Mol Biol Rep (2013) 40:4883–4887 DOI 10.1007/s11033-013-2587-2
Hepatocellular carcinoma and liver cirrhosis TP53 mutation analysis reflects a moderate dietary exposure to aflatoxins in Espı´rito Santo State, Brazil Fernanda Magri de Carvalho • Thiago de Almeida Pereira Patrı´cia Lofego Gonc¸alves • Robson Dettmann Jarske • Fausto Edmundo Lima Pereira • Iuri Drumond Louro
•
Received: 11 September 2012 / Accepted: 29 April 2013 / Published online: 7 May 2013 Ó Springer Science+Business Media Dordrecht 2013
Abstract The close relationship between aflatoxins and 249ser TP53 gene mutation (AGG to AGT, Arg to Ser) in hepatocellular carcinoma (HCC) makes this mutation an indirect indicator of dietary contamination with this toxin. We have examined the prevalence of codon 249 TP53 mutation in 41 HCC and 74 liver cirrhosis (without HCC) cases diagnosed at the HUCAM University Hospital in Vitoria, Espı´rito Santo State, Brazil. DNA was extracted from paraffin sections and from plasma. The mutation was detected by DNA amplification, followed by restriction endonuclease digestion and confirmed by direct sequencing. DNA restriction showed 249ser mutation in 16 HCC and 13 liver cirrhosis, but sequencing confirmed mutations in only 6 HCC and 1 liver cirrhosis. In addition, sequencing revealed 4 patients with mutations at codon 250 (250ser and 250leu) in HCC cases. The prevalence of TP53 mutation was 10/41 (24.3 %) in HCC and 1/74 (1.4 %) in liver cirrhosis. No relationship between the presence of mutations and the etiology of HCC was observed. TP53 exon 7
F. M. de Carvalho T. de Almeida Pereira I. D. Louro (&) Nu´cleo de Gene´tica Humana e Molecular, Departamento de Cieˆncias Biolo´gicas, Centro de Cieˆncias Humanas e Naturais, Universidade Federal do Espı´rito Santo, Av. Marechal Campos 1468, Campus de Maruı´pe, Vito´ria, Espı´rito Santo CEP 29040-090, Brazil e-mail:
[email protected] P. L. Gonc¸alves R. D. Jarske Hospital Universita´rio Cassiano Antoˆnio Moraes, Universidade Federal do Espı´rito Santo, Av. Marechal Campos 1355, Vito´ria, Espı´rito Santo CEP 29040-091, Brazil F. E. L. Pereira Nu´cleo de Doenc¸as Infecciosas, Universidade Federal do Espı´rito Santo, Av. Marechal Campos 1648, Vito´ria, Espı´rito Santo CEP 29040-091, Brazil
mutations, which are related to aflatoxins exposure, were found at 14.6 % (249ser), 7.3 % (250leu) and 2.4 % (250ser) in 41 cases of HCC and 1.4 % in 74 liver cirrhosis (without HCC) cases, suggesting a moderate dietary exposure to aflatoxins in the Espı´rito Santo State, Brazil. Keywords TP53 Hepatocellular carcinoma Liver cirrhosis Aflatoxin
Introduction The incidence and environmental etiological factors of hepatocellular carcinoma (HCC) vary widely worldwide [1–3]. Hepatitis B and C virus (HBV and HCV) and abusive alcohol intake are the main etiological factors in areas of low or intermediate incidence such as North America and Europe and in areas of high incidence such as Japan, Taiwan, and South Korea [2]. In some areas of high incidence, where contamination of food derivatives with aflatoxins is also high, epidemiological studies have shown a linear relationship between aflatoxin B1 (AFB1) levels in foods and mortality attributable to HCC. Moreover, epidemiological and experimental studies have demonstrated a synergistic action between AFB1 and HBV in hepatocarcinogenesis in these regions [4]. There are few reports on the prevalence of HCC in Brazil. However, some observations indicate a low prevalence of this tumor with variable etiological factors in different regions: high prevalence associated with HCV in the South and Southeast regions and high prevalence associated with HBV in Northeast, North and Midwest regions [5, 6]. In the Espı´rito Santo State (Southeast Brazil, showing areas of intermediate prevalence of HBV) [7], the prevalence of HCC associated with HBV is higher than that observed in other southeastern states [5]. Although most cases of HCC in Espı´rito Santo are
123
4884
associated with HBV or abusive alcohol consumption, there are cases where these factors are absent [5]. Aflatoxin B1 food contamination has been reported in Brazil [8], making it reasonable that this toxin could be related to hepatocarcinogenesis, as in southeast Asia and Sub-Saharan Africa [9]. In these regions, exposure to AFB1 is high and the presence of a hotspot mutation in TP53 exon 7 codon 249 (249ser TP53) is frequent in HCC [4, 9]. The close relationship between AFB1 and 249ser TP53 mutation makes this mutation an indirect indicator of contamination with this toxin. In Brazil, there is only one report showing 16.2 % prevalence of 249ser TP53 in 74 HCC cases from the Sa˜o Paulo State, as confirmed by direct sequencing [10]. Espı´rito Santo is a tropical region where fungi easily grow in improperly stored cereals. HBV-associated HCC and HBV-associated liver cirrhosis are frequently diagnosed in this Brazilian state. Therefore, we decided to investigate the presence of 249ser TP53 mutation in HCC and liver cirrhosis diagnosed at a reference local hospital.
Mol Biol Rep (2013) 40:4883–4887
CCCCTGCACACTGG (NT 154411–15431). PCR was performed in a Mastercycle Personal Eppendorf thermocycler (94 °C for 10 min; 45 cycles of 94 °C for 45 s, 67 °C for 45 s and 72 °C for 45 s; 72 °C for 10 min). Eight microliters of the amplified 179 bp fragment (200 ng/ml) were digested at 37 °C by HaeIII (10 U of the enzyme, 0.19 BSA and 19 buffer; final volume 20 ll). Digested products were submitted to 7 % polyacrylamide gel electrophoresis for 2 h and visualized after silver nitrate staining. Mutation was detected by a 158 bp fragment, as compared to 92 and 66 bp fragments for the normal sequence (Fig. 1). Sequencing In order to validate PCR–RFLP results, the 158 bp fragment was gel extracted, amplified, purified using ExoSAPIT (USB, USA) and submitted to direct sequencing by EMBRAPA Recursos Gene´ticos e Biotecnologia, Brası´lia, DF, Brazil. Statistical analysis
Methods Ethics This study was approved by the Ethics Committee of the Federal University of Espı´rito Santo (UFES; Protocol no 107/07). Patients Formalin-fixed paraffin-embedded blocks from 33 HCC and 43 liver cirrhosis without hepatocellular carcinoma and plasma samples from other 8 patients with HCC and other 31 patients with liver cirrhosis were included in this study. All 115 patients’ samples were obtained from the University Hospital of the Federal University of Espı´rito Santo from 1997 to 2008. DNA extraction Eight-micrometer-thick sections (2–6 per case) were deparaffinized, rehydrated and scraped to 2 ml tubes. Plasma DNA extraction was performed using the QIAamp DNA mini-kit and blood DNA was extracted with the QIAamp Blood mini-kit (QIAGEN, CA, USA), following manufacturer’s recommendations. DNA was stored at -20 °C. Detection of 249ser TP53 mutation Amplification of TP53 exon 7 was performed using the following primers (50 –30 ): sense GCGCACTGGCCTCATCTTGG (NT 15252–15272) and anti-sense CTTGCCA
123
Possible associations between TP53 mutations and etiological factors (chronic alcoholism and HBV or HCV infections) in HCC cases were verified using the Chi square test. Fisher’s exact test was used to verify relationships between mutations and presence of liver cirrhosis. Direct sequencing was considered the gold standard for 249ser mutation detection. Sequencing values were compared with PCR–RFLP results using the kappa index and predictive values (sensitivity and specificity). Statistical analysis was performed using BioStat version 5.0. A p value\0.05 was considered significant.
Results Demographic data and etiology of 41 HCC and 74 liver cirrhosis cases are summarized in Table 1. We found 249ser TP53 mutation in 16 samples of HCC (39 %; 95 % CI 24.1–53.9) and in 13 samples of liver cirrhosis (17.6 %; 95 % CI 9.0–26.2 %) using the PCR– RFLP method. Sequencing validation confirmed 6 of 16 PCR–RFLP positives (14.6 % of 41 cases; 95 % CI 3.8–25.4 %). Similarly, 13 liver cirrhosis cases that were PCR–RFLP positive were sequenced and one was confirmed (1.4 %; 95 % CI 0–4.0 %). The frequency of 249ser TP53 mutation was significantly higher in HCC than in liver cirrhosis (14.6 vs 1.4 %; p = 0.011). Other four transitions were found in TP53 exon 7, all at codon 250, in HCC cases: three CCC?CTC (250leu) and one CCC?TCC (250ser). Figure 1 shows positive results with PCR–RFLP and direct sequencing.
Mol Biol Rep (2013) 40:4883–4887
4885
Fig. 1 a Polyacrylamide gel electrophoresis of RFLP products (HaeIII). Lane 1 25 bp molecular weight marker. Lanes 2 and 3 HCC samples without mutation 249ser (wild-type bands at 66 and 92 bp). Lanes 4 and 5 249ser positive HCC sample (undigested 158 bp fragment). b–d Direct DNA sequencing of TP53 exon 7. b 249ser positive HCC sample; arrow indicates the electropherogram peak where the mutation is located. c Codon 250 mutation, arrow indicates the mutated peak. d Codon 250 positive sample; arrow indicates the mutation
Table 1 Demographic data and associated etiological factors in 41 cases of HCC and 74 cases of liver cirrhosis, in which mutations in TP53 codon 249 were investigated Variables
HCC (N = 41)
Cirrhosis (N = 74)
Age (years) Mean ± SE Range Gender (n (%))
62 ± 12
50 ± 12
35–85
16–81
Male
36 (88)
55 (74)
Female
5 (12)
19 (26)
Etiological factors (n (%)) Chronic alcoholism alone
3 (7.3)
13 (17.6)
a
14 (34.1)
9 (12.2)
HCVa
10 (24.4)
12 (16.2)
HBV ? HCVa
2 (4.9)
3 (4.1)
Alcoholism and virus absent
4 (9.8)
6 (8.1)
HBV
a
HBV and HCV infections include patients with chronic alcoholism
PCR–RFLP showed high sensitivity, detecting 249ser TP53 mutation in all positive cases detected by direct sequencing. However, false-positives were relatively high (37.5 %), with a positive predictive value of 0.625. The distribution of codon 249 and 250 mutations in HCC cases showed no relationship with etiological factors (HBV, HCV or alcohol abuse) considering both combined and separate analysis of etiological factors (p = 0.134 for 249ser and p = 0.492 for 249ser, 250leu or 250ser mutations). Similarly, no relationship was found with associated liver cirrhosis (p = 0.415 for 249ser and p = 0.291 for 249ser, 250leu or 250ser mutations; Table 2).
Discussion Our sample was representative of HCC and liver cirrhosis diagnosed in Espı´rito Santo because age, gender distribution and associated etiological factors were similar to those previously reported for our region [5]. However, sample size was a limitation of the present study, contributing to the lack of statistical significance observed for some of the analysis performed. Mutation frequency detected by PCR–RFLP was 16/41 (39 %) for HCC, of which six were confirmed by direct sequencing as 249ser, three as 250leu and one as 250ser. Because all these mutations affect the HaeIII restriction site, they are expected to render positive RFLP results. The frequency of 249ser mutation observed in HCC cases by PCR–RFLP and sequencing (39 and 14.6 %, respectively) is similar to that observed in Sa˜o Paulo [10] and other areas of moderate aflatoxin exposure such as Taiwan [11], Mexico [12] and Hong Kong [13]. However, it is lower than that observed in Southeast Asia [9, 14, 15] and Sub-Saharan Africa [16–18] and higher than that reported in Europe [19], North America [20] and Japan [21], which are areas with high and low exposure to aflatoxins, respectively. Similarly to what was reported in Sa˜o Paulo [10], there was no correlation between the presence of mutations and etiological factors or liver cirrhosis in HCC cases. Because all HCC studied were moderately differentiated, it was not possible to establish a correlation between mutations and tumor differentiation. Mutations at TP53 codon 250 were reported by Kirk et al. in The Gambia [17] and in vitro studies demonstrated that AFB1 binds to codon 250, being considered an
123
4886 Table 2 Distribution of TP53 exon 7 mutations in HCC cases according to etiological factors and the presence of associated liver cirrhosis
Mol Biol Rep (2013) 40:4883–4887 249ser mutation (p value)
Variables
249ser or 250ser or 250leu mutations (p value)
Etiological factors (N?/N tested) Chronic alcoholism
2/3 (0.134)
2/3 (0.492)
HBV
1/14 (0.134)
3/14 (0.492)
HCV
2/10 (0.134)
3/10 (0.492)
HBV and HCV
0/2 (0.134)
0/2 (0.492)
Alcoholism, HBV and HCV absent
0/4 (0.134)
1/4 (0.492)
Incomplete information for etiology
1/8 (0.134)
1/8 (0.492)
All cases
6/41 (0.134)
10/41 (0.492)
Yes
3/21 (0.415)
5/21 (0.291)
No
3/13 (0.415)
5/13 (0.291)
Associated liver cirrhosis
important site of DNA damage [22]. Considering that mutations 250leu and 250ser are consequences of AFB1 exposure, the frequency of TP53 mutations related to exposure to this mycotoxin was 10/41 (24.4 %; 95 % CI 11.3–37.5 %) in the studied HCC sample. The frequency of 249ser TP53 mutation in 74 cases of liver cirrhosis without hepatocellular carcinoma was 1/74 (1.4 %), lower than that observed in HCC. Reports on 249ser TP53 mutation are scarce in liver cirrhosis. This mutation was reported in 15 % of 98 cases studied in The Gambia [17], in 83.3 % of six cases in Mozambique [23] and in 4/20 cases and 5/5 cases in China [24, 25]. Reports from regions with high exposure to AFB1 show that the average prevalence of the mutation is approximately half of what we observed for HCC, except for Peng et al. report [24], in which all cirrhotic liver presented the mutation. Our results showed that the prevalence of mutation in liver cirrhosis was 10 times lower than in HCC, similar to that observed in Southern Africa [18] and Europe [17], areas with moderate to low exposure to aflatoxins. Investigation of 249ser mutation in plasma is valid because free DNA is present in patients’ plasma with different cancers including HCC and mutations found in plasma DNA mimic those found in tumors [17, 26]. Although the amount of DNA obtained from plasma extraction was lower than in tissue samples, PCR amplification was satisfactory and there was no difference in mutation detection by plasma or tissue extraction. Our results confirmed a high sensitivity, but low specificity of PCR–RFLP for the detection of 249ser TP53 mutation, with a moderate concordance with direct sequencing (kappa index = 0.423; 95 % CI 0.11–0.734). Considering that mutations at codon 250 also affect the HaeIII restriction site, the concordance between the two methods increases to 0.670 (95 % CI 0.426–0.914). In conclusion, our results showed 24.4 % of mutation at TP53 exon 7 related to exposure to AFB1 (14.6 % 249ser,
123
7.3 % 250leu and 2.4 % 250ser) in 41 cases of HCC and 1.4 % 249ser mutation in 74 cases of liver cirrhosis (without HCC) diagnosed in the Espı´rito Santo, Brazil. In a meta-analysis study, Stern et al. [9] demonstrated that in areas of moderate exposure to aflatoxin, the mean frequency of 249ser mutation in HCC is 9 % (95 % CI 4–14 %). Therefore, our results suggest a moderate exposure to AFB1 in Espı´rito Santo State. Based on a possible population dietary exposure to aflatoxins, we recommend an augmentation of sanitary inspections in Brazil, since Brazilian legislation establishes what are the acceptable levels of human exposure to this toxin. Acknowledgments Financial support was received from Fundo de Apoio a` Cieˆncia e Tecnologia (FACITEC). F.M.C. was sponsored by a Coordenac¸a˜o de Aperfeic¸oamento de Pessoal de Nı´vel Superior (CAPES) scholarship. T.A.P. was sponsored by a Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq) scholarship.
References 1. Yang JD, Roberts LR (2010) Hepatocellular carcinoma: a global view. Nat Rev Gastroenterol Hepatol 7:448–458 2. Venook AP, Papandreou C, Furuse J, de Guevara LL (2010) The incidence and epidemiology of hepatocellular carcinoma: a global and regional perspective. Oncologist 15(Suppl 4):5–13 3. El-Serag HB (2011) Hepatocellular carcinoma. N Engl J Med 365:1118–1127 4. Montesano R, Hainaut P, Wild CP (1997) Hepatocellular carcinoma: from gene to public health. J Natl Cancer Inst 89: 1844–1851 5. Gonc¸alves CS, Pereira FE, Gayotto LC (1997) Hepatocellular carcinoma in Brazil: report of a national survey (Floriano´polis, SC, 1995). Rev Inst Med Trop Sao Paulo 39:165–170 6. Carrilho FJ, Kikuchi L, Branco F, Goncalves CS, Mattos AA, Brazilian HCC Study Group (2010) Clinical and epidemiological aspects of hepatocellular carcinoma in Brazil. Clinics 65: 1285–1290 7. Yoshida CF, Camargo IF, Mercadante LA, Gaspar AM, Gomes DF, Schatzmayr HG (1986) Hepatitis B serological patterns of
Mol Biol Rep (2013) 40:4883–4887
8.
9.
10.
11.
12.
13.
14.
15. 16.
asymptomatic carriers in an endemic region and evaluation of blood plasma as a source of hepatitis B vaccine. Vaccine 4:253–256 Vargas EA, Preis RA, Castro L, Silva CM (2001) Co-occurrence of aflatoxins B1, B2, G1, G2, zearalenone and fumonisin B1 in Brazilian corn. Food Addict Contam 18:981–986 Stern MC, Umbach DM, Yu MC, London SJ, Zhang ZQ, Taylor JA (2001) Hepatitis B, aflatoxin B(1), and p53 codon 249 mutation in hepatocellular carcinomas from Guangxi, People’s Republic of China, and a meta-analysis of existing studies. Cancer Epidemiol Biomarkers Prev 10:617–625 Nogueira JA, Ono-Nita SK, Nita ME, de Souza MM, do Carmo EP, Mello ES, Scapulatempo C, Paranagua´-Vezozzo DC, Carrilho FJ, Alves VA (2009) 249 TP53 mutation has high prevalence and is correlated with larger and poorly differentiated HCC in Brazilian patients. BMC Cancer 9:204 Lunn RM, Zhang YJ, Wang LY, Chen CJ, Lee PH, Lee CS, Tsai WY, Santella RM (1997) p53 mutations, chronic hepatitis B virus infection, and aflatoxin exposure in hepatocellular carcinoma in Taiwan. Cancer Res 57:3471–3477 Soini Y, Chia SC, Bennett WP, Groopman JD, Wang JS, DeBenedetti VM, Cawley H, Welsh JA, Hansen C, Bergasa NV, Jones EA, DiBisceglie AM, Trivers GE, Sandoval CA, Calderon IE, Munoz Espinosa LE, Harris CC (1996) An aflatoxin-associated mutational hotspot at codon 249 in the p53 tumor suppressor gene occurs in hepatocellular carcinomas from Mexico. Carcinogenesis 17:1007–1012 Ng IO, Srivastava G, Chung LP, Tsang SW, Ng MM (1994) Overexpression and point mutations of p53 tumor suppressor gene in hepatocellular carcinomas in Hong Kong Chinese people. Cancer 74(1):30–37 Peng XM, Peng WW, Yao JL (1998) Codon 249 mutations of p53 gene in development of hepatocellular carcinoma. World J Gastroenterol 4:125–127 Deng ZL, Ma Y (1998) Aflatoxin sufferer and p53 gene mutation in hepatocellular carcinoma. World J Gastroenterol 4:28–29 Coursaget P, Depril N, Chabaud M, Nandi R, Mayelo V, LeCann P, Yvonnet B (1993) High prevalence of mutations at codon 249 of the p53 gene in hepatocellular carcinomas from Senegal. Br J Cancer 67:1395–1397
4887 17. Kirk GD, Lesi OA, Mendy M, Szyman˜ska K, Whittle H, Goedert JJ, Hainaut P, Montesano R (2005) 249(ser) TP53 mutation in plasma DNA, hepatitis B viral infection, and risk of hepatocellular carcinoma. Oncogene 24:5858–5867 18. Kimbi GC, Kew MC, Yu MC, Arakawa K, Hodkinson J (2005) 249ser p53 mutation in the serum of black southern African patients with hepatocellular carcinoma. J Gastroenterol Hepatol 20:1185–1190 19. Kirk GD, Camus-Randon AM, Mendy M, Goedert JJ, Merle P, Tre´po C, Bre´chot C, Hainaut P, Montesano R (2000) Ser-249 p53 mutations in plasma DNA of patients with hepatocellular carcinoma from The Gambia. J Natl Cancer Inst 92:148–153 20. Goldblum JR, Bartos RE, Carr KA, Frank TS (1993) Hepatitis B and alterations of the p53 tumor suppressor gene in hepatocellular carcinoma. Am J Surg Pathol 17:1244–1251 21. Hayashi H, Sugio K, Matsumata T, Adachi E, Urata K, Tanaka S, Sugimachi K (1993) The mutation of codon 249 in the p53 gene is not specific in Japanese hepatocellular carcinoma. Liver 13:279–281 22. Denissenko MF, Cahill J, Koudriakova TB, Gerber N, Pfeifer GP (1999) Quantitation and mapping of aflatoxin B1-induced DNA damage in genomic DNA using aflatoxin B1–8,9-epoxide and microsomal activation systems. Mutat Res 425:205–211 23. Kirby GM, Batist G, Fotouhi-Ardakani N, Nakazawa H, Yamasaki H, Kew M, Cameron RG, Alaoui-Jamali MA (1996) Allelespecific PCR analysis of p53 codon 249 AGT transversion in liver tissues from patients with viral hepatitis. Int J Cancer 68:21–25 24. Huang XH, Sun LH, Lu DD, Sun Y, Ma LJ, Zhang XR, Huang J, Yu L (2003) Codon 249 mutation in exon 7 of p53 gene in plasma DNA: maybe a new early diagnostic marker of hepatocellular carcinoma in Qidong risk area, China. World J Gastroenterol 9:692–695 25. Peng XM, Yao CL, Chen XJ, Peng WW, Gao ZL (1999) Codon 249 mutations of p53 gene in non-neoplastic liver tissues. World J Gastroenterol 5:324–326 26. Anker P, Mulcahy H, Stroun M (2003) Circulating nucleic acids in plasma and serum as a noninvasive investigation for cancer: time for large-scale clinical studies? Int J Cancer 103:149–152
123
