Send Orders for Reprints to
[email protected] Current HIV Research, 2016, 14, 000-000
1
High Burden of HBV-Infection and Atypical HBV Strains Among HIVInfected Cameroonians Romina Salpini*,1, Joseph Fokam*,1,2,3, Laura Ceccarelli4, Maria-Mercedes Santoro1, Aubin Nanfack1,2,5, Samuel Martin Sosso2, Mathurin Kowo3,6, Valeria Cento1, Judith Torimiro2,3, Loredana Sarmati4, Massimo Andreoni4, Vittorio Colizzi2,7, Carlo Federico Perno1,2 and Oudou Njoya3,6 1
Romina Salpini
Department of Experimental Medicine and Surgery, Faculty of Medicine and Surgery, University of Rome Tor Vergata (UTV), Rome, Italy; 2Chantal BIYA International Reference Centre (CIRCB) for research on HIV/AIDS prevention and management, Yaoundé, Cameroon; 3Faculty of Medicine and Biomedical Sciences (FMBS), University of Yaoundé, Yaoundé, Cameroon; 4 Infectious Disease Unit, University Hospital of Rome Tor Vergata, Rome, Italy; 5New York School of School of Medicine, New-York, USA; 6University Health Centre (UHC), Service of Internal Medicine, Hepatology unit, Yaoundé, Cameroon; 7Department of Biology, Faculty of Sciences, University of Rome Tor Vergata (UTV), Rome, Italy.
Joseph Fokam
Abstract: Aim: To investigate the prevalence and genotypic profile of overt and occult hepatitis-B infection (OBI) among HIV-infected individuals in Cameroon. Methods: 212 HIV-infected Cameroonians, aged 37.6 [IQR: 32.6-46.6] followed-up at the University Health Centre in Yaoundé, were tested for HBsAg, anti-HBs, anti-HBc IgG/IgM, HBV-DNA and anti-HCV IgG. HBV positive cases were tested for Hepatitis Delta virus (HDV) using anti-HDV IgG and HDV-RNA. Liver function was assessed by alanine and aspartate aminotransaminases. OBI was defined as negative-HBsAg and detectable HBV-DNA. In occult or overt HBVinfected participants, HBV reverse transcriptase (RT)/surface (S) sequences were analyzed for drug resistance, immuneescape mutants, and phylogeny. Results: Overall, 78.3% (166/212) participants had past/ongoing HBV-exposure, with 39.1% (83/212) carrying “HBcAbpositive alone”. Prevalence of overt HBV (positive-HBsAg) was 11.8% (25/212), prevalence of HBV and HDV was respectively 6.9% (12/175) and 12% (3/25). Phylogeny of HBV-RT/S revealed the co-circulation of genotypes A and E. All HBV-coinfected participants harbored HBV strains with at least one immune-escape mutation. Of note, one HBV variant carried the vaccine-escape mutation G145R that hinders HBsAg neutralization by antibodies. For the first time, a novel 9 aa-deletion (s115-s123), located in the HBsAg “a” determinant, was found concomitantly with OBI. A stop codon in the S region (associated with increased risk of hepatocellular carcinoma) was found in six cases. Conclusion: High prevalence of overt/occult HBV-infection and circulating atypical strains highlight the importance of HBV-surveillance among HIV-infected Cameroonians and strategies to detect OBI in highly endemic countries.
Keywords: Hepatitis B virus, occult Hepatitis B, drug resistance, genotyping, immune escape, HDV co-infection, HIV-infected Cameroonians. 1. INTRODUCTION 1.1. HIV/HBV Co-Infection in Sub-Saharan Africa HIV/HBV co-infection represents a particular health challenge in sub-Saharan Africa (SSA), which carries over two-third of the 35.3 million people living with HIV (PLHIV) worldwide and HBV-highly endemic settings [1, 2]. A major clinical relevance of this co-infection is driven by the fact that HBV-induced hepatitis in PLHIV leads to higher risks of liver-disease and associated-mortality than *Address correspondence to these authors at the Department of Experimental Medicine and Surgery, University of Rome Tor Vergata, Via Montpellier, 1, 00133 Rome, Italy; Tel: 0039.0672596561; Fax: 0039.067256.6039; E-mails:
[email protected],
[email protected]. 1570-162X/16 $58.00+.00
reported in HIV mono-infected patients [3, 4]. In turn, HIV accelerates progression of HBV- or HCV-associated chronic liver disease as well as a rapid progression to hepatocellular carcinoma (HCC) [5, 6]. In different SSA settings, up to 36% of PLHIV were reported with HBV-coinfection [1,7], based on hepatitis B surface antigen (HBsAg) detection. Of note, recent studies conducted in Cameroon showed HBV rates, using serological markers, ranging between 9.8% [8] and 12.6% [9] in different cohorts of PLHIV. Moreover, approximately 80% of PLHIV have past/ongoing exposure to HBV (anticore positivity + anti-S positivity) [10]. The latter is of paramount significance because in case of infection, HBV can latently remain inside the nuclei of hepatocytes, in the form of covalently closed circular DNA (cccDNA). This © 2016 Bentham Science Publishers
2
Salpini!et al.
Current HIV Research, 2016, Vol. 14, No. 2
results in viral persistence with considerable risks of reactivation and pathogenesis in HIV-associated immune suppression [10]. 1.2. Relevance of Occult Hepatitis B in Sub-Saharan Africa The burden of HBV infection in SSA settings could be underestimated in real-life due to occult hepatitis B infection (OBI), well-known as a persistent HBV-DNA in the liver and/or in serum of individuals tested negative for HBsAg using currently available serological assays. Viral reactivation, diagnostic and vaccine-escape are common OBI-related events [12]. Clinically, even at low replicative rate, OBI favors progression towards cirrhosis and HCC, by maintaining the typical pro-oncogenic properties of persistent HBV [13], as previously reported in China (OBI found in 70% HCC) [14]. 1.3. Purpose of the Study As HIV/HBV interaction favors pathogenesis, early diagnosis of HBV infection (including OBI) would be clinically relevant for timely initiation of treatment and/or for appropriate monitoring of PLHIV. Additionally, monitoring the spread of HBV immune-escape mutants is a great asset in ensuring effective diagnosis and vaccination against HBV in highly endemic settings. 1.4. Research Objectives Our main objectives are to evaluate the molecular epidemiology of HBV and to ascertain the genotypic characteristics of overt and occult hepatitis-B infections among populations of PLHIV in HBV highly-endemic settings as Cameroon. 2. MATERIALS AND METHODS 2.1. Study Design A prospective and cross-sectional survey was conducted from April to August 2010 among 212 PLHIV followed-up at the HIV Care and Treatment Centre of the University Health Centre (UHC) in Yaoundé, Cameroon. Following an informed consent, study participants (aged >12 years) were enrolled based on a positive HIV serological diagnosis as per the national algorithm (rapid testing and subsequent confirmation using an enzyme immunoassay [EIA]). A detailed questionnaire, covering basic socio-demographic data (sex, age, region, origin, risk factors, alcohol, smoking habits), was administered to each participant. Treatment history and the presence of any relevant disease were collected from participant’s medical records. Samples were processed at the Chantal Biya International Reference Centre for research on HIV/AIDS prevention and management (CIRCB), in Yaoundé, Cameroon. 2.2. HBV, HCV, HDV Testing Serological testing for HBsAg, anti-HBs, anti-HBc (IgG/IgM) and anti-HCV (IgG) was performed using enzyme linked immunosorbent assay (ELISA) as per manufacturer’s
instructions (Radim, Italy). For patients with positive-HBsAg and/or detectable HBV-DNA, anti-HDV (IgG) testing was performed using ELISA as per manufacturer’s instructions (Radim, Italy); only patients with positive anti-HDV were tested for HDV-RNA. HBV-DNA viral load measurement was performed using Abbott RealTime HBV as per manufacturer’s instructions, with a lower detection limit of 10 IU/ml HBV-DNA (Abbott Laboratories, USA). HDV-RNA viral load measurement was performed using HDV Real Time RT-PCR Kit (LiferiverTM, Shangai ZJ Bio-Tech Co., China) as per manufacturer’s instructions, with a lower detection limit of 1000 RNA copies/ml. 2.3. HBV Sequencing Sequencing of HBV overlapping region between reverse transcriptase (RT: 60-320 amino acids) and the surface (S: 51226 amino acids) was performed on all positive HBV-DNA samples. Briefly, HBV-DNA was extracted using Qiagen kits (QIAmp DNA mini-kit, Qiagen Inc., USA) as per manufacturer’s instructions. HBV-DNA extracts were amplified with AmpliTaq-Gold polymerase using the speci-fic primers (5’GGTCACCATATTCTTGGGAA and 5’GTG GGGGTTGCGTCAGCAAA) and PCR conditions (one cycle 93 °C 12 min, 40 cycles [94 °C 50 s, 57 °C 50 s, 72 °C 90 s], and a final cycle 72 °C for 10 min). Direct sequencing was done using eight overlapping primers (Fwd [5’GTTGAC AAGAATCCTCACAATA, 5’-GGTCACCATATTCTTGG GAA, 5’-GGCATGGGGACGAATCTTT, and 5’-CTCAGT TTACTAGTGCCATT]; Rev [5’-GAGGTTGGGGACTGC GAATT; 5’-GTGGGGGTTGCGTCAGCAAA 5’-CCTCT TGTTGCTGCTGTACAAAA; 5’-GGTGGACTTCCTCTC AATTTT]) and BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems FosterCity, CA). Sequences were detected by capillary electrophoresis on ABI 3130xL automated sequencer. Sequences were analyzed using SeqScape v2.7, with the quality endpoint being ensured by coverage of at least two bidirectional primers. Sequence with a mixture of wild type and mutant at a given position was considered having the mutant. 2.4. HBV Sequence Interpretation and Phylogenetic Analysis Nineteen HBV RT drug resistance-associated mutations (primary- [rtM204V/I, rtA181T/V, rtN236T, rtA194T] and secondary-mutations [rtL80I/V, rtI169T, rtV173L, rtL180M, rtT184A/S/G/C, rtS202C/G/I and rtM250V]), and 21 immune/ diagnostic-escape HBsAg-mutations (sT114R, sT118A, sP120A/T, sT123N, sT126S, sA128V, sQ129R, sG130N, sT131N, sM133I/L/T, sK141E, sD144E/A/H, sG145R/A, sF158Y, sF161L) were considered in the analysis [15-17]. Phylogenetic analysis was performed using MEGA v5 [18], and a Maximum Likelihood (ML) tree was inferred using Kimura two-parameter and Gamma-distributed Rate models. RT/HBsAg sequences, 54 GenBank/DDBJ reference HBV/A strains from diverse origins, representative sequences of other HBV strains, atypical strains of HBV-A genotypes from Cameroon, as well as subgenotypes HBV-A3, -A4 and -A5, were all included in the phylogenetic analysis [19-22].
Hepatitis B Among HIV-Infected Cameroonians
Current HIV Research, 2016, Vol. 14, No. 2
3
2.5. Monitoring of HIV Infection
3.2. Hepatitis B co-infection: overt and occult HBV
HIV infection was monitored by determination of T-cell subpopulations and HIV viral load measurement. Briefly, determination of T-cell subpopulations was based on CD4+ and CD8+ cell counts by flow cytometry, using a FACS Calibur (www.bdbiosciences.com/documents/facscalibur), as per manufacturer’s instructions (Becton Dickinson, USA). HIV viral load measurement was performed using the Abbott RealTime HIV-1 reverse transcription-polymerase chain reaction (RT-PCR) assay for the quantitation of HIV-1 on an automated m2000 System (www.abbottmolecular.com/prod ucts/infectious-diseases/realtime-pcr/hiv-1-assay) as per manufacturer’s instructions (Abbott Laboratories, USA), with a lower detection limit of 40 copies/mL.
Positive-anti-HBc (markers of past/ongoing HBVexposure) was reported in 78.3% (166/212). Concomitant HBcAb IgG/IgM and HBsAb positivity was detected in 23.1% (49/212) while HBcAb positivity “alone” was found in 39.1% (83/212).
3. RESULTS
HBsAg was positive in 25/212, resulting in 11.8% prevalence of overt HBV co-infection (Table 2). Among the 25 HBsAg positive participants, 14 had HBV-DNA not detectable and 11 had detectable HBV-DNA ranging from 10 IU/ml
10
27.0
Hypertransaminasemy
17
45.9
- HAART-Naive
14
37.8
- HAART-Treated
23
62.2
HBV-DNA:
Therapy status
HIV status
Risk factor for HIV infection, n (%) Heterosexual intercourse
Coinfection of HBV, HCV and HDV among HIVinfected people.
4.5 [3.8-4.6]
ALT, IU/l, Median [IQR]
22 [16-32]
AST, IU/l, Median [IQR]
31.5 [24-41]
Therapy status, n (%) HAART-naïve
70 (33)
HAART-treated
142 (67)
Legend: IQR: Interquartile range; IU: international unit; HAART: highly active antiretroviral therapy.
- HIV- RNA, log copies/ml, Median [IQR] 3
- CD4 cell count, cells/mm Median [IQR]
3.9
[2.8-5.2]
471 [226-611]
Legend: *This percentage was calculated on the total of 175 samples tested for HBVDNA IQR: Interquartile range; HAART: highly active antiretroviral therapy
Due to reagent shortage, HBV-DNA measurement was performed for 175/212 participants (including all 25 HBsAg positive and 150/187 HBsAg negative). To limit potential bias, data of the 37 participants HBsAg negative not benefiting from HBV-DNA measurement were compared to those who benefited, and revealed similar past/ongoing exposure to HBV (anti-HBc: 64.9% versus 75.4 % respectively, p=0.185) and to HCV (anti-HCV: 24.3% versus 24% respectively, p=0.967). A total of 12 cases were identified as OBI (6.9%; 12/175), of which 10 (83.3%) had a viral load below detection limit (HBV-DNA
