High Level Expression of Functional Full Length and Truncated ...

THEJOURNALOF BIOLOGICAL CHEMISTRY

Vol. 266, No. 16, Issue of June 5,pp. 10078-10085.1991 Printed in U.S.A.

0 1991 by The American Society for Biochemistry and MolecularBiology, Inc.

High Level Expressionof Functional Full Length and Truncated Glucocorticoid Receptorin Chinese Hamster Ovary Cells DEMONSTRATION OF LIGAND-INDUCED DOWN-REGULATION OF EXPRESSEDRECEPTOR PROTEIN*

mRNAAND

(Received for publication, September 10, 1990)

MariFnne Alksnis, Tomas Barkhem, Per-Erik StromstedtSj, Harri Ahola, Ejii KutohS, Jan-Ake GustafssonS, Lorenz PoellingerS, and StefanNilssonll From Karo Bio AB, Box 4032, S-141 04 Huddinge, Sweden and the $Department of Medical Nutrition, Karolinska Institute, Huddinge University Hospital F-60, Novum, s-14186 Huddinge, Sweden

Full length human glucocorticoid receptor andtrun- erted via a specific intracellular receptor protein which, like cated receptor derivatives lacking the major amino- many other steroid receptors, functions as a signal-activated terminal trans-activating domain were expressed in nuclear transcriptional regulator (Beato, 1989; Freedman et stably transfectedChinese hamster ovary (CHO) cells. al., 1989, and references therein). The mechanism by which The receptors wereco-expressed together withhuman the receptor induces the transcriptional response of target metallothionein IIa, and the expression levels were genes to glucocorticoids is poorly understood. However, the amplified in the presence of increasing concentrations response is known to be mediated by a positive control eleof metal. In amplified cells, both synthesized receptor ment (the glucocorticoid-response element, GRE)’ which is forms showed the expected molecular weights, as as- present in single or multiple copies upstream of or within sayed by affinity labeling and immunoblotting. They target genes (reviewed in Yamamoto, 1985). In uitro, GRE were expressed at concentrations of about 350,000520,000 molecules/cell which corresponds toa 10-fold sequences are specificallyrecognizedby the glucocorticoid increase in receptor levels as compared to rat liver receptor protein. The receptor structure determining target gene specificity cells. The hormone (agonist or antagonist)binding and direct contact with DNA response elements has been properties of the expressed proteins were very similar region of 66-68 amino to those characteristic of authentic glucocorticoid shown to be contained within a central receptors in tissues or cultured cells. Moreover, the acids which are highly conserved inthe nuclear receptor expressed proteins specifically recognized a glucocor- superfamily and which have the capacity to coordinate 2 zinc ticoid-response element sequence motif in in vitro pro-atoms (reviewed in Evans, 1988; Freedman et al., 1988). The tein-DNA binding experiments. The activation of a amino-terminal partof the receptor protein harbors an acidic region which is important for transcriptional activation (Giglucocorticoid-responsive reporter gene by theexpressed full length receptor was dramatic (about 75- gu&e et al., 1986; Freedman et al., 1989), whereas the ligandfold) and strictly ligand-dependent. In contrast, the binding capacity of the receptor is contained within the carexpressed amino-terminal deletion mutant exhibited boxyl-terminal region (Gigutke et al., 1986). considerably weaker functional activity but showed As stated above, several key issues concerning the structure normal hormone-binding properties. Upon exposure to and function of the glucocorticoid receptor remain unclear. dexamethasone in vivo, the expressed receptor mRNAs These questions include, among others, structuralanalysis of and proteins were down-regulatedabout 2 - to 6-fold, the receptor and the mechanism of target gene activation and indicating that regulatory signals important for auto- signal transfer from the cytoplasm to the nucleus, including regulation may be contained within structures corre- the signal-induced activation step of the receptor from a latent sponding tothe ligand and DNA-binding domains. species to a functional one. It is reasonable to assume that Transcription from the expression vector was not negthese regulatory pathways include a rather complex series of atively regulated from the hormone, strongly arguing biochemical events which will require eukaryotic expression that receptor down-regulation wasdue to a post-transcriptional mechanism. In conclusion, this expression systems for their full reconstitution under cell-free conditions. system should be a useful tool for further structural To this end, we have established stable lines of CHO cells and functional studies of the receptor, including the expressing amplified levels of the human glucocorticoid recepbiochemistry of its activation froma cryptic toa func- tor. This expression system has permitted a functional and tional species, and its ligand-dependent autoregula- biochemical characterization of the full length human receptor and a truncated receptor derivative containing only the tion. DNA- and ligand-binding domains. Finally, glucocorticoid treatment was found to induce down-regulation of the exThe biological effects of glucocorticoid hormones are ex* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Supported by a fellowship from the Swedish Medical Research Council. li To whom correspondence should be addressed.

’

The abbreviations and trivial names used are: GRE, glucocorticoid response element; hsp 90, the 90-kDa heat shock protein; CHO, Chinese hamster ovary; kb, kilobase(s); LBD, ligand-binding domain; triamcinolone acetonide, 9a-fluoro-ll~,21-dihydroxy-la,l7a-[lmethylethylidenebis(oxy)]pregna-1,4-diene-3,2O-dione;dexamethasone, 9~-fluoro-16a-methyI-11S,1701,21-trihydrox~regna-l,4-diene3,20-dione; dexamethasone mesylate, Sa-fluoro-16a-methyl-lW, 17a,21-trihydroxypregna-l,4-diene-3,20-dione-2l-methanesulfonate; GR, growth hormone; XRE, xenobiotic responsive element.

10078

Expression of Human Glucocorticoid Receptor

10079

the exception that the cells were lysed for 15 min a t 0-4 “C in 0.1 M Tris-HC1, pH 8.8,0.4 M NaCl, 0.5% Nonidet P-40, and1 mM phenylmethylsulfonyl fluoride prior to the preparation of a cytosolic extract. Immunoblot analysis was performed by incubation of cytosolic or whole cell extracts immobilized on nitrocellulose filters with the antirat glucocorticoid receptor monoclonal IgGl antibody No. 5 (Okret EXPERIMENTALPROCEDURES et al., 1984). Immunocomplexes were identified by alkaline phosphaConstruction of Expression Vectors-The expression vector pMT- tase-conjugated anti-mouse immunoglobulins. The specific DNA-binding activityof expressed receptor formswas GR was generated by subcloning of a 2.8-kb fragment from pRSVhGR (generously provided by California Biotechnology, Palo Alto, monitored by an electrophoretic mobility shift assay as previously CA) as follows. An XhoI-XbaI fragment of pRSV-hGR, containing described (Nemoto et al., 1990b). Briefly, 2 X lo6 cells were lysed in the sequence coding for the full length human receptor was inserted 0.4% Nonidet P-40 and centrifuged in an Eppendorf centrifuge for 5 into the BamHI (blunt-ended) and the XbaI sites of the mammalian min a t 4 “C. The cytosolic extract was cleared by further centrifugaextract was prepared by expression vector pMT-hGH (Friedman etal., 1989).To facilitate the tion for 15 min. Asmall-scalenuclear suspension of the nuclei at 0-4 “cin 15 jd of20 mM KC1,20 mM joining of the 5’ XhoI end of the GR fragment and the blunted Tris, pH 7.6, 0.2 mM EDTA, 1.5 mM MgC12, 25% glycerol, 5 mM pBamHI site in the expression vector, the ligation was performed in the presenceof the double stranded adapter 5’-GGATCCC-3’ (upper mercaptoethanol, and 0.5 mM phenylmethylsulfonyl fluoride. Thereafter, 60 pI of the same buffer containing 600 mM KC1 was carefully strand) and 5’-TCGAGGGATCC-3’ (lower strand). pUC18(ATG)added, and the nuclei were incubated for 30 minon ice. Nuclear AGR (kindly provided by Dr. A. Wright, Karolinska Institute) contains an AuaII-XbaI fragment of the human glucocorticoid receptor debris was pelleted by centrifugation in an Eppendorfcentrifuge for (Hollenberg etal., 1985) cloned downstream of an in-frame initiation 15 min at 4 “C. DNA-binding reactions were assembled in a total volume of 20 ~1 with a radiolabeled double stranded synthetic GRE codon. A 1.5-kb BamHI-XbaI fragment from pUC(ATG)-AGR, encoding the DNA and ligand-binding domainsof the human receptor (5“GACCCTAGAGGATCAGAACAGGATGTTCTAGATCGAATT CG-3’) containing a perfect palindromic motif (Klock et al., 1987) as (amino acids 415-777) and two additionalamino-terminalamino acids (the initiating Met and Val), was cloned into the BamHI and specific probe. In oligonucleotide competition experiments, a 38-base XbaI sitesof pMT-hGH following excision of human growth hormone pair oligonucleotide spanning the dioxinresponse element XREl coding sequences, to give the resulting vector pMT-AGR. Similarly, (Hapgood et al., 1989) of the rat cytochrome P-450IA1 gene was used the expression vector pMT-LBD was constructed by subcloning a as a GRE-unrelated sequencemotif. Hormone-induced Down-regulation of Expressed Glucocorticoid 1.2-kb BamHI-XbaI fragment (encoding Met, Val, and amino acids 500-777 of the human receptor) ofpUClS(ATG)-LBD (obtained from Receptor-Individual amplified cell clones (GR 36, AGR29, and LBD, Dr. A. Wright) into the BamHI and XbaI sites of pMT-hGH. In the respectively) were treated with 1 FM dexamethasone for 24-48 h prior to extraction of cytoplasmic mRNA by lysis in 10 mM Tris-HC1, pH pMT-hGR, pMT-AGR, and pMT-LBD vectors, expression is controlled by the human metallothionein IIA promoter driven by the 7.9, 150 mM NaC1, 5 mM MgCI,, and 0.65% Nonidet P-40 for 15 min SV40 enhancer (Friedman et al., 1989 and references therein). The a t 0-4 “C. Nuclei and cell debris were pelleted by centrifugation at 15,000 X g for 10 min, and the supernatantwas extracted repeatedly glucocorticoid-responsive reporter pMMTV-hGH2 was constructed with phenol/chloroform and ethanol precipitated. RNA was gel fracby ligation of a 3.8-kb SalI-EcoRI fragment of pMSG (Pharmacia) and a 2.1-kb SalI-EcoRI fragment encoding human growth hormone. tionated, blotted to nitrocellulose filters, hybridized a t 42 “C, and washed a t 65 “C by standard procedures (Sambrook et al., 1989). A In indicated experiments, the gene for the secretable form human 1.5-kb BamHI-XbaI fragment (encodingonly the ligand-binding doalkaline phosphatase was inserted into the pMT expression vector and used as a reporter gene in transient transfection assays. To this main of the human receptor) of pMT-LBD was used as aprobe end, a 1.9-kb BglII-XhoI fragment of the phosphatase gene (Berger following radiolabeling with [a-”P]dCTP by the large fragment of Escherichia coli DNA polymerase I and random priming. et al., 1988) was inserted into the BamHI-XhoI sites of pMT-hGH, thus replacing the growth hormone gene. RESULTS Cell Culture and Establishment of Stable Cell LinesExpressing Glucocorticoid Receptor-CHO K1 cells (ATCC No. CCL 61) were Stepwise Selection of Stable CHO Cell Lines Expressing cultured in Ham’s F-12 medium in the absence of phenol red but supplemented with 10% fetal calf serum stripped with dextran char- Elevated Levels of Glucocorticoid Receptor and Characterizacoal. CHO cells were transfected with pMT-GR, pMT-AGR, or pMT-tion of Ligand-binding Activities-CHO cells (Israel and KaufLBD together with pSV2-Neo and phMTIIa (Friedman et al., 1989) man, 1989; Hirst etal., 1990) in analogy to COS cells (GiguCre by calcium phosphate precipitation (Graham and van der Eb, 1973). et al., 1986) contain very low levels of endogenous glucocorThe transfection efficiency was enhanced by a 15% glycerol shock for ticoid receptor and represent suitable“receptor-negative’’ eu5 min (Frost andWilliams, 1978). For selection of stably transfected karyotic hosts for receptor expression systems.In the present cells the mediumwas supplemented with G418 (Gibco) to a final study, CHO K1 cells were co-transfected with: (i) pSV2-Neo concentration of 0.8 mg/ml. Stable G418-resistant clone pools were (for primary selection of stably transfected cells with G418); then analyzed for receptor expression by their ability to activate a steroid-responsive reporter construct in the presenceor absence of 1 (ii) a human metallothionein IIa expression vector, phMTIIa p~ dexamethasone. Glucocorticoid receptor expression was amplified (for selection and amplificationin the presence of increasing as detailed under “Results” by exposure to increasing concentrations concentrations of Cd2+,see below); and (iii) a plasmid, pMT, of Cd” (2.5-40 wM) in the presenceof 50 p~ Zn2+. containing glucocorticoid receptor coding sequences expressed Transient Transfections and Assays for Functional Activity of Expressed Glucocorticoid Receptor Forms-Stable G418-resistant cells from the human metallothionein IIa promoter and theSV40 enhancer (schematically summarized in Fig. M). Both full expressing receptor were transfected by the DEAE dextran method (Weber et al., 1984; and references therein) with the reporter vector length receptor cDNA or derivatives obtained by truncation pMMTV-hGH. Induced growth hormone expression was monitored from the amino terminus were cloned into this expression by a radioimmunoassay (Pharmacia) up to 48 h following hormone vector, resulting in the constructs pMT-GR, pMT-AGR, and treatment. Secreted alkaline phosphatase activity was analyzed in pMT-LBD, respectively. As graphically displayed in Fig. 1B, the cell medium by achemiluminescence assay essentially as dethe construct pMT-AGR encodes a receptor derivative lacking scribed (Tizard etal., 1990). the amino-terminal trans-activating domain but containing Biochemical Analysis of Expressed Glucocorticoid Receptor Formswhereas Steroid-binding activitieswere assayed by awhole cell ligand-binding intact DNA-binding and steroid-binding domains, assay asfollows. About 300,000 cells were incubated withradiolabeled pMT-LBD encodes only the ligand-binding domain. steroid in the absence or presence of a molar excess of radioinert Cell lines expressing high levels of receptor were selected competitor ligand as specified below for 1 h a t 37 “C. Upon removal in a stepwise fashion (summarized in Fig. 2 A ) for resistance of unbound steroid by three sequential washes in phosphate-buffered of 50 saline, cells were lysed in 1 M NaOH for 1 h andassayed for to increasing concentrationsof Cd2+ in an environment overexpressedreceptor radioactivity. Expressed receptor proteins were affinity labeled with p~ Zn2+. To examinewhetherthe [“Hldexamethasone mesylate under conditions outlined above with retains its native properties and to assess the levels of ex-

pressed receptor mRNAs in stably transfected CHO cell lines. Thus, these cell lines could also serve as a useful system in which to investigate the ligand-induced autologous regulation of the receptor.

10080

Expression of Human Glucocorticoid Receptor

80 amol/pg of homogenate protein) which bound dexamethasone witha Kd of about 1nM (Fig. 2B). Theseligand-binding parametersareinexcellentagreementwiththose of the endogenous dexamethasone-bindingactivity described in CHO DUKX cells (about 150 amol receptor/pg protein; Kd = 2.5nM; Israel and Kaufman, 1989). Upon maximal amplification, cells expressing thefull length receptor from the stably transfected pMT-GRvector bound dexamethasone witha Kd of 6.6 nM at a level of approximately 3.5 fmollpg of homogenate protein. Similar ligand-binding properties were observed for the amplified pMT-AGR expression product, i.e. a Kd of 2.2nM and amaximal binding capacity of2.5 fmollpg of homogenate protein (Fig. 2B). In conclusion, the endogenous and expressed receptors bound the ligand with an affinity similar to thatof the bonafide receptor (Beato and Feigelson, 6 1972). In amplified cells, both the expressed wild-type and truncated glucocorticoid receptors were present in 30- to 50fold elevated levels as compared to levels the of native receptor present in the parental CHO K1cells (summarized in Table I). Moreover, the expressed receptor forms were 8- to 10-fold more abundant than the receptor present in ratliver (Wrange et al., 1984, and references therein). FIG. 1. Expressionvectorsforfulllengthandtruncated The binding specificity of the expressed receptors was exglucocorticoid receptor. A, maps of the expression plasmids used amined by labeling pools of whole cells under inducing confor stable transfectionof CHO cells. B, a schematic representationof ditionswith10 nM [3H]dexamethasoneinthe absence or the functional organizationof the human glucocorticoidreceptor. The presence of an increasing molar excess of radioinert competfull length receptor reading frame is represented by the boxed area, and ligand-binding itors. As shown in Fig. 3, RU 486, triamcinolone acetonide, and the major trans-activating ( T ) , DNA (DBD), domains ( L B D ) are indicated. The bars indicate the location of the and dexamethasone competed effectively (80-go%), already different expressed receptor fragments. at a 10-fold molar excess for binding to either theexpressed full length (panel A ) or the truncated(panel B ) glucocorticoid A ba receptors.At a 10- to 100-fold molarexcess, R5020 was moderately effective as a competitor, whereas estradiol and testosterone were poor competitors. These datashow that the specificity of the expressed receptors was very similar to that described for the glucocorticoid receptor identified in tissues and culturedcells (Rousseau, 1975, and references therein). I I Covalent Labeling andImmunochemicalAnalysis of Expressed Receptor Proteins-To visualize the expression products, pMT-GR and pMT-AGR cells were labeled with the covalent affinity ligand [3H]dexamethasone mesylate in the absence or presence of the unlabeled competitor triamcinolone acetonide. In parental CHO K1 cells a faint band was detected by autoradiography upon sodium dodecyl sulfatepolyacrylamide gel fractionation of cytosolic proteins. The band migrated in a position corresponding to an Mr of approximately 94,000 (Fig. 4A) which is identical to the M , of the purified rat liver glucocorticoid receptor (Wrange et al., 1984). Autoradiography of [3H]dexamethasone mesylate-labeled pMT-GR cells (either a mixture of unamplified cell clones or the individualamplified cell clone 36) showed conBound 3Hder (pM) siderably strongersignals of identical mobility(Fig. 4B). FIG. 2. Saturation analyses of glucocorticoid receptors expressed inCHO cells. A, schematic illustrationof the metal-induced amplification procedure. B , determination of ligand-binding affinity. TABLEI Pools of parental CHO K1 (W, grown under noninducing conditions), Amplification of full length and truncated glucocorticoid pMT-GR (A,grown under maximally inducingconditions),or pMTreceptor expressed in CHO cells AGR (0,grown undermaximallyinducing conditions)cells were The ligand-binding activitiesof expressed receptorswere analyzed incubated with increasing concentrations of [3H]dexamethasonein the absence (total binding) or presence of an excess of radioinert under noninduced (parental CHO K1 cells) or metal-induced(pMTtriamcinolone acetonide (nonspecific binding). Binding was deter- GR and pMT-AGR cells) conditions as described under “Experimenmined by the whole cell binding assay described under “Experimental tal Procedures” and in the legend of Fig. 2. Levels of maximally Procedures.”Specific binding was calculated by subtracting nonspe- bound steroid and Kd values were calculated by Scatchard analysis. cific from total binding. Shown in a Scatchard analysis of the satu- The present values weredetermined in at least two independent ration binding data. B , specific binding of hormone; F, free hormone. assays. Receptor

pressed receptor protein, pools of cells were analyzed by a whole cell binding assayfor steroid-binding activity. Parental CHOK1 cells grown undernoninducingconditions were found to contain very low levels of receptor (approximately

Parental CHO K1 GR (clone 36) AGR (clone 29)

nM

Abundance moleculeslcell

1 6.6

-10,000 400,000-520,000

2.2

300,000-350,000

Kd

Expression of Human Glucocorticoid Receptor A

6

10081

CH0:GR

NS

T

"1

c

Cold ligand (nM)

B

1

CH0:AGR

2 CHO : GR

mix

1

clone 36 NS

1

2

T

NS

3

4

C H O : AGR Cold ligand

mix

(nM)

FIG.3. Steroid binding specificity of glucocorticoid receptor expressed in CHO cells. Pools of cells grown under inducing conditions in 1.50 V M Zn'+ were incuhated with 10 nM [.'H]dexamethor presence of increasing concenasone in the ahsence (100% bound) trations of the following radioinert competitor steroids: dexamethatriamcinoloneacetonide (+); R5020 (0);RU 486 (A); sone (0); estradiol (A); and testosterone (0).Binding was determined by the whole cell binding assay. Shown are binding curves for the expressed full length glucocorticoid receptor ( A ) or the amino terminally truncated LGR receptor ( R ) .

Analysis of pMT-AGR cells (unamplified mixed clones or amplified clone 29 alone) revealed a ["Hldexamethasone mesylate bound species migrating in the 40-kDa region of the gel (Fig. 4C). In both pMT-GR and pMT-AGR cells, more than a 10-fold difference in ["Hldexamethasone mesylate-binding activity was observed between unamplifiedand amplified cells (Fig. 4, R and C, compare lanes 1 and 3 ) . ["HIDexamethasone mesylate was specifically bound in the extracts from all the different CHO cell lines as indicated by the absence of radiolabeled protein in the presence of excess unlabeled triamcinolone acetonide (Fig. 4, compare lanes 1 and 3 to lanes 2 and 4 ) . The anti-rat glucocorticoid receptor monoclonal antibody 5 (Okret etal., 1984) recognized in amplified pMT-GR cell extracts a protein of 94 kDa that was indistinguishable with respect to electrophoreticmobility from the purified rat liver glucocorticoid receptor (Fig. 4 0 , compare lanes 1 and 2). DNA-binding Activity of Expressed Receptors-Expressed receptors were analyzed for receptor-dependent DNA-binding activity to aradiolabeledsingle copy GRE probeina gel mobility shift assay. Small-scale cytosolic extracts were prepared from amplified pMT-GR and pMT-AGR cells. Fig. 5A shows that the migration position of a major protein-DNA complex (indicated by an arrow) formed with each cytosolic extract correlated very well with the predictedsize of the expressed proteins. Thus, in extracts from pMT-AGR cells, the protein-GRE complex exhibited a faster relative mobility thanthecorresponding complex present in extracts from

clone 29 NS

1

1

NS

c

D

1

2

pMTGR

3

rGR

4

kD I97 I 67

t 43 I 30

1

2

FIG. 4. Affinity labeling and immunoanalysis of expressed

glucocorticoid receptor. A-C, pools of cells grown under inducing conditions in 40 V M Cd" were labeled for 1 h at 37 "C with 20 n M ["H]dexamethasonemesylateintheahsence(totalbinding, 7') or presence (nonspecific hinding, N S ) of a 300-fold molar excess of the radioinert competitor triamcinolone acetonide. Cells were lysed in a detergent-containing huffer, and a cytosolic extract was prepared as describedunder"ExperimentalProcedures."Affinity laheled complexes were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and visualized by autoradiography. A, receptor present in parental CHO K1 cells; R, expressed full length receptor in unamplified or amplified pMT-GR cells; C, expressedtruncated recept.or in unamplifiedor amplified pMT-LGR cells. Arrows indicate specifically labeled complexes; 11, immunoblot analysis of expressed full length receptor. Cytosol was prepared from amplified pMT-GlI cells (clone X ) , resolved hy sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and immunohlotted with the antireceptor antibody 5 (lane I). Purified rat liver glucocorticoid receptor (94 k D a ) was applied on the samegel for comparison (Ianr 2).

Expression of Human Glucocorticoid Receptor

10082 A

Protein:

I

=E

a

1 2 3 u w

B Competitor:

aa ux

-m I

.

_ i

between amino acids 409 and 414 (Eriksson and Wrange, 1990, and references therein). Moreover, the AGR protein and the a-chymotrypsin-inducedreceptor fragment are similar in molecular weight and increased levels of nonspecific DNA-bindingactivityto a mutantform of glucocorticoid receptor (referred to as the nt' mutant) found in a glucocorticoid-resistant lymphoma cell line (Miesfeld et al., 1984, and references therein). Interestingly, in addition to expressing high levels of nonspecific DNA-binding activity i n vitro, the amino-truncated 40-kDa nt' mutant receptor is also retained in the nucleus more efficiently than the wild-type receptor (Westphal et al., 1984, and references therein). Transcriptional Activityof Expressed Receptors-Trans-activating properties of expressed receptor proteinswere investigated by a functional assay in vivo, in which we measured theirability to activate a reporterconstructcarryingthe sequence codingfor humangrowth hormone under the control of the long terminal repeat of mouse mammary tumor virus (Fig. 6 A ) . Regulation of this mouse mammary virus reporter (referred to as MMTV-hGH2) was monitored by immunochemical determination of human growth hormone levels in the cell medium following transfection into either pMT-GR

1 2 3 4

FIG. 5. Specific bindingactivity of expressedglucocorticoid receptor to a single copy GRE probe. A, electrophoretic gel mobility shift analysisof protein complexes formed with a"'P-labeled GRE probe and cytosolic extracts from untreated pMT-GR (lane 2 ) or pMT-LGR cells (lane 3 ) .23, a competition assaywas performed by incubation of the radiolabeled probe with a cytosolic extract from untreated pMT-GR cells in the absence(lane 2 ) or presence of either a 40-fold molarexcess of unlabeled GRE (lane 3 ) or an identical excess of an unrelatedsequence spanning thedioxin response element XREl (lane 4 ) . Protein-DNA complexes were visualized by autoradiography. The GRE-specific complex is indicated by an arrow. In both panels, lane I shows the mobility of the unbound probe (Free) in the absence of any added protein.

pMT-GR cells (compare lanes 2 and 3 ) . The levels of DNAbinding activity of the AGR protein were lower relative to those of the full length receptor, consistent with the about2fold lower expression levels of ligand-binding activityof AGR receptor in whole cell steroid-binding assays (summarized in Table I).As a control, thelow levels of glucocorticoid receptor present in extracts from the parental CHO K1 cells were unabletogeneratetheprotein-GRE complex (datanot shown). Formationof the GREcomplex by cytosolic extracts from pMT-GR cells was competed for by the addition of an excess of unlabeled wild-type GRE oligonucleotide (Fig. 5B, compare lanes 2 and 3). In contrast, an oligonucleotide containing the dioxin response element X R E l of the rat cytochrome P-450IA1 gene did not compete for binding (Fig. 5B, lane 4 ) . A GRE complex of identical specificity and mobility was generated by nuclear extracts prepared from dexamethasone-treated pMT-GR cells (data not shown). Thus, these experiments stronglysuggest that the retardation of the GRE probe was the resultfrom specific receptor-DNA interactions. In the case of the AGR protein, oligonucleotide competition experiments indicated little specificity for the GRE probe. Maximally a2- to 4-fold difference in GREcomplex formation by the AGR protein could be detected in the presence of a n excess of the unlabeled GRE or XRE sequences, respectively (data not shown), indicating some, albeit low, specificity of the AGR protein for its target DNA sequence. The high levels of nonspecific DNA-binding activityof the AGR receptor are in excellent agreement with thebehavior of a similar deletion mutant of the rat glucocorticoid receptor which can be generated by a-chymotrypsin cleavage of the purified protein

PUMlV-hGH 2 hGH

mUll

De.

- +

- +

- +

a

5

"

S

T

" r g

"

!

0

FIG. 6. Induction of the mouse mammary tumor virus promoter by the expressed receptor. A, reporter construct for functionalanalysis of expressedreceptorforms. R, activity of the pMMTV-hGH2transcriptionunitinparentaland glucocorticoid receptor-expressing CHO cells. Parental CHOK1, pMT-GR, or pMTAGR cellswere transiently transfected with pMMTV-hGH2 and incubated for 48 h in the absence (filled columns)or presence (hatched columns) of 1 p~ dexamethasone. Secreted growth hormone levels were determined by a radioimmunoassay as described under "Experimental Procedures." Each value represents the average of a t least two independent transfections.

Expression of Human Glucocorticoid Receptor A

OM

-

none

-- 24h

-

48 h

i

28518s-

1

2

,

I

4

6

8

7

9

101112

B

Dexamethasone treatment[h] 48

24

0

kD 4 97 4 67

443 4

1

2

3

\y

'=l

'2Y';I!

I r m

"3"

1

l'ji

.;

,':I i

I

:ii

,*Iolbl..l: i .m

(

. i-/,"i

l:i

i:

1

1

'i1.j

0..

f

2

P

Y

P

Y

CHO K1

D

150

-

100

3

.

:

3

E 50

0 Time 01 induclion (h)

CH0:GRmlx

E

300

s 1

200

-

3

c

30

10083

or pMT-AGR cells. As shown in Fig. 6R, addition of dexamethasone results in a 4-fold induction of reporter activity in CHO parental the presumably K1 cells, the attributable to low levels ofreceptor present native in these cells. No GH was detected by the employed radioimmunoassay in the mecells, dium of mock-transfected cells (not shown). In pMT-GR dexamethasone induced a dramatic increase (about 75-fold) in reporter activity. The high degree of inducibility of reporter activity seen in pMT-GR cells strongly supports the notion changes that cellular in glucocorticoid receptor levels are paralleled by changes cellular in responsiveness to glucocorticoid hormones. Such relationships between receptor concentration and target gene induction have previously been indicated in eukaryotic receptor expression experiments (Miesfeld et al., 1986; Hirst et al., 1990) or by manipulation of the level of endogenous pools of receptor (Dong et al., 1989). contrast In pMT-GR to cells, only a 9-fold increase in reporter activit.y was detected in pMT-AGR cells upon dexamethasone treatment (Fig. 6R), consistent with the deletion of the major amino-terminal trans-activating domain in the expressed LGR protein. Hormone-induced Down-regulation of Expressed Receptor mRNA-Dexamethasone induces a subtlereduction (about 2to 3-fold) in the levels of native glucocorticoid receptor mRNA and proteinin rat liver and hepatomacells (Okret etal., 1986; Rosewicz et al., 1988; Dong et al., 1988, and references therein). In the case of stably transfected CHOcells, exposure todexamethasone resultedin abouta 2- to 6-fold downregulation of steady-state levels of both the 3.1-kb glucocorticoid receptor mRNA encoding the full length protein and the 1.8-kb AGR(Fig. mRNA The7A). down-regulated mRNA levels were detected after 24 and 48 h of treatment. Interestingly, dexamethasone-induced down-regulation of receptor mRNAinobserved was also CHO cells transfected stably with theexpression vector pMT-LBD which encodes only the ligand-binding domain of the human receptor and yields a 1.6-kb mRNA (Fig. 7.4, compare lanes 2,6, and IO). The effect of dexamethasone on cellular levels of the expressed full length receptor protein was analyzed in immunoblot assays employing the monoclonal antibody 5 (Okret et al., 1984) which is directed an against within epitope the aminoterminus of thereceptor(Rusconiand Yamamoto, full length receptor, AGR, or the ligand-binding domain, respectively, were treated with 1 V M dexamethasone in uiuo prior to analysis of RNA protein and the at indicated points of time. A, RNA blot analysis

of mRNAs. receptor isolated, Total wasRNA resolved by electrophoresis, and blot-hybridized as described under "Experimental Procedures." R, immunoblot analysisof full length receptorlevels following exposure of pMT-GR cells (clone 36) todexamethasone i n uiuo. 0 Cytosol was prepared, resolved by sodium dodecyl sulfate-polyacrylT h e 01 induclion (h) amide gel electrophoresis, immunohlotted and withantireceptor the antibody 5. C, effect of dexamethasone on human metallothionein Ila promoter/SV40enhanceractivityinthepMT expressionvector. CH0:GR (clone 36) 150 human (encoding pMT-hGH growth hormone) was transtransiently or pMT-GR cells. Following fected intoeitherparentalCHOK1 transfection, cells were incubated for 48 h either in the absence (filled -3 columns) or presencecolumns) (hatched of 1 C M dexamethasone, as & 100 indicated. Secreted growth hormone levels were monitored radioimmunochemically. Values represent the average of at least two inde2 c transfections. pendent 11-F,effect of dexamethasone on pMT-driven 5 50 expression levels phosphatase. (encoding alkaline pMT-AF of human the secreted form of human alkaline phosphatase) was transiently transfected into either parental CHO K1 ( I ) ) , unamplified pMT-GR 0 (designated mix; E ) , or amplified pMT-GR (clone 96, F ) cells. Fol0 24 48 48 lowing transfection, the cell medium was substituted by fresh medium Time 01 induclion (h) containing 1 V M dexamethasone, and secreted alkaline phosphatase FIG. 7. Hormone-induced down-regulation of expressed levels were assayed in aliquots of the medium after the indicated periods of time of incubation. mock, mocktransfection. Values reprereceptor mRNA and protein. Amplified cell clones expressing the sent the average of at least two independent transfections, P

-

100

10084

Expression of Human Glucocorticoid Receptor

and the unmasking of the previously cryptic GRE-binding activity (Denis et al., 1988). Apart from inhibiting the DNAbinding activity of the receptor, hsp 90 has recently been suggested to be required for high affinity interaction of the receptor with its ligands (Bresnik et al., 1989; Nemoto et al., 1990a,199Ob). Given this background, the investigation of glucocorticoid receptor action will require the isolation and reconstitution of the latent heteromeric receptor complex. In pMT-GR cells, transcription of the glucocorticoid responsive reporter gene was very low in the absence of hormone, indicating that the receptor is present in its latent state, even when expressed at high levels. Thus, these cells could prove to be useful in exploring the role of inhibitory proteins (presumably hsp 90) in modulating functional activities of the receptor protein and, in particular, facilitate purification of the latent heteromeric receptor complex. Autologous down-regulation of glucocorticoid receptor mRNA and protein is a well studied phenomenon in a variety of target cells and tissues (Dong et al., 1988; Rosewicz et al., 1988, and references therein). During the preparation of this article, dexamethasone-induced down-regulation of expressed human glucocorticoid receptor mRNA was reported (Burnstein et al., 1990). In the present study, it was possible to demonstrate dexamethasone-induced down-regulation of both expressed full length and truncatedreceptor mRNAs and the full length protein. The degree of down-regulation of steadystate levels of expressed receptor mRNA wassimilar in pMTGR (about 6-fold) and pMT-AGR (about 5-fold) cells. In pMT-LBD cells it was not possible to reach such a quantitative estimate since the levels of the down-regulated receptor were below the limit of detection. In marked contrast to the results on the effect of hormone on expressed glucocorticoid receptor levels, hormone treatment had no negative effect on either growth hormone or alkaline phosphatase levels exDISCUSSION pressed from identical expression vectors. Thus, these data We have obtained high level expression of recombinant strongly suggest that hormone-induced down-regulation of glucocorticoid receptors in CHO cells. The expressed full the receptor was not a transcriptionaleffect. The present experiments indicate that regulatory signals length receptor exhibited the steroid and DNA-binding properties characteristic of the authentic receptor, and, impor- determining, at least in part, hormone-dependent down-regtantly, the expressed full length receptor induced a very high ulation are containedwithin the cDNA fragment encompasstranscriptional activity from a glucocorticoid-responsivepro- ing the steroid-binding domain (corresponding to amino acids moter upon hormone treatment. Consistent with the deletion 500-777) of the human glucocorticoid receptor. It is an interof the major trans-activating domain of the receptor, the AGR esting issue whether these putative regulatory signals deterprotein expressed wild-type hormone-binding activity but ac- mine post-transcriptional modification of the mRNA, possibly tivated transcriptionconsiderably less efficiently than thefull triggered by interaction of the mRNA with the ligand-actilength protein and exhibited high levels of nonspecific DNA- vated (expressed and/or endogenous) receptor itself. In line with this notion, it is possible to distinguish GRE-like sebinding activity in vitro. The expression levels obtained in the present study may quence motifs within the glucocorticoid receptor cDNA and not be sufficiently high to facilitate structural studies on the to demonstrate specific recognition of these sequences by in receptor. In the case of the isolated DNA-binding domain of vitro DNA-binding assays (Okret et al., 1986; Burnstein et al., the rat glucocorticoid receptor, prokaryotic expression sys- 1990). In certain model systems structural motifs within tems (Freedman et al., 1988;Dahlman et al., 1989)have proven mRNA molecules can function as determinants of mRNA to be suitable to generate the amounts of proteins required turnover. For instance, turnover of c-fos mRNA appears to for the elucidation of its three-dimensional structure in solu- require ongoing translation of the c-fos mRNA itself, rather tion (Hard et al., 1990). Moreover, very high levels of expres- than continuous synthesis of a degradative protein, and degsion (about 1x IO6 molecules/cell) have been reported for the radation of the c-fos mRNA is facilitated by 3' AU-rich full length human glucocorticoid receptor in Spodoptera fru- sequences (Wilson and Treisman, 1988). However, it should giperda cells employing a baculovirus expression vector sys- be noted that metabolic inhibition experiments showed no tem (Srinivasan and Thompson, 1990).However, mammalian detectable effect of dexamethasone on the half-life of the cell lines enriched in receptor will be an important tool in the endogenous glucocorticoid receptor mRNA half-life (Dong et investigation of the role of the ligand duringtarget gene al., 1988 Rosewicz et al., 1988), whereas it was possible to activation. In a hormone-free environment the receptor ap- observe a subtle (about 2-fold) dexamethasone-induced depears to be initially present in an inactive form which does crease in the rateof glucocorticoid receptor gene transcription not bind DNA and which is associated in vitro with the 90- in treated cells (Dong et al., 1988; Rosewicz et al., 1988). In kDa heat shock protein, hsp 90 (Sanchez et al., 1987; Denis conclusion, the mechanism of glucocorticoid receptor autoreget al., 1988). Hormone treatment results in release of hsp 90 ulation is still not understood, but the present expression 1987). This assay demonstrated that the expressed 94-kDa receptor species present in whole cell extracts from pMT-GR cells was down-regulated by dexamethasone about 2-fold after 24 h of treatment, or about 4-fold after 48 h of treatment (Fig. 7B, compare lunes 1-3). Dexamethasone did not have any negative effect on the levels of human growth hormone expressed from the pMT vector (pMT-hGH) transfected into parental CHO K1 cells or into pMT-GR cells (Fig. 7C). On the contrary, a small positive effect of dexamethasone on growth hormone expression was discernible against the high background levels of growth hormone being expressed in the absence of hormone (Fig. 7C, compare filled columns to hatched columns). This observation was confirmed by inserting a different reporter gene, alkaline phosphatase, into the pMTexpression vector. The resulting alkaline phosphatase expression vector was transiently transfected into both parental CHO K1 cells as well as into unamplified and amplified (clone 36) cells expressing full length glucocorticoid receptor. Following transfection, the cell medium was substituted by fresh medium containing 1PM dexamethasone. In the presence of hormone, the secreted levels of alkaline phosphatase activity were increased in a time-dependent manner inall the tested cell lines (Fig. 7, D-F) including pMT-AGR cells (data not shown). Taken together, these resultsdemonstrate that hormoneinduced down-regulation of glucocorticoid receptor mRNA and protein levels couldnot be explained by direct inhibition of the function of either the metallothionein promoter or SV40 enhancer, resulting in decreased levels of transcription from the pMTvectors. Thus, our data strongly argue that the negative effect of hormone on expressed receptor levels are due to post-transcriptional modification of the receptor transcript.

Expression of Human Glucocorticoid Receptor

10085

system may prove to beuseful in continued efforts to unravel Hard, T., Kellenbach, E., Boelens, R., Maler, B., Dahlman, K., FreFdman, L. P., Carlstedt-Duke, J., Yamamoto, K. R., Gustafsson, the natureof this process. Acknowledgments-We thank Dr. Anthony Wright for providing us with the AGR and the LBD plasmid constructs, California Biotechnology Inc. for providing full length receptor cDNA, and Dr. P. Kushner for helpful discussions. The placental alkaline phosphatase gene was generously provided by Hoffmann-LaRoche Inc. (Nutley, NJ). REFERENCES Beato, M. (1989) Cell 56,335-344 Beato, M., and Feigelson, P. (1972) J. Biol. Chem. 2 4 7 , 7890-7896 Berger, J., Hauber, J., Geiger,R., and Cullen, B. R. (1988) Gene (Amst.) 6 6 , l - l O Bresnick, E. H., Dalman, F. C., Sanchez, E. R., and Pratt, W. B. (1989) J . Biol. Chem. 2 6 4 , 4992-4997 Burnstein, K. L., Jewell, C.M., and Cidlowski, J. A. (1990) J. Biol. Chem. 265,7284-7291 Dahlman, K., Stromstedt, P.-E., Rae, C., {ornvall, H., Flock, J.-I., Carlstedt-Duke, J., and Gustafsson, J.-A. (1989) J. Biol. Chem. 264,804-809 Denis, M., Poellinger, L., Wikstrom, A.-C., and Gustafsson, J.-A. (1988) Nature 3 3 3 , 686-688 Dona, Y., Poellinger, - . L.,. and Gustafsson. J.-A.(1988) Mol. Endocrinol. 2,7256-1264 Done. Y.. Aronsson. M.. Gustafsson. J.-A.. and Okret., S.(1989) . , J. BEl. &em. 264,13679-13683 ' Eriksson, P., and Wrange, 0 . (1990) J. Biol. Chem. 2 6 5 , 3535-3542 Evans, R. M. (1988) Science 240,889-895 Freedman, L. P., Luisi, B. F., Korszun, Z. R., Basavappa, R., Sigler, P. B., and Yamamoto, K. R. (1988) Nature 334,543-546 Freedman, L., Yoshinaga, S., Vanderbilt, J., and Yamamoto, K. R. (1989) Science 245, 298-300 Friedman, J. S., Cofer, C. L., Anderson, C. L., Kushner, J. A., Gray, P. P., Chapman, G. E., Stuart, M. C., Lazarus, L., Shine, J., and Kushner, P. J. (1989) Biotechnology 7,359-362 Frost, E., and Williams, J. (1978) Virology 9 1 , 39-50 GiguBre, V., Hollenberg, S. M., Rosenfeld, M. G., and Evans, R. M. (1986) Cell 46,645-652 Graham, F. L., and van der Eb, A. J. (1973) Virology 52,456-467 Hapgpod, J., Cuthill, S., Denis, M., Poellinger, L., and Gustafsson, J.-A. (1989) Proc. Natl. Acad. Sci. U. 5'. A. 86, 60-64

J.-A., and Kaptein, R. (1990) Science 2 4 9 , 157-160 Hirst, M.A., Northrop, J. P., Danielsen, M., and Ringold, G. M. (1990) Mol. Endocrinol. 4 , 162-170 Hollenberg, S.M., Weinberger, C., Ong, E. S., Cerelli, G., Oro, A., Lebo, R., Thompson, E. B., Rosenfeld, M. G., and Evans, R.M. (1985) Nature 3 1 8 , 635-641 Israel, D. I., and Kaufman, R. J. (1989) Nucleic Acids Res. 17, 45894604 Klock, G., Strahle, U., and Schutz, G. (1987) Nature 3 2 9 , 734-736 Miesfeld, R., Okret, S., Wikstrom, A.-C., Wrange, O., Gustafsson, J.A.,and Yamamoto, K. R. (1984) Nature 3 1 2 , 779-781 Nemoto, T., Ohara-Nemoto, Y., Denis, M., and Gustafsson, J.-A. (1990a) Biochemistry 2 9 , 1880-1886 Nemoto, T., Mason,*G.G . F., Wilhelmsson, A., Cuthill, S., Hapgood, J., Gustafsson, J.-A., and Poellinger, L. (1990b) J.Biol. Chem. 265, 2269-2277 Okret, S., aNikstrom, A.-C., Wrange, O., Andersson, B., and Gustafsson, J.-A. (1984) Proc. Natl. Acad. Sci. U. S. A. 8 1 , 1609-1613 Okret, S., Poellinger, L., Dong, Y., and Gustafsson, J.-A. (1986) Proc. Natl. Acad. Sci. U. S. A. 8 3 , 5899-5903 Rosewicz, S., McDonald, A. R., Maddux, B. A., Goldfine, I. D., Miesfeld, R. L., and Logsdon, C.D. (1988) J. Biol. Chem. 2 6 3 , 2581-2584 Rousseau, G. G. (1975) J. Steroid Biochem. 6 , 75-94 Rusconi, S., and Yamamoto, K. R. (1987) EMBO J. 6, 1309-1315 Sambrook, J., Fritsch,E. F., and Maniatis, T. (1989) Molecular Cloning; A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Sanchez, E. R., Meshinchi, S., Tienrungroj, W., Schlesinger, M. J., Toft, D. O., and Pratt, W.B. (1987) J. Biol. Chem. 262, 69866991 Srinivasan, G., and Thompson, E. B. (1990) Mol. Endocrinol. 4 , 209216 Tizard, R., Cate, R. L., Ramachandran, K. L., Wysk, M., Voyta, J. C., Murphy, 0. J., and Bronstein, I. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,4514-4518 Weber, F., de Villiers, J., and Schaffner, W. (1984) Cell 3 6 , 983-992 Westphal,H. M., Mugele, K., Beato, M., and Gehring, U. (1984) EMBO J. 3 , 1493-1498 Wilson, T., and Treisman, R. (1988) Nature 3 3 6 , 396-399 Wrange, 6, Okret, S., Radojcic, M., Carlstedt-Duke, J., and Gustafsson, J.-A. (1984) J. Biol. Chem. 259,4534-4541 Yamamoto, K. R. (1985) Annu. Reu. Genet. 19, 205-252