracatinib 0.6
*
Huh7
*
*
1.5 1
*
0.5 0
0.4
0 0
3
6
9
12
15
18
21
24
27
Time (days)
E
2
F
HBc+DMSO pcDNA3.1+DMSO pcDNA3.1+Saracatinib
Tumor weight (g)
Tumor volume (cm3)
1.6
HBc+Saracatinib
1.2
HepG2 2
* 0.8
HepG2
*
0.4
*
1.5 1
*
0.5 0
0 0
3
6
9
12
15
18
21
24
27
Time (days)
Figure 7. Saracatinib(AZD0530) administration alleviates promotion of tumor formation induced by HBc expression. A, B) Cell proliferation assay for Huh7 (A) and HepG2 (B) cells after stable HBc expression during treatment with saracatinib (1 mM). *P , 0.05. C, D) In vivo subcutaneous tumor growth curves (C ) and tumor weight quantification (D) of intersected subcutaneous tumor tissues of Huh7 cells after stable HBc expression during treatment (25 mg/kg body weight daily for 4 wk; n = 12). *P , 0.05. E, F) In vivo subcutaneous tumor growth curves (E ) and tumor weight quantification (F ) of intersected subcutaneous tumor tissues of HepG2 cells after stable HBc expression during saracatinib treatment (25 mg/kg body weight daily for 4 wk; n = 12). *P , 0.05.
formation induced by stable HBc expression in Huh7 and HepG2 cells (Fig. 7C–F). These results show that saracatinib administration suppressed cellular proliferation in vitro and tumor formation in vivo through intervening Src signal activation conferred by HBc expression, which could be used as a therapeutic target for HBV-associated HCC. 3044
Vol. 32
June 2018
DISCUSSION Hepatocellular tumorigenesis, mainly induced by prosurvival signals, is implicated in several experimental and human liver diseases, including viral hepatitis and HCC. Therefore, identification of pro- and antisurvival pathways related to prosurvival signaling–mediated
The FASEB Journal x www.fasebj.org
LIU ET AL.
hepatocarcinogenesis would be an important contribution to the understanding of the pathophysiological role of proliferation in the major liver diseases. Src activation has been shown to be involved in HBVmediated HCC (7, 8, 33), but a role for HBc in hepatocarcinogenesis has not been documented. In this study, we demonstrated for the first time that HBV core protein is a strong prosurvival factor capable of promoting tumorigenesis of hepatoma cells dependent on Src/PI3K/Akt signal activation in vitro and in vivo. The possibility that HBc functions as a gene regulatory protein arises from its arginine-rich C-terminal properties including the presence of nucleic acid-binding motifs (34), nuclear localization signals (35) and phosphorylation sites (36). Several studies have suggested that HBc has the ability to bind to a large number of human gene promoters and can disrupt normal host gene expression. For example, HBc has been shown to be a transcriptional repressor of the human p53 gene through the transcription factor E2F1 binding site at the p53 promoter (16). More recently, whole-genome chromatin immunoprecipitation microarray (ChIP-on-chip) analysis revealed that HBc could disrupt expression of 3100 human host genes by binding to promoter regions (37). To gain further insight into molecular mechanisms that may contribute to the up-regulation of Src by HBc, we investigated the expression and correlation of Sp1, Sp3, and hnRNP K, all of which are known to regulate Src 1A transcription. It has been reported that Sp1 and hnRNP K are capable of activating the Src 1A promoter and that Sp3 is also capable of inhibiting Sp1mediated transactivation (19). In keeping with this, we found that forced expression of HBc in hepatoma cells resulted in a significant increase in Src level that was accompanied by an increase in Sp1 expression. We cannot exclude the possibility that HBc also directly promotes Src transcription, but it is tempting to suggest a model in which HBc serves as a transcriptional activator of Sp1, which in turn regulates Src expression at the transcriptional level. Furthermore, Sp1 may activate itself at the transcription level through autoregulation (21). However, the role of HBc in Sp1-mediated self-activation remains to be clarified and explored. One study indicated that HBc promotes hepatocellular carcinoma cell proliferation by up-regulating the c-Ets2dependent expression of human telomerase reverse transcripts (38). However, an important addition from our study to current knowledge about the biologic function of HBc is its previously unrecognized role in regulating expression of the active form of Src kinase. The catalytic activity of Src is suppressed by phosphorylation on the tyrosine residue Tyr527, which is mainly catalyzed by Csk (32). Specifically, Csk is reduced in HCC as compared to normal liver tissue, and this altered expression correlates with enhanced Src activity (39). It may be worth noting that HBc expression also significantly inhibited the expression of Csk in hepatoma cells. However, the molecular mechanisms responsible for HBc-mediated Csk expression and the role of Csk suppression by HBc in HBV-infected hepatocytes remain to be determined. HBC PROMOTES SRC-MEDIATED HEPATOCARCINOGENESIS
Our current study also elucidated the potential therapeutic effect of the oral Src-specific inhibitor saracatinib on hepatoma cell-xenografted tumors in nude mice, which merits further clinical investigation in patients with HBV-associated HCC to assess its feasible therapeutic efficiency. Despite extensive preclinical evidence which warrants targeting Src as a promising therapeutic approach for cancer, saracatinib show only minimal therapeutic activity in various types of solid tumors including HBV-associated HCC as a single agent in recent early-phase clinical trials (40). Given the intrinsic complexity of Src signaling and redundant pathways involved in tumor development, the translation into the clinic from numerous preclinical studies on Src and its role in cancer is challenging. However, preselection of potential responders to anti-Src therapies or combination of Src-targeting agents with firstline or other types of cancer therapies may enhance the clinical benefit. Innovative design of clinical studies that rationally and seamlessly integrate preclinical knowledge is critical for the development of Srctargeting therapies and it represents another frontier for successful translational cancer research. In summary, to our knowledge, this report is the first demonstration to date that hepatitis B viral core protein serves to promote Src kinase activation by repressing the expression of Csk at a transcriptional level and increasing Src expression by facilitation of Sp1 transcription factor. Our results suggest that HBc may promote Src-mediated hepatocarcinogenesis, thus contributing to the survival and persistence of infected hepatocytes toward the development of chronic HBV infection. ACKNOWLEDGMENTS This work was supported by National Natural Science Foundation of China Grant 31600134, Key Laboratory of Tumor Microbiology, Fujian Medical University (Open Research Fund, Grant FMUTM-201704). The authors declare no conflicts of interest.
AUTHOR CONTRIBUTIONS T.-F. Guo and Z.-T. Jing designed and performed the experiments and analyzed the results, with guidance from W. Liu and Q.-Y. Tong; Z. Yang and X. Lin optimized and performed qPCR and Western blot assays; L. Liu and Y.-P. Yang provided expertise and contributed to the animal studies and the immunohistochemistry staining of mouse tissues; W. Liu conceptualized the project and contributed to the writing and editing of the manuscript; and all authors reviewed and approved the manuscript. REFERENCES 1. Lok, A. S., Heathcote, E. J., and Hoofnagle, J. H. (2001) Management of hepatitis B: 2000—summary of a workshop. Gastroenterology 120, 1828–1853 2. Kew, M. C. (2010) Epidemiology of chronic hepatitis B virus infection, hepatocellular carcinoma, and hepatitis B virus-induced hepatocellular carcinoma. Pathol. Biol. (Paris) 58, 273–277 3045
3. Br´echot, C. (2004) Pathogenesis of hepatitis B virus-related hepatocellular carcinoma: old and new paradigms. Gastroenterology 127 (5 suppl 1), S56–S61 4. Neuveut, C., Wei, Y., and Buendia, M. A. (2010) Mechanisms of HBVrelated hepatocarcinogenesis. J. Hepatol. 52, 594–604 5. Whittaker, S., Marais, R., and Zhu, A. X. (2010) The role of signaling pathways in the development and treatment of hepatocellular carcinoma. Oncogene 29, 4989–5005 6. Aravalli, R. N., Steer, C. J., and Cressman, E. N. (2008) Molecular mechanisms of hepatocellular carcinoma. Hepatology 48, 2047–2063 7. Klein, N. P., and Schneider, R. J. (1997) Activation of Src family kinases by hepatitis B virus HBx protein and coupled signaling to Ras. Mol. Cell. Biol. 17, 6427–6436 8. Liu, H., Xu, J., Zhou, L., Yun, X., Chen, L., Wang, S., Sun, L., Wen, Y., and Gu, J. (2011) Hepatitis B virus large surface antigen promotes liver carcinogenesis by activating the Src/PI3K/Akt pathway. Cancer Res. 71, 7547–7557 9. Ito, Y., Kawakatsu, H., Takeda, T., Sakon, M., Nagano, H., Sakai, T., Miyoshi, E., Noda, K., Tsujimoto, M., Wakasa, K., Monden, M., and Matsuura, N. (2001) Activation of c-Src gene product in hepatocellular carcinoma is highly correlated with the indices of early stage phenotype. J. Hepatol. 35, 68–73 10. Jeong, H., Cho, M. H., Park, S. G., and Jung, G. (2014) Interaction between nucleophosmin and HBV core protein increases HBV capsid assembly. FEBS Lett. 588, 851–858 11. Shim, H. Y., Quan, X., Yi, Y. S., and Jung, G. (2011) Heat shock protein 90 facilitates formation of the HBV capsid via interacting with the HBV core protein dimers. Virology 410, 161–169 12. Li, H. C., Huang, E. Y., Su, P. Y., Wu, S. Y., Yang, C. C., Lin, Y. S., Chang, W. C., and Shih, C. (2010) Nuclear export and import of human hepatitis B virus capsid protein and particles. PLoS Pathog. 6, e1001162 13. Milich, D. R., and McLachlan, A. (1986) The nucleocapsid of hepatitis B virus is both a T-cell-independent and a T-cell-dependent antigen. Science 234, 1398–1401 14. Yin, Y., Wu, C., Song, J., Wang, J., Zhang, E., Liu, H., Yang, D., Chen, X., Lu, M., and Xu, Y. (2011) DNA immunization with fusion of CTLA-4 to hepatitis B virus (HBV) core protein enhanced Th2 type responses and cleared HBV with an accelerated kinetic. PLoS One 6, e22524 15. Chen, X., Li, M., Le, X., Ma, W., and Zhou, B. (2004) Recombinant hepatitis B core antigen carrying preS1 epitopes induce immune response against chronic HBV infection. Vaccine 22, 439–446 16. Kwon, J. A., and Rho, H. M. (2003) Transcriptional repression of the human p53 gene by hepatitis B viral core protein (HBc) in human liver cells. Biol. Chem. 384, 203–212 17. Liu, W., Lin, Y. T., Yan, X. L., Ding, Y. L., Wu, Y. L., Chen, W. N., and Lin, X. (2015) Hepatitis B virus core protein inhibits Fas-mediated apoptosis of hepatoma cells via regulation of mFas/FasL and sFas expression. FASEB J. 29, 1113–1123 18. Du, J., Liang, X., Liu, Y., Qu, Z., Gao, L., Han, L., Liu, S., Cui, M., Shi, Y., Zhang, Z., Yu, L., Cao, L., Ma, C., Zhang, L., Chen, Y., and Sun, W. (2009) Hepatitis B virus core protein inhibits TRAIL-induced apoptosis of hepatocytes by blocking DR5 expression. Cell Death Differ. 16, 219–229 19. Ritchie, S., Boyd, F. M., Wong, J., and Bonham, K. (2000) Transcription of the human c-Src promoter is dependent on Sp1, a novel pyrimidine binding factor SPy, and can be inhibited by triplexforming oligonucleotides. J. Biol. Chem. 275, 847–854 20. Bonham, K., Ritchie, S. A., Dehm, S. M., Snyder, K., and Boyd, F. M. (2000) An alternative, human SRC promoter and its regulation by hepatic nuclear factor-1alpha. J. Biol. Chem. 275, 37604–37611 21. Nicol´as, M., No´e, V., Jensen, K. B., and Ciudad, C. J. (2001) Cloning and characterization of the 59-flanking region of the human transcription factor Sp1 gene. J. Biol. Chem. 276, 22126–22132 22. Wu, Y. L., Peng, X. E., Zhu, Y. B., Yan, X. L., Chen, W. N., and Lin, X. (2015) Hepatitis B virus X protein induces hepatic steatosis by enhancing the expression of liver fatty acid binding protein. J. Virol. 90, 1729–1740
3046
Vol. 32
June 2018
23. Lin, Y. J., Huang, L. R., Yang, H. C., Tzeng, H. T., Hsu, P. N., Wu, H. L., Chen, P. J., and Chen, D. S. (2010) Hepatitis B virus core antigen determines viral persistence in a C57BL/6 mouse model. Proc. Natl. Acad. Sci. USA 107, 9340–9345 24. Chen, J. Y., Chen, W. N., Jiao, B. Y., Lin, W. S., Wu, Y. L., Liu, L. L., and Lin, X. (2014) Hepatitis B spliced protein (HBSP) promotes the carcinogenic effects of benzo [alpha] pyrene by interacting with microsomal epoxide hydrolase and enhancing its hydrolysis activity. BMC Cancer 14, 282 25. Wheeler, D. L., Iida, M., and Dunn, E. F. (2009) The role of Src in solid tumors. Oncologist 14, 667–678 26. Lau, G. M., Lau, G. M., Yu, G. L., Gelman, I. H., Gutowski, A., Hangauer, D., and Fang, J. W. (2009) Expression of Src and FAK in hepatocellular carcinoma and the effect of Src inhibitors on hepatocellular carcinoma in vitro. Dig. Dis. Sci. 54, 1465–1474 27. Ritchie, S. A., Pasha, M. K., Batten, D. J., Sharma, R. K., Olson, D. J., Ross, A. R., and Bonham, K. (2003) Identification of the SRC pyrimidine-binding protein (SPy) as hnRNP K: implications in the regulation of SRC1A transcription. Nucleic Acids Res. 31, 1502–1513 28. Yeatman, T. J. (2004) A renaissance for SRC. Nat. Rev. Cancer 4, 470–480 29. Frame, M. C. (2002) Src in cancer: deregulation and consequences for cell behaviour. Biochim. Biophys. Acta 1602, 114–130 30. Masaki, T., Okada, M., Shiratori, Y., Rengifo, W., Matsumoto, K., Maeda, S., Kato, N., Kanai, F., Komatsu, Y., Nishioka, M., and Omata, M. (1998) pp60c-src activation in hepatocellular carcinoma of humans and LEC rats. Hepatology 27, 1257–1264 31. Chen, M. L., Chai, C. Y., Yeh, K. T., Wang, S. N., Tsai, C. J., Yeh, Y. T., and Yang, S. F. (2011) Crosstalk between activated and inactivated cSrc in hepatocellular carcinoma. Dis. Markers 30, 325–333 32. Levinson, N. M., Seeliger, M. A., Cole, P. A., and Kuriyan, J. (2008) Structural basis for the recognition of c-Src by its inactivator Csk. Cell 134, 124–134 33. Bouchard, M., Giannakopoulos, S., Wang, E. H., Tanese, N., and Schneider, R. J. (2001) Hepatitis B virus HBx protein activation of cyclin A-cyclin-dependent kinase 2 complexes and G1 transit via a Src kinase pathway. J. Virol. 75, 4247–4257 34. Hatton, T., Zhou, S., and Standring, D. N. (1992) RNA- and DNAbinding activities in hepatitis B virus capsid protein: a model for their roles in viral replication. J. Virol. 66, 5232–5241 35. Eckhardt, S. G., Milich, D. R., and McLachlan, A. (1991) Hepatitis B virus core antigen has two nuclear localization sequences in the arginine-rich carboxyl terminus. J. Virol. 65, 575–582 36. Liao, W., and Ou, J. H. (1995) Phosphorylation and nuclear localization of the hepatitis B virus core protein: significance of serine in the three repeated SPRRR motifs. J. Virol. 69, 1025–1029 37. Guo, Y., Kang, W., Lei, X., Li, Y., Xiang, A., Liu, Y., Zhao, J., Zhang, J., and Yan, Z. (2012) Hepatitis B viral core protein disrupts human host gene expression by binding to promoter regions. BMC Genomics 13, 563 38. Gai, X., Zhao, P., Pan, Y., Shan, H., Yue, X., Du, J., Zhang, Z., Liu, P., Ma, H., Guo, M., Yang, X., Sun, W., Gao, L., Ma, C., and Liang, X. (2013) Hepatitis B virus core protein enhances human telomerase reverse transcriptase expression and hepatocellular carcinoma cell proliferation in a c-Ets2-dependent manner. Int. J. Biochem. Cell Biol. 45, 1174–1185 39. Masaki, T., Okada, M., Tokuda, M., Shiratori, Y., Hatase, O., Shirai, M., Nishioka, M., and Omata, M. (1999) Reduced Cterminal Src kinase (Csk) activities in hepatocellular carcinoma. Hepatology 29, 379–384 40. Zhang, S., and Yu, D. (2012) Targeting Src family kinases in anticancer therapies: turning promise into triumph. Trends Pharmacol. Sci. 33, 122–128
The FASEB Journal x www.fasebj.org
Received for publication October 25, 2017. Accepted for publication December 26, 2017.
LIU ET AL.
