of a cephalosporin C acylase from Pseudomonas strain N176 ... cyanate and site-directed point mutagenesis of the cephalosporin C acylase, we have deduced ...
Eur. J. Biochem. 230,773-778 (1995) 0 FEBS 1995
High-level production, chemical modification and site-directed mutagenesis of a cephalosporin C acylase from Pseudomonas strain N176 Yoshinori ISHII, Yoshimasa SAITO, Takao FUJIMURA, Hitoshi SASAKI, Yuji NOGUCHI, Hisashi YAMADA, Mineo NIWA and Kyoichi SHIMOMURA Pharmacological Research Laboratories, Fujisawa Pharmaceutical Co., Ltd., Osaka, Japan (Received 16 December 1994/31 March 1995)
-
EJB 94 1942/3
A cephalosporin acylase from Pseudomonas strain N176 hydrolyses both 7-p-(4-~arboxybutanamido)cephalosporanic acid (glutarylcephalosporanic acid) and cephalosporin C to 7-amino-cephalosporanic acid. However, its productivity in the original host was low and its activity against cephalosporin C was not sufficient for direct large-scale production of 7-amino-cephalosporanic acid. In order to overcome these problems, we established a high-level expression system for the acylase in Escherichia coli. Tyr270 in the acylase is reported to play an important role in the interaction with glutarylcephalosporanic acid, as determined from the reaction with an affinity-label reagent, 7p-(6-bromohexanoylamido) cephalosporanic acid [Ishii, Y., Saito, Y., Sasaki, H., Uchiyama, F., Hayashi, M., Nakamura, S. & Niwa, M. (1994) J. Ferment. Bioeng. 77,598-6031 and modification with tetranitromethane [Nobbs, T. J., Ishii, Y., Fujimura, T., Saito, Y. & Niwa, M. (1994) J. Ferment. Bioeng. 77, 604-6091, From carbamoylation with potassium cyanate and site-directed point mutagenesis of the cephalosporin C acylase, we have deduced that Tyr270 exists at a position where it can interact with a residue (possibly Ser239) corresponding to inactivation by carbamoylation. We mutated Met269 and Ala271 of the acylase and found that mutation of Met269 to Tyr or Phe caused a 1.6-fold and 1.7-fold increase, respectively, of specific activity against cephalosporin C as compared to that of the wild-type enzyme. Kinetic studies of these mutants revealed that their k,,, values increased, although their Km values against cephalosporin C were not changed. These data indicate that the mutation of Met269 near Tyr270 induces a minor conformational change to increase the stability of the activated complex with the enzyme and cephalosporin C. In particular, a mutant in which Met269 was replaced by Tyr was 2.5-fold more efficient in converting cephalosporin C to 7-aminocephalosporanic acid than the wild-type enzyme under conditions similar to those in a bio-reactor system. Keywords. Cephalosporin C ; site-directed mutagenesis ; 7-amino-cephalosporanic acid ; carbamoylation ; bioreactor.
Recently, enzymic production of chemicals has been preferred to that of the chemical method because plant investment costs are lowered and the ecological problem of organic solvent disposal is eliminated. For 7-amino-cephalosporanic acid, a key intermediate in the production of cephem antibiotics, a two-step enzymic method is attractive in which cephalosporin C is converted to 7-~-(4-carboxybutanamido)cephalosporanicacid (glutarylcephalosporanic acid) with D-aminO acid oxidase and hydrogen peroxide, followed by hydrolysis of glutarylcephalosporanic acid to 7-amino-cephalosporanic acid with glutarylcephalosporanic acid acylase. Recently, a cephalosporin C acylase which directly catalyzes the hydrolysis of cephalosporin C to 7amino-cephalosporanic acid and a-amino-adipic acid was isolated from a strain of Pseudomonas sp. N176 (Aramori et al., 1991a). It appeared to be useful for the one-step enzymic production of 7-amino-cephalosporanic acid from cephalosporin C. This acylase, designated as N176 acylase, consists of two polypeptide chains (aand p chains) which are formed from a single precursor protein (773 amino acid residues, 88.6 kDa; Aramori Correspondenceto Y. Saito, Pharmacological Research Laboratories, Fujisawa Pharmaceutical Co., Ltd., Kashima, Yodogawa-ku, Osaka, Japan 532 Fax: +81 6 304 1192. Enzyme. Lysylendopeptidase (EC 3.4.21.50).
et al., 1991b) and also shows glutarylcephalosporanic acid acylase activity which is 25-fold higher than that against cephalosporin C (Aramori et al., 1992). In previous studies, Tyr270 in N176 acylase was found to be the residue that was specifically modified both with an affinity-label reagent, 7P-(6-bromohexanoy1amido)cephalosporanic acid (Ishii et al., 1994) and with a non-specific nitration reagent, tetranitromethane (Nobbs et al., 1994). These results encouraged us to mutate residues near Tyr270 to improve the enzymic capability of the acylase, whose activity against cephalosporin C was not sufficient for direct production of 7-amino-cephalosporanic acid on a large scale. Furthermore, production of the enzyme either from the original host Pseudomonas sp. N176 or from recombinant Escherichia coli JM109/pCCN176-3 (Aramori et al., 1991b) was not satisfactory for the industrial production of the enzyme. In this paper, we describe the establishment of a high-expression system for the acylase in E. coli, carbamoylation of the wild-type and mutant acylases and preparation of mutant enzymes in which Met269, Tyr270 or Ala271 were altered by site-directed point mutagenesis. We also report further investigation of mutant acylases with higher cephalosporin C acylase activities, designated as [M269Y]cephalosporin C acylase or [M269F]cephalosporin C acylase, respectively, in which Met269 is replaced by
774
Ishii et al. (Euc J. Biochem. 230)
Table 1. Expression and characterization of amino-terminal variants of N176 acylase. E. coli JM109 was used as the host strain. Cultivation was performed in 0.5% M9CA broth by induction, with 8-indoleacrylic acid. The assay of glutarylcephalosporanic acid acylase activity is described in Materials and Methods. The expression level with E. coli JM109/pCCN176-3 (Aramori et al., 1992) was 0.5 units/ml. The specific activity of the wild-type enzyme against glutarylcephalosporanic acid (46.3 units/mg protein) is defined as 100. The amino-terminal sequence was determined by a 470A protein sequencer (Applied Biosystems). fM, formylmethionine. Plasmid
DNA sequence of amino-terminal region
pCK002
'M T M A A N T D CGATAAAATGACTATGGCGGCCAACACCGATC *M F Y F A N T D CGATAAAATGTTCTACTTCGCCAACACGGATC 'M T M A A N T D CGATAAAATGACTATGGCAGCTAATACGGATC 'M T M I T D
pCKOl0 pCKO13 pCKO14
CGATAAAATGACTATGATTACGGATC
Tyr or Phe, to study the possibility of direct 7-amino-cephalosporanic acid production.
MATERIALS AND METHODS Materials. Plasmid pA097 carrying a 1.2-kb kanamycin-resistant gene was a gift from Professor M. Takanami (Institute for Chemical Research, Kyoto University, Japan). Potassium cyanate was purchased from Nacalai tesque and lysylendopeptidase was from Wako Pure Chemicals. Restriction and modification enzymes were purchased from Takara Shuzo, Toyobo and New England Biolabs. Genetic engineering technique. Oligodeoxyribonucleotides were synthesized by a 381A or a 392 DNA synthesizer (Applied Biosystems). pCCN176-3 coding for native N176 acylase (Aramori et al., 1991), pCLaHtrp3t carrying a synthetic E. coli tryptophan promoter (Saito et al., 1987), and pTQiPAdtrp carrying a duplicated form of fd phage central terminator were used as starting plasmids. All DNA manipulations were performed according to the method of Maniatis et al. (1982). Site-directed mutagenesis was performed according to Kunkel et al. (1987). DNA sequencing of expression vectors was performed by a 370A or a 373A DNA sequencer (Applied Biosystems). Semi-large-scalefermentation of recombinant E. coli. E. coli JMI09 carrying an expression vector was incubated in 2.0 L medium containing 0.7% each of yeast extract (Difco), Na,HPO,. 12 H20, KH,PO, and K,HPO, 0.12% (NH,),SO,, 0.02% NH,CI, 0.155% each of Leu, Pro and Ile, 1.0% glycerol, 2 mM MgSO,, 0.1 mM CaCI, and 25 pg/ml kanamycin, at 30"C, with stirring and aeration at 350 rpm . 1.0 L a i r ' . min-' (at the start of cultivation). After 8 h, the cultivation temperature was lowered to 20°C and 10 pg/ml /I-indoleacrylic acid was added for the induction of the Trp promoter. To promote cell growth, 40 ml50% glycerol was added portion-wise at 4-56 h (18% of the final concentration) and stirring and aeration was raised stepwise to 900 rpm . 3 L air-' . min-' to maintain the required oxygen level. The cells were harvested after 72 h, when an A,, of 60 had been reached. Enzyme purification and assay. The cells from 2.0 L broth were suspended in 1.0 L 0.1 M TrisMCl, pH 8.0, treated with lysozyme (500 mg) at 4°C for 30 min, dispersed by a blender (Yamato Seiki) and centrifuged. The supernatant was treated with 0.01 % polymin P and applied to a DEAE-Toyopearl650M column (5 cm internal diameterX25 cm, Tosoh). The column was washed with 0.1 M NaCl in 20 mM Tris/HCI, pH 8.0, then eluted with 0.3 M NaCl in 20 mM TrisMCI, pH 8.0. The eluate
Expression level
Specific activity
unitdm1
% wild-type
2.75 (0.743) 4.61 (0.960) 12.0 (3.24) 5.93 (1.91)
100 92.2
100 64.4
Analyzed aminoterminal sequence of a-chain
TMAANTDRAVLQaALP MFYFANTDRAVLQAALP TMAANTDRAVLQAALP TMTDRAVLQAALP
was dialyzed against 20 mM Tris/HCI, pH 8.0, and purified on a QAE-Toyopearl 550C column (5 cm internal diarneterX13 cm, Tosoh) with a linear gradient of NaCl(0-0.5 M) in 20 mM Tris/ HC1, pH 8.0. The purified acylase was dialyzed against 25 mM Tris/HCl, pH 8.0, and concentrated to 10 mg/ml by ultrafiltration (Amicon). The homogeneity of the acylase obtained was confirmed by SDS/PAGE, IEF (PhastSystemTM,Pharmacia) and reverse-phase HPLC (Cosmosil 5C4-AR-300 column, 4.6 mm internal diameterX5 cm; Nacalai Tesque Inc. elution was with a linear gradient of 15-60% acetonitrile in 0.05 % aqueous trifluoroacetic acid over 30 min; detection was at 214 nm). Enzymic activity was determined for conversion of cephalosporin C or glutarylcephalosporanic acid to 7-amino-cephalosporanic acid. To 500 pl of the substrate (10 mg/ml in 0.15 M Tris/HCl, pH 8.7), 100 p1 sample acylase (approximately 25 pg/ ml for glutarylcephalosporanic acid and 100 pg/ml for cephalosporin C) was added and the mixture was incubated at 37°C for 5 min (glutarylcephalosporanic acid) or 10 min (cephalosporin C). The reaction was stopped by addition of 5 % acetic acid (550 pl). After centrifugation (10000 rpm, 5 min), the 7-aminocephalosporanic acid formed in the supernatant was determined by HPLC (LiChrospherTMRP-18 column, 4.0 mm internal diameterX250 mm; E. Merck; eluate was 100 mM citric acid, 5 mM n-hexane-I-sulfonate, 14.3% acetonitrile; detection was at 214nm). One unit was defined as the amount of the enzyme liberating 1.O pmol 7-amino-cephalosporanic acidmin. Protein chemistry. The protein concentrations of purified enzymes were determined by a spectrophotometric method (Wetlaufer, 1962). Carbamoylation of enzymes was performed according to Rimon and Perlmann (1968). The amino-terminal sequence was determined with a 470A protein sequencer (Applied Biosystems) and mass measurement was performed with Mat TSQ-70 (Finigan). The sequence of the carboxy-terminal region of the Q chain of N176 acylase was determined as follows: (a) isolation of the polypeptide by reverse-phase HPLC; (b) digestion with trypsin (Seikagaku Co.); (c) isolation of the carboxy-terminal fragment by anhydrotrypsin-agarose (Takara Shuzo) ; (d) amino-terminal sequencing and mass measurement of the purified peptide fragment; (e) confirmation of the resulting sequence by analysis of each tryptic peptide.
RESULTS AND DISCUSSIONS Comparative expression of vectors for amino-terminal variants of N176 acylase in E. coli. A kanamycin-resistant expression vector pCK013 was prepared from pCCO13A (Ishii et al.,
775
Ishii et al. (Eur J. Biochem. 230) a chaln
1
J.
1 Met Thr Met Ala Ala Asn AIXXAIAAAATGACTATGGCAGCIAAI (Clal)
Gly ;3ihaa'" Ser Asn GGC AGC AAC
precursor
2
3
4
5
6
7
8
94kDa
f--f
C- 45kDa
Pro Ala Ter CCGGCCTGA
-CTCGAG (Xhol)
GTCGP (Sal I fd phage central terminator (duplex form)
a -
f-
-
3OkDa
2O.lkDa
Clal 6789 Hpal6756 EcoRl Clal 5918 EcoRV 1073
Ec0471111129
EcoRl 5050
__
pCK013
~
PVUll3879
/
Fig.2. Expression of N176 acylase at various temperatures. E. co/i JM109/pCK013 was cultivated in 5 % soybean hydrolysate medium (Nobbs et al., 1994) at 3OOC. After 16 h, P-indoleacrylic acid was added to a final concentration 10 pl/ml. The cultivation was continued at 20, 25, 30 or 37°C for 72, 48, 24 or 8 h, respectively. Cells were harvested by centrifugation (7000 rpm, 10 min, 4"C), suspended in 20 ml 10 mM Tris/HCl, pH 8.0, 1.0 mM EDTA and lysed by sonication. The supernatant was recovered by centrifugation (15000rpm, 15 min, 4°C) and the precipitates were dissolved in the above buffer containing 8 M urea to obtain the precipitate fraction. Both fractions were analyzed by 12.5 % SDSPAGE. Lanes 1-4, soluble fractions; lanes 5-8, precipitate fractions; lanes 1 and 5, at 20°C; lanes 2 and 6, at 25°C; lanes 3 and 7, at 30°C; lanes 4 and 8, at 37°C. Arrows indicate the size of proteins corresponding to a and b, respectively.
1
'Hind1112373 XholZ382
Sa112466
4 -
Fig. 1. Structure of pCK013, an expression vector for N176 acylase. pCKO13 was prepared from pCCO13A (Ishii et al., 1994b) by digestion with DraI, ligated with an EcoRI linker (Pharmacia), digested with EcoRI and ligated with the 1.2-kb EcoRI DNA for the kanamycin-resistant gene from pA097. trp. E. coli tryptophan promoter; Km, kanamycin resistant gene; ter, phage central terminator (duplicated form). Restriction sites, EcoRV, SmaI, Eco47111, Hind111 and HpaI, were used for cloning of DNA fragments from the N176 acylase gene into MI3 phage to prepare templates used in Kunkel's method.
1994) to prevent the possibility of P-lactam compounds, such as 7-amino-cephalosporanic acid, glutarylcephalosporanic acid and cephalosporin C, being decomposed by P-lactamase coded in the ampicillin-resistant gene (Fig. 1).Expression vectors for the amino-terminal variants of N176 acylase were also prepared and compared with pCKO13 to study the relationship of the amino acid andor nucleotide sequences of the amino-terminal region of the acylase and the activity of the expressed proteins (Table 1). The activity of pCK013 is fourfold higher than that of pCK002 which carries the native nucleotide sequence. These data are in accordance with the experiment reported by Hall et al. (1982), indicating that the nucleotide sequence near the amino-terminal region plays an important role in the transcription of the DNA (Wood et al., 1984; Tessier et al., 1984) and the translation of the resultant mRNA (Yaesuda et al., 1990). In the case of amino-terminal variants, the mutation shown by either pCKOl0 or pCK014, coding for the amino-terminal sequence of a-hANP fused protein (Saito et al., 1987) or /3-galactosidase, respectively, resulted in a minor change in the specific activity with glutarylcephalosporanic acid (Table 1). These results are consistent with the previous report on glutarylcephalosporanic acid acylase from Pseudomonas strain C427 (Ishii et al., 1994b), suggesting that the amino-terminal sequence in the a chain of N176 acylase is not so important for enzymic activity.
Characterization and high-level production of N176 acylase. The active form of N176 acylase consists of two polypeptide
chains, a and b, which are processed from an inactive singlechain precursor protein (Aramori et al., 1991b). However, it was still unclear whether or not a spacer peptide existed at the junction region of both chains and whether or not the removal of the spacer sequence was necessary for the maturation of the enzyme. We confirmed the homogeneity of the maturated acylase by SDSPAGE, IEF and HPLC analyses, and verified that the enzyme has a single processing site. Then, we determined the entire amino acid sequence of the a chain in addition to its carboxy-terminal sequence. The a chain has the sequence ThrlGly238, which is identical to that deduced from the nucleotide sequence of the gene for the precursor. These data indicate that the precursor has no spacer sequence, in contrast to other cephalosponn and penicillin acylases (Ishii et al., 1994a; Schumacher et al., 1986). Therefore, processing at the Gly238-Ser239 bond should be a key step for the activation of the precursor and should be essential for attainment of high-level production of the acylase. When pCKO13 was expressed in E. coli JM109 at 37"C, the majority of the gene product (more than 90%) precipitated immediately as an inactive precursor protein to form an inclusion body in the cells (Fig. 2, lanes 4 and 8). It was very difficult to recover the active enzyme from the precipitated precursor (data not shown). We assumed that the production rate of the precursor at 37°C was too high for the protein to form a soluble conformation which is essential for processing in E. coli. Therefore, the cultivation temperature was lowered to 20 "C for slower production (Table 2) and for complete processing. The expressed activity (Table 2) increased as the fermentation temperature was decreased from 37°C to 20°C. These data are consistent with SDSPAGE analysis (Fig. 2) in which the amounts of both chains increased (lanes 1-4) and the amount of the precursor decreased (lanes 5 - 8) by lowering the temperature. However, cultivation at less than 17"C gave a poor yield, perhaps because the cell growth was too slow (data not shown). These results are in accordance with the experiments on the formation of soluble recombinant proteins in E. coli at lower (30°C) growth temperature (Schein and Noteborn, 1988). In the case of N176 acylase, cultivation at near 20 "C was most appropriate, probably because
776
Ishii et al. (Eur J. Biochem. 230)
Table 2. Expression of pCKOl3 at various temperatures. The cultivation method is described in Fig. 2. The expression level at 20°C is defined as 100. Temperature
A,,, at harvest
Expression
Relative expression level
Table 3. Activities of enzyme mutated at Lys239 and Ser239. Values for the wild-type acylase are 46.3 unitdmg protein and 1. 55 unitslmg protein for glutarylcephalosporanic acid and cephalosporin C, respectively. The concentration of [S239C]cephalosporin C acylase in the assayed buffer was 41.7 pg/ml (approximately 10 times as much as that of other acylases, as described in Materials and Methods). n.t., not tested.
units . ml-'
%
Mutation
10.0 8.0 7.6 6.9
23.6 16.9 12.0 7.2
100 71.5 50.8 30.5
"C 20 25 30 37
the processing of the precursor protein is an essential factor in addition to solubilization in the cells. The processed enzyme was easily purified to homogeneity by small-scale (1.0- 10 mg) preparative HPLC using Fractogel EMD DEAE-650 (M) (E. Merk) or by semi-large-scale (0.510 g) column chromatography on DEAE-Toyopearl 650M followed by QAE-Toyopearl55O"C (Tosoh) because acylase accumulated as a major acidic protein (PI = 5.8) in the cells (Fig. 2, lane 1). In the case of wild-type acylase, the yields of the expressed and purified acylase were approximately 10 g and 7 g, respectively, from 1 L cultured broth (A6oo= 60).
Carbamoylation of the wild-type acylase and mutant acylases by potassium cyanate. To investigate active residues corresponding to acylase activity, carbamoylation with potassium cyanate was performed. N176 acylase was irreversibly inactivated in a time-dependent manner by carbamoylation. The inactivation showed pseudo-first-order kinetics and a plot of log k,,, against log [potassium cyanate] (Levy et al., 1963) resulted in a straight line with a slope of 0.98 +_ 0.02. This result indicated that at least 1 mol potassium cyanate/mol enzyme was required to produced inactivation. The limitation of the kinetic method for determination of the number of essential amino acid residues is as indicated by Levy et al. (1963). In order to determine the residue(s) related to the loss of activity, we performed peptide mapping of the inactivated enzyme with lysylendopeptidase, amino-terminal sequence analysis and site-directed point mutagenesis. Although it was difficult to identify the residue(s), we propose that the most possible candidate may be Ser239, the amino-terminal residue of the p chain, This was proposed from the following data: (a) the inactivation was independent of the carbamoylation of E amino groups of Lys residues, because sitedirected point mutants of each of 10 Lys residues to Gln residues retained acylase activity (Table 3); (b) the a amino group of the amino-terminal residue of either a or p chain of the inactivated acylase was blocked ; (c) the native amino-terminal sequence of the a chain appears non-essential for acylase activity according to data from amino-terminal variants (Table 1); (d) a mutant, [S239C]acylase, in which Ser239 was converted to Cys, showed dramatically reduced glutarylcephalosporanic acid acylase activity (approximately 1 % reduction) as compared to that of the wild-type enzyme, and its cephalosporin C acylase activity could not be detected (Table 3). Ser239 is perfectly conserved with other cephalosporin and penicillin G acylases (Ishii et al., 1994a, b) and corresponds to Ser290 (numbering corresponds to that of Barber0 et al., 1986) of penicillin G acylase which acts as a nucleophile in the catalysis (Slade et al., 1991; Martin et al., 1991). Further investigation of the cephalosporin C acylase will be necessary to determine if Ser239 is an active residue for catalysis. To study the effect of mutation of Tyr270 on carbamoylation, [Y270F]acylase and [Y270A]acylase in which Tyr270 was replaced by Phe or Ala, respectively, were treated with
Activity with glutarylcephalosporanic acid
cephalosporin C
% of the wild-type acylase
K44Q K73Q KlOOQ K114Q K170Q K187Q K255Q K301Q K507Q K629Q S239C
102.0 46.9 81.0 86.0 130.0 113.0 107.1 101.0 102.0 94.2 1.21
0
10
20
111.0 47 .0 106.0 101.o 95.6 91 .I 97.0 n.t. 113.9 n.t. 0.0
30
40
50
60
70
Time (min)
Fig. 3. Inactivation of the wild-type and Tyr270 mutants by carbamoylation. The enzyme (25 pg/ml) was incubated at 37°C with 3.3 mM potassium cyanate in 20 mM Tris/HCI, pH 8.0. At intervals, an aliquot of the reaction mixture was withdrawn and gel filtrated on a Quick spinTMcolumn (Boehringer Mannheim). The residual glutarylcephalosporanic acid acylase activity was measured as described in Materials and Methods. ( 0 ) Wild-type acylase; (B) [Y270F]acylase; (0) [Y270A]acylase.
potassium cyanate. The mutation resulted in a decreased inactivation rate induced by carbamoylation and in an increase of the half-lives (approximately three-times that of the wild-type acylase; Fig. 3). These data indicate that the mutation of Tyr270 alters the reactivity of the residue attacked by potassium cyanate (possibly Ser239) and that Tyr270 may be located at a position so as to interact with the residue in the catalytic pathway.
Activities of mutants of Tyr270 and its neighboring amino acid residues. Tyr270 in N176 acylase plays an important role in the interaction with glutarylcephalosporanic acid, as determined from reaction with an affinity-label reagent, 7,!-(6-bromohexanoy1amido)cephalosporanic acid (Ishii et al., 1994b) and modification with tetranitromethane (Nobbs et al., 1994), although mutation of Try270 to Phe or Leu did not cause complete
777
Ishii et al. ( E m J. Biochem. 230) Table 4. Activities of enzyme mutated at Met269, Tyr270 and Ala271. Values for the wild-type acylase are 46.3 unitdmg protein and
1.55 units/mg protein with glutarylcephalosporanic acid and cephalosporin C, respectively. Mutation
Activity with glutarylcephalosporanic acid
cephalosporin C
% of the wild-type acylase activity
Y270L Y270F Y 270A Y270S Y270E M269L M269F M269Y A271L A271F A27 1Y
28.1
50.4 70.6 61.7 0.0 92.5 98.2 91.5 104 118 101
Table 5. Kinetic parameters of the wild-type and mutant acylases. Kinetic parameters were calculated from Lineweaver-Burk plots of the primary velocity of formation of 7-amino-cephalosporanic acid from cephalosporin C (3.33, 5.0, 10.9 and 20.0 mM) in the presence of enzymes (0.2 pM) at 37°C for 10 min. Values in parentheses are relative to wild-type values.
32.3 46.1 24.3 28.3
~
mM (%I
21.6 2 2.07 (100) [Y27OF]acylase 27.8 215.3 (126) [M269F]acylase 21.3 ? 3.59 (98.2) [M269Y]acylase 22.1l i 5.53 (102)
Wild type
s-' (%)
s-' . mM (%)
5.9320.93 (100) 2.9121.21 (47.9) 10.4 ?2.1 (173) 9.40i2.16 (159)
0.273i0.02 (100) 0.10720.02 (39.2) 0.483i0.02 (179) 0.430i0.07 (159)
0.0
107.9 165 155 100
56.2 122.2
loss of activity. From the carbamoylation of the enzyme, Tyr270 is suggested to exist near a residue important for enzyme activity. These findings suggested that mutation of residues near Try270 should result in improvement of the enzymic activity. Therefore, we prepared several mutants in which Met269, Tyr270 or Ala271 were altered by site-directed point mutagenesis and studied the effect of the mutations on the enzymic activity (Table 4). In the case of mutations at Tyr270, the mutation caused a considerable loss of glutarylcephalosporanic acid and cephalosporin C acylase activities. In particular, [Y270E]acylase showed complete loss of activity. These data are consistent with the results of previous experiments on chemical modification and point mutagenesis (Ishii et al., 1994b; Nobbs et al., 1994), indicating that Tyr270 is essential for the acylase to exert its maximum activity. In the case of mutations at Met269 and Ala271, the mutations resulted in a slight change in glutarylcephalosporanic acid acylase activity. Interestingly, specific activities of [M269Y]acylase and [M269F]acylase with cephalosporin C showed a 1.6-fold and 1.7-fold increase, respectively, over the activity of the wild-typ enzyme. These data suggest that Met269 plays a different role in cephalosporin-C-enzyme and glutarylcephalosporanic-acid-enzyme complexes. Kinetic studies of these mutants revealed that the K,, values of [M269YIacylase and [M269F]acylase for cephalosporin C were not altered compared to that of the wild-type acylase. Alternatively, their k,,, values increased 1.6-fold and 1.8-fold, respectively, compared to that of the wild-type acylase (Table 5). These data indicate that mutation of Met269 to Tyr or Phe has little effect on the recognition of cephalosporin C (i.e. the formation of enzyme-substrate complex), but causes the stabilization of the activated enzyme-substrate complex in the transition state. Therefore, we suggest that Met269 is located at a position in the cephalosporin-C -enzyme complex which is responsible for the liberation of formed 7-amino-cephalosporanic acid but not in the glutarylcephalosporanic-acid- enzyme complex.
Reaction of mutant [M269Y] cephalosporin C acylase in a bio-reactor system. To investigate the industrial application of [M269Y]acylase and [M269F]acylase, conversion of cephalosporin C and formation of 7-amino-cephalosporanic acid by these acylases were monbitored under conditions similar to those
0
20
40
60
80
100
T h e (min)
Fig.4. Conversion of cephalosporin C and formation of 7-aminocephalosporanic acid with the wild-type and mutant acylases, [M269Y]acylase and [M269F]acylase. Each enzyme (4 mg/ml) was incubated with cephalosporin C (4 mg/ml) at 25°C in 0.15 M Tris/HCl, pH 9.0. At intervals, an aliquot of the reaction mixture was withdrawn and analyzed by HPLC to determine the remaining cephalosporin C and 7-amino-cephalosporanic acid formed. ( 0 )[M269Y]acylase (7-aminocephalosporanic acid) ; (0) [M269Y]acylase (cephalosporin C) ; (A) [M269F]acylase (7-amino-cephalosporanic acid); (A) [M269F]acylase (cephalosporin C) ; (m) wild-type acylase (7-amino-cephalosporanic acid) ; (0) wild-type acylase (cephalosporin C).
in a bio-reactor system (Fig. 4). Both [M269]acylase and [M269F]acylase were more capable of converting cephalosporin C to 7-amino-cephalosporanic acid than the wild-type acylase. In particular, the yield of 7-amino-cephalosporanic acid formed with [M269Y]acylase is more than 95 % within 60 min. As compared to the wild-type acylase, [M269Y]acylase improved both the production rate of 7-amino-cephalosporanic acid and the conversion rate of cephalosporin C. To clarify the reactivity of [M269Y]acylase, the rate constant for [M269Y]acylase in the bio-reactor system was calculated. It was 9.28 t 0.06 (s-'j and increased 2.5-fold compared to that of the wild-type acylase (3.64? 0.25 s-') and, therefore, the t1,2of the remaining cephalosporin C with [M269Y]acylase was less than half that of the wild-type acylase. These data indicate that an increase in the rate constant of [M269Y]acylase directly corresponds to the improved productivity of 7-amino-cephalosporanic acid in this system. From these results, [M269Y]acylase may be a promising
778
Ishii et al. (Eur J. Biockem. 230)
new enzyme in the one-step enzymic production of 7-aminocephalosporanic acid from cephalosporin C. We thank Mr S. Miyoshi for his skillful techniques in protein analyses and Ms M. Hayashi and Ms Y. Fujishita for their technical assistance. We are grateful to Dr A. Hunt for reading the manuscript.
REFERENCES Aramori, I., Fukagawa, M., Tsumura, M., Iwami, M., Yokota, Y., Kojo, H., Kohsaka, M., Ueda, Y. & Imanaka, H. (1991 a) Isolation of soil strains producing new cephalosporin acylases, J. Ferment. Bioeng. 72, 227-231. Ararnori, I., Fukagawa, M., Tsumura, M., Iwami, M., Isogai, T., Ono, H., Ishitani, Y., Kojo, H., Kohsaka, M., Ueda, Y. & Imanaka, H. (1991b) Cloning and nucleotide sequencing of new glutaryl 7-ACA and cephalosporin C acylase genes from Pseudomonas strain, J. Ferment. Bioeng. 72, 232-243. Aramori, I., Fukagawa, M., Tsumura, M., Iwami, M., Ono, H., Ishitani, Y., Kojo, H.. Kohsaka, M., Ueda, Y. & Imanaka, H. (1992) Comparative characterization of new glutary 7-ACA and cephalosporin C acylases, J. Ferment. Bioeng. 73, 185-192. Hall, M. N., Gabay, J., Debarbouille, M. & Schwartz, M. (1982) A role for mRNA secondary structure in the control of translation initiation, Nature 295, 616-618. Ishii, Y., Saito, Y., Fujimura, T., Isogai, T., Kojo, H., Yamashita, M., Niwa, M. & Kohsaka, M. (1994a) A novel 7-P-(4-carboxybutanarnido)-cephalosporanic acid acylase isolated from Pseudomonas strain C427 and its high-level production in Escherichia coli, J. Ferment. Bioeng. 77, 591-597. Ishii, Y., Saito, Y., Sasaki, H., Uchiyama, F., Hayashi, M., Nakamura, S. & Niwa, M. (1994b) Affinity labeling of cephalosporin C acylase from Pseudomonas sp. N176 with substrate analogue, 7P-(6-bromohexanoy1amido)cephalosporanic acid, J. Ferment. Bioeng. 77, 598 603. Kunkel, T. A,, Roberts, J. D. & Zakour, R. A. (1987) Rapid and efficient site-specific mutagenesis without phenotypic selection, Methods Enzyrnol. 154, 367-382. Levy, H. M., Leber, P. D. & Ryan, E. M. (1963) Inactivation of myosin by 2,4-dinitrophenol and protection by adenosine triphosphate and other phosphate compound, J. Biol. Chem. 238, 3654-3659.
Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular cloning: a laboratory manual, pp. 1-545. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Martin, J., Slade, A,, Aitken, A., Arche, R. & Virden, R. (1991) Chemical modification of serine at the active site of penicillin acylase from Kluyvera citrophila, Biochem. J. 280, 659-662. Nobbs, T. J., Ishii, Y., Fujimura, T., Saito, Y. & Niwa, M. (1994) Chemical modification and site-directed mutagenesis of tyrosine residues in cephalosporin C acylase from Pseudomonas strain N176, J. Ferment. Bioeng. 77,604-609. Rimon, S . & Perlrnann, G. E. (1968) Carbamylation of pepsinogen and pepsin, J. Biol. Chem. 243, 3566-3572. Saito, Y., Ishii, Y., Koyama, S., Tsuji, K., Yamada, H., Terai, T., Kobayashi, M., Ono, T., Niwa, M., Ueda, I. & Kikuchi, H. (1987) Bacterial synthesis of recombinant a-human atrial natriuretic polypeptide, J. Biockem. 102, 111- 122. Schein, C. H. & Noteborn, M. H. M. (1988) Formation of soluble proteins in Esckerickia coli is favored by lower growth temperature, Biotechnology 6, 291 -294. Schumacher, G., Sizmann, D., Haug, H., Buckel, P. & Bock, A. (1986) Penicillin acylase from E. coli: unique gene-protein relation, Nucleic Acids Res. 14, 5713-5727. Slade, A,, Horrocks, A. J., Lindsay, L. C., Dumbar, B. & Virden, R. (1991) Site-directed chemical conversion of serine to cysteine in penicillin acylase from Eckerickia coli ATCC 11105. Effect on conformation and catalytic activity, Eur. J . Biockem. 197, 75-80. Tessier, L., Sondermeyer, P., Faure, T., Dreyer, D., Benavente, A., Villeval, D., Courtney, M. & Lecocq, J. (1984) The influence of mRNA primary and secondary structure on human IFN-1, gene expression in E. coli, Nucleic Acids Res. 12, 7663-7675. Wetlaufer, D. B. (1962) Ultraviolet spectra of proteins and amino acids, Adv. Prot. Chem. 17, 303-390. Wood, C. R., Boss, M. A,, Pate, T. P. & Emtage, J. S. (1984) The influence of messenger RNA secondary structure on expression of an immunoglobulin heavy chain in Escherichia coli, Nucleic Acids Res. 12, 3937-3950. Yasueda, H., Nagase, K., Hosoda, A,, Akiyama, Y. & Yamada, K. (1990) High-level expression of semi-synthetic human interleukin-6 in Escherichia coli and production of N-terminus Met-free product, Biotecknology 8, 1036-1040.
