Hepatitis C virus variants from Nepal with novel genotypes ... - CiteSeerX

Journal of General Virology (1994), 75, 931-936. Printed m Great Britain

931

Hepatitis C virus variants from Nepal with novel genotypes and their classification into the third major group Hajime Tokita, 1 Santosh M a n Shrestha, 2 Hiroaki Okamoto,' Minoru Sakamoto, 3 Minoru Horikita, 4 Hisao Iizuka, s Shobhana Shrestha, 2 Yuzo M i y a k a w a 6 and M a k o t o M a y u m i ' * 1Immunology Division, Jichi Medical School, Tochigi-Ken 329-04, Japan, 2Liver Unit, Bir Hospital, Kathmandu, Nepal, 3First Department of Internal Medicine, Yamanashi Medical College, Yamanashi-Ken 409-38, ~ Second Department of Internal Medicine, The University of Tokushima School of Medicine, Tokushima-Ken 770, 5Japanese Red Cross Saitama Blood Center, Saitama-Ken 338, and 6Mita Institute, Tokyo 108, Japan Five isolates o f hepatitis C virus (HCV) RNA from patients with chronic liver disease in Nepal were not classifiable into the known genotypes I/la, II/lb, II1/2a, IV/2b or V/3a using P C R with type-specific primers deduced from the HCV core gene. Their nucleotide sequences were determined for the 5'-terminal 1.5 kilobases and 3'-terminal 1.2 kilobases, covering 30 % of the entire genome, and compared with each other and with reported sequences of HCV isolates of various genotypes. They were more similar to a reported HCV isolate (NZL1) of genotype V/3a (in 81.6 to 84.1% of their nucleotides and 85"7 to 88.7% of the deduced amino acid sequence) compared with the genotypes I / l a

Hepatitis C virus (HCV) has a positive-stranded R N A of about 9400 nucleotides (nt) (Choo et al., 1991), and is the major aetiological agent of acute and chronic non-A, non-B liver diseases (Alter et aL, 1989). As sequence data accumulate on many HCV isolates, a wide range of variability in the HCV genome is becoming apparent. Based on sequence similarity in the entire genome and within parts thereof, HCV isolates are classified into genotypes I, II, III, IV, V and V! (Mori et al., 1992; Okamoto et al., 1992b, d, 1993). Another nomenclature for the classification o f HCV is proposed which defines three major types, 1, 2 and 3, with each type being divided into two subtypes, a and b (Chan et al., 1992;

The nucleotide sequence data reported in this paper have been deposited in the DDBJ, GenBank and EMBL databases under the followingaccessionnumbers: the 5'-terminal 1504 to 1505nucleotides and the 3'-terminal 1141 to 1154 nucleotides for the NE137 isolate (genotype VI/3b) nos. D16616 and D16617, respectively: those for NE048 (3c) nos. D16612 and D16613; those for NE274 (3d) nos. D16620 and D16621 ; those for NE145 (3e) nos. D16618 and D16619; those for NE125 (3/) nos. D166t4 and D16615. 0001-2074 © 1994 SGM

to IV/2b (in 69.3 to 74.7% and 72'3 to 77.4%, respectively). Hence they were considered to be variants of the third major group (group 3). The five HCV isolates shared 81.3 to 85.2% of nucleotide sequence and 85.4 to 89.3 % of deduced amino acid sequence. Thus they were substantially different from each other. One of them was classified as genotype Vl/3b due to an 88-2 % similarity in nucleotide sequence to that of the reported HCV isolates o f this genotype, whereas the remaining four were classified into provisional genotypes 3c, 3d, 3e and 3f. These HCV variants have evolved and remained in Nepal, and have not been observed in the other areas of the world.

Simmonds et al., 1993; Stuyver et al., 1993). Genotype I corresponds to la, II to lb, III to 2a, IV to 2b, V to 3a and VI to 3b. In this paper, we use both nomenclatures to reflect current provisional classifications. In a survey o f HCV markers occurring in 145 patients with chronic liver disease in Nepal, 12 sera were positive for HCV R N A by PCR with nested primers deduced from well conserved areas of the 5' untranslated region (UTR) of the HCV genome (Okamoto et al., 1990; Nagayama et al., 1993). When they were genotyped by PCR with primers specific to the core gene of one or other genotypes I / l a , I I / l b , III/2a, IV/2b and V/3a (Okamoto et al., 1992d, 1993), one was found to be of genotype I / l a , five of I I / l b and one of V/3a. The remaining five were not classifiable into any of these genotypes. Nucleic acids were extracted from 0" 1 to 1"0 ml o f the five untypable sera and reverse-transcribed to c D N A with HCV-specific 20-mer primers (nos. 122 and 337) or a non-specific 43-mer primer (no. 165) with (A)17 as described previously (Okamoto et al., 1992b, d, 1993). A Y-terminal fragment spanning nt 63 to 847 (785 nt);

932

Short communication

Table 1. Comparison of five H C V isolates from Nepal of novel genotypes (3b to 3f) for the identity of nucleotide and amino acid sequences Identity in various genomic regions (%) HCV isolates in comparison*

Total 2625 nt (779 aa)

3b versus 3c

83-1 (87.7) 82.8 (87.6) 81.6 (85"4) 84-4 (87.7) 85-2 (89.3) 83.7 (87.4) 83.5 (87.4) 83.0 (87"0) 83.5 (87.4) 81.3 (85.4)

3b versus 3d 3b versus 3e 3b versus 3f 3c versus 3d 3c versus 3e 3c versus 3f 3d versus 3e 3d versus 3f 3e versus 3f

5' UTR 259 nt 95.8 96-5 96-9 95.8 98.1 98.5 98.1 98.8 96-5 96-5

C 573 nt (191 aa)

E1 576 nt (192 aa)

E2/NS1 96 nt (32 aa)

NS5 1096 nt (364 aa)

87-4 (927) 85.3 (92.7) 85"0 (92"7) 90.4 (93.2) 88.0 (95.8) 86.9 (94.2) 87.8 (94.2) 86"9 (95"8) 87.4 (94"8) 86.0 (93.2)

74.5 (80-7) 75.9 (82.3) 74.7 (79"2) 77.1 (81.3) 76.4 (83.3) 75.7 (81.8) 73.4 (77-1) 73"8 (81"8) 74-0 (78-1) 71.7 (78.6)

53.1 (53.1) 54-2 (56-3) 52.1 (37.5) 53.1 (46.9) 61.5 (43.8) 50.0 (40-6) 56.3 (50.0) 46.9 (37.5) 61-5 (46.9) 44.8 (34.4)

84.9 (91.8) 84.4 (90.4) 82.2 (89"0) 85.4 (91.8) 87-2 (93.1) 85.4 (90.9) 85.7 (92-6) 84.9 (89"6) 85.2 (92.0) 83.4 (89.3)

3' UTR 25 nt 88.0 88-0 92.0 80.0 92.0 96.0 80.0 96"0 88-0 84.0

* Two-by-two comparison was made within the indicated nucleofide sequences and deduced amino acid sequences (in parentheses) between two of the five HCV isolates of different genotypes: NE137 of genotype VI/3b, NE048 of 3c, NE274 of 3d, NE145 of 3e, and NE125 of 3£

another covering nt 732 to 1606 (875 nt), and a 3'terminal fragment from nt 8256 to the poly(T) tail (1205 to 1219 nt) were amplified by PCR with AmpliTaq DNA polymerase (Perkin-Elmer Cetus) and primer pairs nos. 33/122, nos. 50/337 and nos. 80/166, respectively (Okamoto et al., 1990, 1992b, 1993) (nucleotides are numbered from the putative 5' end of the genome of HCV genotype I I / l b for which the entire sequence has been determined by Okarnoto et al., 1992c). For each of the five RNAs, three cDNA clones of both plus and minus strands were sequenced for the three regions, and the consensus sequences were determined. They covered 1504 or 1505 nt of the 5'-terminal sequence and 1141 to 1154 nt of the 3'-terminal sequence. Together they accounted for approximately 30% of the entire genome, including the 3'-terminal 259 or 260 nt (76 %) of the 5' UTR (341 nt, nt 1 to 341), all 573 nt of the core gene (nt 342 to 914), all 576 nt of the E1 gene (nt 915 to 1490), 96 nt (9%) including a hypervariable region (Hijikata et al., 1991 ; Weiner et al., 1991) of the E2/NS1 region (1038 nt, nt 1491 to 2528), 1096 nt (37 %) of the NS5 region (2991 nt, nt 6381 to 9371) and the entire 3' UTR excluding the poly(T) tail. Table 1 compares the nt and deduced amino acid (aa) sequences of the five HCV isolates of unclassifiable genotypes from Nepal. For the reasons given below, they were designated and classified provisionally as follows:

Table 2. Comparison of nucleotide and amino acid sequences of five H C V isolates of novel genotypes (3b to 3f) from Nepal with four H C V genomes of various genotypes with the entire sequence known* HCV isolate and genotype in comparisont Nt (aa)

HC-J1 I/la

HC-J4/83 II/lb

HC-J6 III/2a

HC-J8 IV/2b

259 573 (191) 576 (192) 96 (32)

93.1-95.0 81.5-84.3 (89.0--91.1) 62.7-67.4 (63.5-71.4) 50.0-59-4 (43.8-53.1)

93.4-95.8 81.%83.8 (88.540.6) 65.6-66.7 (66.1-69.3) 50.0-54.2 (40.6-56.3)

91.1-93.4 78"2-80.3 (86.4-89.0) 59.4-61-5 (56"8-62.5) 49"0-61.5 (37.5-53.1)

89.2-91.9 78'C~79"4 (85,9-88.5) 57.1-59.2 (55.~58-3) 44,8-54.2 (31.346.9)

NS5

1096 70.4-72.2 (364) (73-9-77-2)

69.8-71.8 (74.277.7)

67"7-69.2 (74-2-76-4)

68-5-69.5 (74.7 77.2)

3' UTR Total

25 2625 (779)

56.0-68.0 73.5-74.7 (75.~77.4)

32-0-44.0 70-1-71.0 (72.8-73.5)

36.0M4.0 69.3 70.5 (72.3 72.7)

Region 5' UTR C E E2/NS1

40.048.0 73-2-74.1 (74-9-77.4)

* The five HCV isolates of novel genotypes from Nepal were compared within the indxcated regions for the similarity of nucleotide sequence and amino acid sequence (in parentheses). The figures indicate ranges of similarity. "~ The four HCV isolates of different genotypes with the entire sequence known are HC-J1 (Okamoto et aL, 1992a), HC-J4/83 (Okamoto et aL, 1992c), HC-J6 (Okamoto et aL, 1991) and HC-J8 (Okamoto et al., 1992 b) with database accession nos. D 10749, DO 1217, D00944 and D01221, respectively.

Short communication

933

Table 3. Comparison of HCV isolates from Nepal of novel genotvpes (3b to 3f) with reported isolates of genotypes

other than I/la to IV/2b Nucleotide identity (%) Genotypes and isolates Genotype V/3a T-1 T-7 E-b1

Origin* THA THA GBR

Region

DEN HKG ITA ITA

D10078 D 10079 D10114 D10123 D10130 D14305 D14306 D14307 D14308 D14309 D14310 D14311 D14312 M84864 M84835 M84837 M84834

NS5 NS5 5' UTR C NS5 5' UTR, C, El, NS5, 3" UTR 5' UTR, C, El, NS5, 3' UTR 5' UTR, C, El, NS5. 3' UTR 5" UTR. C. El, NS5, 3' UTR 5" UTR, C 5' UTR, C 5' UTR, C 5' UTR, C

THA THA JPN

D 10080 D 10081 Dl1443

NS5 NS5 5' UTR, C, El, E2

EGY EGY

L08163 L08164

C C

ITA ZAI ZAI ZAI ZAI DEN RSA RSA HKG

M84833 M84845 M84848 M84862 M84822 M84832 M84860 M84826 M84872

5" UTR, 5' UTR, 5' UTR, 5' UTR, 5' UTR 5' UTR, 5' UTR, 5' UTR 5' UTR,

NZL1

NZL

Th85

THA

US114

USA

HEM26

JPN

DK12 HK10 $52 $54 Genotype VI/3b T-9 T- 10 HPCENCR Genotype 4:~ HPCCOREZB HPCCOREZC Unclassified§ $83 Z1 Z4 Z6 Z7 DK13 SA1 SA3 HK2

Accession no.t

E2 E2 E2 E2

C C C C C C C

Length (nt)

NE137 (VI/3b)

NE048 (3c)

NE274 (3d)

NE145 (3e)

NE125 (3f)

334 334 149 368 222 1504 1121 1504 1121 1504 1121 1504 1121 298 298 298 298

77.5 79.0 94.0 86.4 77.5 81.4 81.8 82.5 81.4 82.0 81.6 81.8 82.3 96-6 97-0 96.6 96.3

83.5 83.5 98-0 89.4 81-5 83-5 84-9 83.6 84.7 83.4 84-7 83.1 85.5 97.0 98.0 97.7 97-7

83.2 83.2 98.0 87.8 81-5 83.2 85.4 83.6 85.4 83.6 85.0 83-3 85.5 98.0 99.0 98.7 98.7

81.1 81.1 98.7 88-9 80.0 82-1 83.7 82.6 83.5 82.3 83-5 81.7 83.8 98.3 99.3 99.0 99.0

80.2 79.6 94.6 87.5 76.6 82.5 83.4 82.3 83.7 82.0 83.0 82.4 83-5 95.3 95.6 95.3 95.0

334 334 1504

91-6 90.4 88.2

81.4 81.7 80-7

78.4 78.7 80"6

77-5 77.8 79"4

82.6 83.2 82.2

242 226

78.1 77-0

82.6 80.5

80-2 79-6

80.6 79-2

79-3 78.8

298 298 298 298 196 298 298 196 298

92.3 93.6 94.3 94.3 94-4 94.3 94.6 93.9 93.6

92.6 94.0 93.3 93.6 94-4 93.6 94.0 93.9 95.3

92.6 93.0 92.3 92.6 92-9 92.6 93'0 92.3 94.3

90.9 92.6 92.6 93.0 93-4 93.0 93.3 92.9 94.0

91.3 94.0 93.0 93.6 94-4 93.6 94.0 93.9 93.6

* Countries where HCV isolations were made: Thailand, THA; Great Britain, GBR; New Zealand, NZL; United States of America, USA; Hong Kong, HKG; Italy, ITA; Japan, JPN; Denmark, DEN; Egypt, EGY; Zaire, ZAI; Republic of South Africa, RSA. ~ Sequences are available under these accession numbers from the GenBank (Release 76, April 1993)/DDBJ (Release 13, April 1993)/EMBL (Release 34, March 1993) databases. :~ According to the classification of Simmonds et al. (1993). § Reported by Buhk et al. (1992).

NE137 in subgroup VI/3b of the major group 3, NE048 in subgroup 3c, NE274 in 3d, NE145 in 3e and NE125 in 3f. They showed > 95.8 % similarity in the 5' UTR; two isolates (NE274 and NE125) had an insertion of A after nt 121 that has not been observed in any reported isolate. They shared > 80 % of the 3' UTR sequence which varies extensively among reported isolates of different genotypes (Okamoto et at., 1992b, 1993). Within the coding regions, the similarity of nt sequence in the core gene ranged from 85.0 to 90"4 %, that in the E1 gene 71-7 to 77.1%, and that in the NS5 region 82.2 to 87.2%. A Y-terminal sequence of the E2/NS1 region, including a hypervariable region, was most variable with a similarity of only 44.8 to 61.5 %. The similarity in a total of 2625 nt

ranged from 81.3 to 85.2% and that in the deduced 779 aa from 85.4 to 89.3 %. The five HCV isolates from Nepal were compared with four HCV isolates of genotype I / l a , I I / l b , III/2a or IV/2b, for which the entire genomic sequences are known (Table 2). The five isolates were similar to the four isolates of genotypes I/1 a to IV/2b in 69"3 to 74.7 % of the 5'- and 3"-terminal sequences spanning 2625 nt. The sequence similarity of the five isolates from Nepal to the four HCV isolates of genotypes I / l a to IV/2b, therefore, was less than that within themselves. These results indicated that the five HCV isolates from Nepal were related but significantly different from each other, and that they were not of genotypes I / l a to IV/2b.

934

Short communication [_[~

Ilia

HCV-I HC-JI HCV-H HC-J4/83 HC-J4/91 HCV-JH HCVT HC-C2 HCV-JT HCV JT' HC-J2 HCV J HCV-JKI HCV-BK NZL1 NEM26 Tn85 USll4 NE048

~

Group 1

II/lb Vt3a

HCV

Group 3

~

Group 2

0.5

0-4

IV/2b

0.3

0.2

i - -

NE[45 NE[25 NEI37 HPCENCR

{

USI14 T-7 Th85 NE048

31t

V~3h

[

--f 3f

~_ TT-IO9 NEI37 NEI25

Hc-J6

{ - - -

0-1

HEM26

3e

Group 3

~274

3f VI/3b

~wz. f

0.6

~

~

V/3a

T-t NZLI

HC-J5 He-J8 HC-17

0

Number of nucleotide substitutions per site Fig. 1. A proposed phylogenetic tree of HCV. The entire nucleotide sequence of the E1 gene (576 nt) of HCV isolates of various genotypes were compared with the five isolates from Nepal (NE048, NE274, NE145, NE125, NE137). A proposed phylogenetic tree was constructed by the unweighted pair-group method with arithmetic mean of Nei & Gojobori (1986) using a molecular evolutionary analysis system for DNA and amino acid sequences (ODEN, National Institute of Genetics, Mishima, Japan). Accession nos. in databases of HCV isolates not shown in Tables 2 and 3 are: HCV-1, M62321. HCV-H. M67463; HCV-JH, D00574; HCV-T, M84754; HC-C2, D10934; HCV-JT, D01171: HCV-JT', D01172; HC-J2, D10074; HCV-J, D90208; HCV-JK1, X61596; HCV-BK, M58355; HC-J5, D10075; HC-J7, D10077.

The five HCV isolates from Nepal were compared with reported HCV isolates of genotypes other than I / l a to IV/2b, for which only partial sequences are available (Table 3). Within the coding regions, they were > 77 % similar in nt sequence to isolates of genotype V/3a. One isolate (NE137) was > 90 % similar to HCV isolates of genotype VI/3b (T-9 and T-10) within a part of the NS5 region (334 nt) and 88.2 % similar to another isolate of the same genotype (HPCENCR) within a 5'-terminal sequence of 1504 nt. NE 137 was considered, therefore, to be of genotype VI/3b. Because both genotypes V/3a and VI/3b are of the third major group, the five HCV isolates from Nepal would belong to group 3. Substantial sequence divergence among them indicated that they should be classified into distinct subgroups of group 3. Therefore, the NE137 isolate is considered to be of genotype VI/3b, and genotypes of the remaining four isolates were provisionally designated 3c for the NE048 isolate, 3d for NE274, 3e for NE145 and 3f for NE125. The five isolates from Nepal shared only 77"0 to 82.6 % of a core gene sequence of 242 or 226 nt with HCV isolates from Egypt, which are proposed to be of type 4 by Simmonds et al. (1993). They showed a similarity of 90.9 to 94.6 % in a 5' UTR sequence to HCV isolates of unclassified genotypes from various areas of the world (Bukh et al., 1992), which is substantially less than the value of 95.8 to 98.8 % among themselves. Hence, the five

0-3 0-2 0.1 Number of nucleotide substitutions per site

0

Fig. 2. A phylogenetic tree of HCV of group 3 constructed on the basis of sequence divergence within a part of the NS5 region (334 nt spanning nt 8366 to 8699). See Table 3 for accession nos. of HCV isolates.

isolates from Nepal are of previously unclassified genotypes. The sequence divergence characteristic of genotypes I/1 a to IV/2b is distributed over the entire HCV genome, with variations most extensive in the E1 and NS2 genes (Okamoto et al., 1992b). In Fig. 1 a phylogenetic tree of HCV has been constructed based on the difference in nt sequence within the entire E1 gene by using the unweighted pair-group method with arithmetic mean (Nei & Gojobori, 1986). This analysis further substantiated the subgrouping of group 3 (3b to 3f) to which the five HCV isolates from Nepal would belong. Genotypes V/3a and VI/3b were proposed originally because of the sequence divergence within a part of the NS5 region (Mori et al., 1992). Fig. 2 depicts a phylogenetic tree constructed with 13 HCV isolates of group 3 for which an NS5 region sequence of 334 nt (nt 8366 to 8699) is available for comparison. The tree shows differences as well as relatedness among the 13 HCV isolates of group 3, and reinforces the novel subgrouping of type 3. In this analysis some characteristics of HCV isolates of group 3 became apparent, which are not shared by those of genotypes I / l a to IV/2b. HCV isolates of genotypes I / l a to IV/2b invariably have two in-phase stop codons in the 3" UTR (Okamoto et al., 1991), contrasting with only one in those of genotype V/3a (Okamoto et al., 1993). This feature of group 3 was preserved in all the five HCV isolates from Nepal of genotypes VI/3b, 3c, 3d, 3e or 3f (Fig. 3). The distance from the first stop codon to the poly(T) tail was 20 to 28 nt for isolates of subgroups V/3a, VI/3b, 3d and 3e, somewhat shorter than those of 3c and 3fwith 37 and 39 nt, respectively, or those of genotypes I / l a to IV/2b with 38 to 42 nt. Conserved secondary structures are recognized within a Y-terminal region of 300 nt of the HCV genome, and

Short communication

. . , . HC-JI ( I / l a ) T~AG6TTGGGGT/L~CACTCCGGCCTCTTAGGCCATTTTCTfiT6 HC-J4/83 ( II/Ib) -G--C--GG-A-C--C-----A-G-CAA--~---CC~ HC-J6 (r./2a) -"G--CGGCACAC-TT~--A-ACT-CA-AGCTAAC-G-C-C HC-J8 (IV/21o) -'~--CGGCAAACCCT~--A-ACT-CA-AGCTAGT--C~ NZL1 (v/3a) -'.C--6CTGGTAA-AT----~-A NE137 (vl/3b) "Cr'GCTGGTA--GC-------AATTCTG NE048 (3c) "6"6CTGGTA~AC-------AT-TCTG-TTA-TT--C NE274 (3d) ""6-GCTGGTA--AC-------ATTTCA NE145 (3e) "ff-GCTGGTA--AC . . . . ,~TTTCTG-G NE125 (3f) -'-6GCTGGTA~T. . . . ATT-CACAGTH-C--C--C Fig. 3. The 3' UTR of HCV isolates of various genotypes. Sequences between the first stop codon and the poly(T) tail are shown for HC-J1 of genotype I/1 a (Okamoto et al., 1992a), HC-J4/83 of genotype II/1 b (Okamoto et al., 1992c), HC-J6 of genotype III/2a (Okamoto et al., 1991), HC-J8 of genotype IV/2b (Okamoto et al., 1992b) and NZL1 of genotype V/3a (Okamoto et aL, 1993), as well as for the five HCV isolates from Nepal classifiableinto subgroups of group 3 (3b to 3f). In-phase stop codons are shaded.

its role in the viral replication has been p r o p o s e d ( H a n & H o u g h t o n , 1992). I n c o m m o n with other isolates o f genotype V / 3 a ( O k a m o t o et al., 1993), all the five H C V isolates from Nepal, classified into s u b g r o u p s o f g r o u p 3 (3b to 3e), were devoid of the 3 ' - t e r m i n a l one of the four stem a n d loop structures. W h e t h e r this influences the replication efficiency or pathogenicity of g r o u p 3 H C V w o u l d be of virological a n d clinical interest. Sequence analyses of the five H C V isolates of g r o u p 3 from Nepal revealed a range o f sequence variability which allows their classification into at least five subgroups, 3b to 3t", a n d highlighted the u n i q u e character of H C V genomes of g r o u p 3. H C V isolates of genotypes 3c to 3f are different from a n y reported isolates from other parts of the world, a n d therefore a p p e a r to have evolved a n d r e m a i n e d in Nepal, a place that has been isolated geographically because of its high altitude a n d historically for m a n y centuries. It r e m a i n s to be seen whether these H C V genotypes have n o t only epidemiological significance, b u t also clinical differences in the severity of liver disease they induce a n d their response to interferon, as has been observed for other genotypes ( T a k a d a et al., 1992; Y o s h i o k a et al., 1992). Variations in a m i n o acid sequence of viral proteins encoded by these R N A s should be considered in the serological diagnosis o f H C V infection a n d the d e v e l o p m e n t o f vaccines. This work was supported in part by the Mimstry of Health and Welfare and the Viral Hepatitis Research Foundation of Japan.

References ALTER, H.J., PURCELL, R.H., SHIH, J.W., MELPOLDER, J.C., HOUGHTON, M, CHOO, Q.-L. & KUO, G. (1989). Detection of antibody to hepatitis C virus in prospectively followed transfusion recipients with acute and chronic non-A, non-B hepatitis. New England Journal of Medicine 321. 1494-1500. BUKH, L, PURCELL,R. H. & MILLER,R. H. (1992). Sequence analysis of the 5' noncoding region of hepatitis C virus. Proceedmgs of the National Academy of Sciences, U.S.A. 89, 4942-4946.

935

CHAN,S.-W., McOMIsH, F., HOLMES,E. C., Dove, B., PEUTHERER,J. F., FOLLETT,E., YAP, P.-L. & SIMMONDS,P. (1992). Analysis of a new hepatitis C virus type and its phylogenetic relationship to existing variants. Journal of General Virolog)' 73, 1131-1141. CHOO,Q.-L., RICHMAN,K. H., HAN,J. H., BERGER,K., LEE,C., DONG, C., GALLEGOS,C., COLT,D., MEDINA-SELBY,R., BARR,P. J., WEINER, A. J., BRADLEY,D. W., Kuo, G. & HOUGHTON,M. (1991). Genetic organization and diversity of the hepatitis C virus. Proceedings of the Natwnal Academy of Sciences, U.S.A. 88, 2451-2455. HAN, J. H. & HOUGHTON,M. (1992). Group specific sequences and conserved secondary structures at the 3' end of HCV genome and its implicahon for viral replication. Nucleic Acids Research 20, 3520. HIJIKATA,M, KATO,N., OOTSUYAMA,Y., NAKAGAWA,M., OHKOSHI, S. & SHIMOTOrINO,K. (1991). Hypervariable regions in the putative glycoprotein of hepatitis C virus. Biochemical and Biophysical Research Communications 175, 22~228. MORI, S., KATO,N., YAGYU,A., TANAKA,T., IKEDA,Y., PETCHCLAI,B., CmEWSlLV,P., KtSRIMURA,T. & SHIMOTOHNO,K. (1992). A new type of hepatitis C virus in patients in Thailand. Biochemical and Biophysical Research Communications 183, 334-342. NAGAYAMA,R., TSUDA,F., OKAMOTO, H., WANG, Y., MITSUI, T., TANAKA, T., MIYAKAWA,Y. & MAYUM1,M. (1993). Genotype dependence of hepatitis C virus antibodies detectable by the firstgeneraUon enzyme-linked immunosorbent assay with C100-3 protein. Journal of Climcal Investigation 92, 1529-1533. NEL M. • GOJOBORLT. (1986). Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Molecular Bwlogy and Evolutton 3, 418426. OKAMOTO, H., OKADA, S., SUGIYAMA,Y., TANAKA, T., SUGAI, Y., AKAHANE,Y., MACHIDA,A., MISHIRO,S., YosrnZAWA,H., MIYAKAWA,Y. & MAYUMLM. (1990). Detection of hepatitis C virus RNA by a two-stage polymerase chain reaction with two pairs of primers deduced from the 5'-noncoding region. Japanese Journal of Experhnental Medicine 60, 215-222. OKAMOTO, H., OKADA, S,, SUGIYAMA,Y., KuR~a, K., IIZUKA, H., MACHmDA,A., MIVAKAWA,Y. & MAYUMI,M. (1991). Nucleotide sequence of the genom~c RNA of hepatitis C virus isolated from a human carrier: comparison with reported isolates for conserved and divergent regions. Journal of General Virology 72, 269%2704. OKAMOTO,H., KANAI,N. & MISHIRO,S. (1992a). Full-length nucleotide sequence of a Japanese hepatitis C virus isolate (HC-J1) with high homology to USA isolates Nucleic Acids Research 20, 6410. OKAMOTO, H., KURA1, K., OKADA, S., YAMAMOTO,K., IIZUKA, H., TANAKA,T., Ft~'KtrOA,S., TSUDA,F. & MISHmO, S. (1992b). FuUlength sequenceof a hepatitis C virus genome having poor homology to reported isolates: comparative study of four distinct genotypes. Virology 188, 331-341. OKAMOTO, n., KOJIMA,M., OKADA,S., YOSHIZAWA,H., IIZUKA,H., TANAKA,T., MUCHMORE,E. E., PETERSON,D. A., ITO,Y. & MISHIRO, S. (1992c). Genetic drift of hepatitis C virus during an 8.2-year infection in a chimpanzee: variability and stability. Virology 190, 894-899. OKAMOTO, H., SUGIYAMA,Y., OKADA, S., KURAI, K., AKAHANE,Y., SUGAI, Y., TANAKA, T., SATO, K., TSUDA, F., MIYAKAWA,Y. 8~; MAYUMI,M. (1992d). Typing hepatitis C virus by polymerase chain reaction with type-specificprimers: application to clinical surveys and tracing infectious sources. Journal of General Virology 73, 673-679. OKAMOTO,H., TOKITA,H., SAKAMOTO,M., HOR1KITA,M., KOJIMA,M., hZUKA, H. & MISH1RO,S. (1993). Characterization of the genomic sequence of type V (or 3a) hepatitis C virus isolates and PCR primers for speofic detection. Journal of General Virology 74, 2385-2390. SIMMONDS, P., McOMISH, F., YAP, P.-L., CHAN, S.-W., LIN, C. K., DUSrEIKO, G., SAEED,A.A. & HOLMES, E.C. (1993). Sequence variability in the 5' non-coding region of hepatitis C virus: identification of a new virus type and restrictions on sequence diversity. Journal of General Virology 74, 661 668. STUYVER,L., ROSSAU,T.. WYSEUR,m., DUHAMEL.M., VANDERI~ORGHT, B., VAN HEUVERSW~q'~,H. & MAERTENS, G. (1993). Typing of hepatitis C virus isolates and characterizatLon of new subtypes using a line probe assay. Journal of General Virology 74, 1093-1102. TAKADA,N., TAKASE,S., ENOMOTO,N., TAKADA,A. & DATE,T. (1992).

936

Short communication

Clinical backgrounds of the patients having different types of hepatitis C virus genomes. Journal of Hepatology 14, 35M0. WEINER,A. J., BRAUER,M. J., ROSENBLATT,J., RICHMAN,K. H., TUNG, J., CRAWFORD, K., BONINO, F., SARACCO, G., CHOO, Q.-L., HOUGHTON, M. & HAN, J. H. (1991). Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins. Virology 180, 842-848.

YOSHIOKA, K., KAKUMU, S., WAKITA, T., ISHIKAWA,T , ITOH, Y., TAKAYANAGI, M., H1GASHI, Y., SHIBATA, M. & MORISHIMA, T. (1992). Detection of hepatitis C virus by polymerase chain reaction and response to interferon-alpha therapy: relationship to genotypes of hepatitis C virus. Hepatology 16, 293-299.

(Received 8 September 1993; Accepted 5 November 1993)