Higher prevalence and levels of Nosema ceranae than Nosema apis infections in Canadian honey bee colonies Berna Emsen, Ernesto Guzman-Novoa, Mollah Md Hamiduzzaman, Les Eccles, Brian Lacey, Rosario A. Ruiz-Pérez & Medhat Nasr Parasitology Research Founded as Zeitschrift für Parasitenkunde ISSN 0932-0113 Parasitol Res DOI 10.1007/s00436-015-4733-3
1 23
Your article is protected by copyright and all rights are held exclusively by SpringerVerlag Berlin Heidelberg. This e-offprint is for personal use only and shall not be selfarchived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.
1 23
Author's personal copy Parasitol Res DOI 10.1007/s00436-015-4733-3
ORIGINAL PAPER
Higher prevalence and levels of Nosema ceranae than Nosema apis infections in Canadian honey bee colonies Berna Emsen 1,2 & Ernesto Guzman-Novoa 2 & Mollah Md Hamiduzzaman 2 & Les Eccles 3 & Brian Lacey 3 & Rosario A. Ruiz-Pérez 1,4 & Medhat Nasr 5
Received: 18 June 2015 / Accepted: 4 September 2015 # Springer-Verlag Berlin Heidelberg 2015
Abstract This study was conducted to determine the prevalence and infection levels of the microsporidia fungi Nosema apis and/or Nosema ceranae in honey bee colonies of two Canadian provinces. Three surveys were conducted in the springs of 2008, 2010 and 2012 and PCR identification of Nosema species were performed in samples from 169 and 181 Ontario colonies and from 76 Alberta colonies that tested positive to Nosema spp. Infection levels of positive colonies were determined by microscopy and analyzed by Nosema spp. Results showed that N. ceranae was the dominant species in all three surveys (prevalence range of 41–91 vs. 4–34 % for N. apis), whereas mixed infections were less frequent than single infections (5–25 %). Infection levels of colonies parasitized by N. ceranae were three to five times higher than those of colonies parasitized by N. apis in the three surveys whereas mixed infections showed the highest spore counts. This is the first field study demonstrating significantly higher infection levels in colonies parasitized with either N. ceranae only or with both, N. ceranae and N. apis, than in colonies parasitized with N. apis only. Taken together, these results
* Ernesto Guzman-Novoa
[email protected] 1
Department of Animal Science, Ataturk University, Erzurum 25240, Turkey
2
School of Environmental Sciences, University of Guelph, 50 Stone Road East, Guelph, Ontario N1G 2W1, Canada
3
Ontario Beekeepers Association, 5420 – 185 Hwy 6 N, Guelph, Ontario N1H 6J2, Canada
4
Departamento de Producción Animal: Abejas, FMVZ, UNAM, Cd. Univ, Mexico, D.F. 04510, Mexico
5
Crop Diversification Centre North, Alberta Agriculture and Food, Edmonton, Alberta T5Y 6H3, Canada
suggest that N. ceranae may be more virulent and better adapted than N. apis in cold climates such as Canadian environments. Keywords Nosema ceranae . Nosema apis . Microsporidia . Apis mellifera . Prevalence . Virulence
Introduction The parasitic fungus Nosema apis was thought to be the only microsporidium to infect epithelial cells in the midgut of adult honey bees (Apis mellifera) and to cause nosema disease in these insects (Matheson 1993). However, it was recently discovered that another microsporidium, Nosema ceranae, also infects western honey bees (Higes et al. 2006; Huang et al. 2007); thus, surveys have been conducted in many countries to find out where this parasite exists and how prevalent it is. It has been proposed that N. ceranae is a relatively new parasite of A. mellifera that jumped from the Asian honey bee, Apis cerana, to European honey bees, and has recently dispersed (Fries et al. 2006; Higes et al. 2006; Klee et al. 2007; Martín-Hernández et al. 2007; Botías et al. 2012; GómezMoracho et al. 2015). Today, we know that N. ceranae infects A. mellifera worldwide (Klee et al. 2007; Martín-Hernández et al. 2007; Chen et al. 2008; Calderón et al. 2008; Giersch et al. 2009; Invernizzi et al. 2009; Guzman-Novoa et al. 2011; Yoshiyama and Kimura 2011) and that it has been infecting honey bees since at least 1993 in Europe (Ferroglio et al. 2013), 1979 in South America (Teixeira et al. 2013) and 1975 in North America (Traver and Fell 2015). The above studies thus demonstrate that N. ceranae has infected bees in the Americas for several decades. In Canada, in particular, the oldest record of the presence of N. ceranae is from bees collected in 1994 in Alberta (Currie et al. 2010). Limited
Author's personal copy Parasitol Res
Canadian surveys showed that out of 79 samples from eight provinces that were tested for Nosema species in 2008, 24 % were found to contain only N. ceranae, 28 % to contain only N. apis and 32 % to contain both species (Currie et al. 2010). In Quebec, bees from six hives were sampled from 2008 to 2010 to quantify Nosema infections by species. Results showed that in those colonies, N. ceranae was the more prevalent parasite (Copley et al. 2012). It has also been suggested that N. ceranae may be replacing N. apis in honey bee populations because its prevalence has increased in some regions of the world (Klee et al. 2007; Martin-Hernandez et al. 2007; Paxton et al. 2007; Higes et al. 2009; Yoshiyama and Kimura 2011). However, this hypothesized displacement does not seem to have occurred worldwide. Gisder et al. (2010) found no evidence of Nosema spp. replacement in German bee populations where N. apis was still the more prevalent species. Additionally, studies on the prevalence and distribution of Nosema spp. in commercial apiaries in Spain do not support the replacement hypothesis either (Fernández et al. 2012; Martín-Hernández et al. 2012). Furthermore, a temporal study of Nosema spp. involving hundreds of colonies in Sweden concluded that N. apis was the dominant microsporidia infection in bees of that country and that no tendency for one species replacing the other was found (Forsgren and Fries 2013). N. ceranae has been linked to depopulation and collapse of colonies in parts of Europe (Higes et al. 2006, 2008, 2009; Martín-Hernández et al. 2007; Paxton 2010), although evidence from other regions does not support the hypothesis that this parasite is a major driver of colony losses (Cox-Foster et al. 2007; vanEngelsdorp et al. 2009; Fries 2010; Gisder et al. 2010; Guzman-Novoa et al. 2010; Stevanovic et al. 2011, 2013; Fernández et al. 2012; Meixner et al. 2014). At the individual level, N. ceranae was found to be highly pathogenic to bees kept in cages in incubators (Higes et al. 2007). Conversely, similar experiments did not find differences in pathogenicity between N. ceranae and N. apis, and N. ceranae did not appear to have a competitive advantage over N. apis in infected bees (Forsgren and Fries 2010). It is evident that data on N. ceranae virulence are controversial, possibly because this parasite affects honey bees differently in different environments, as a result of variation in susceptibility of bee genotype, or possibly, due to differences in virulence between strains of the parasite. Additionally, these differences could result from complex host-parasite-environment interactions or simply because of differences in experimental designs. Clearly, evidence on N. ceranae virulence, time since dispersal and whether it is replacing N. apis is conflicting and unclear. Thus, and given that differences in region, climate and bee genotype may be important in understanding the impact of N. ceranae, as well as to gain insight into the virulence and potential advantages of this parasite compared to N. apis,
data from studies on the prevalence and infection levels of Nosema species in different parts of the world is needed. Here, we report the prevalence and infection levels of N. ceranae and/or N. apis for 426 colonies surveyed in two Canadian provinces between 2008 and 2012.
Materials and methods Sampling procedures Samples of adult honey bees were obtained from randomly chosen hives located in the two Canadian provinces with the most colonies, Ontario and Alberta. These hives had not been treated against nosema disease for at least 6 months and were sampled during the springs of three different years. In Ontario, hives in the counties of Norfolk, Six Nations, Wellington, Grey, Niagara and Middlesex (located between 42° 51′ N, 80° 16′ W and 44° 20′ N, 80° 40′ W) were sampled in 2008 (n=433) and again in 2012 (n=402). In Alberta, hives in the counties of Peace, Fairview, Grande Prairie, Smoky River, Birch Hills, Athabasca, Smokey Lake, St. Paul, Leduc, Barrhead, Camrose, Red Deer, Stettler, Rocky View, Foothills, Cypress, Lethbridge, Vulcan, Starland, Mountain View, Wetaskiwin, Parkland, Bonnyville, Smoky Lake and Sprit River (located between 49° 41′ N, 112° 49′ W and 56° 14′ N, 118° 23′ W) were sampled in 2010 (n=127). In each hive, bees were collected from outer honey frames of the brood chamber, placed in jars containing 70 % ethanol and kept at −20 °C until analyzed. Microscopic analyses Samples were initially analyzed by phase contrast microscopy for presence or apparent absence of Nosema spp. spores. Briefly, each sample of 60 adult bee abdomens was macerated in 60 mL of ddH2O and the homogenate examined under a microscope (Olympus BX41; Olympus, Markham, Ontario) at 400× magnification. If positive, infection levels were determined by performing spore counts as per Shimanuki and Knox (2000). Spore counts correlate strongly with PCR quantifications (Bourgeois et al. 2010; Hamiduzzaman et al. 2010; Copley et al. 2012), another way of determining infection levels. In fact, we found a very high and significant linear relationship between the amount of Nosema quantified by PCR and the number of Nosema spores/bee from samples with different infection levels (R2 =0.95, n=23). Positive samples were also used for further molecular diagnosis as discussed below. All items that were used for macerating bee abdomens or extracting DNA were thoroughly washed and then autoclaved prior to these procedures to avoid contamination.
Author's personal copy Parasitol Res
PCR analyses Homogenates from positive samples were filtered and centrifuged at 9400 G for 15 min, and DNA extracted from the pellet of spores. DNA extractions and PCR procedures performed on the samples were as per Hamiduzzaman et al. (2010). Briefly, each sample in extraction buffer and proteinase K solution was incubated at 60 °C for 3 h and DNA was extracted with a two-step phenol-chloroform procedure. The sample was centrifuged and washed with 95 % ethanol and the pellet dried. The extracted DNA was stored at −20 °C until PCR amplification. Three sets of specific primers were used in a triplex PCR involving co-amplifying the N. apis and N. ceranae 16S rRNA gene with the ribosomal protein RpS5 gene from the honey bee as control in the same reaction. PCR reactions were done with a Mastercycler (Eppendorf, Mississauga, Ontario). Each reaction contained 1.5 μL 10× PCR buffer (New England BioLabs, Pickering, Ontario), 0.5 μL 10 mM dNTPs (Bio Basic Inc., Markham, Ontario), 1 μL 10 μM for each primer (Laboratory Services, University of Guelph), 0.2 μL 5U/μL Taq polymerase (New England BioLabs, Pickering, Ontario), 2 μL DNA sample (10 ng total in 2 μL) and 8.8 μL ddH2O. The thermocycler was programmed to run at 94 °C for 2.5 min, followed by 10 cycles of 15 s at 94 °C, 30 s at 61.8 °C and 45 s at 72 °C and 20 cycles of 15 s at 94 °C, 30 s at 61.8 °C and 50 s at 72 °C, and a final extension step at 72 °C for 7 min, holding reactions at 4 °C for the rest of the time. DNA obtained from newly emerged, Nosema-negative honey bees was used as negative control in the experiments. Primers for the Nosema 16S rRNA gene were MITOC-F (5′ CGGCGACGATGTGATATGAAAATATTAA) and MITOC-R (5′ CCCGGTCATTCTCAAACAAAAAACCG) to yield a 218-bp PCR product specific for N. ceranae and APIS-F (5′ GGGGGCATGTCTTTGACGTACTATGTA) and APIS-R (5′ G G G G GG C G T TTA A A ATG TG A A A C AACTATG) to yield a 321-bp PCR product specific for N. apis (Martin-Hernandez et al. 2007). Additionally, a honey bee housekeeping gene, the ribosomal protein S5 (RpS5) was used as a reference. Primer pairs RpS5-F (5′ AATTATTTGG TCGCTGGAATTG) and RpS5-R (5′ TAACGTCCAGCA GAATGTGGTA) with 115-bp length product were used in the reactions (Thompson et al. 2007). PCR products were separated by electrophoresis in 1.1 % agarose gels, stained with ethidium bromide and photographed under UV light. Chi-square tests were used to compare proportions of positive colonies infected by N. ceranae, N. apis or both Nosema species (mixed infections). Spore counts of the three infection types from each sampling year were square root transformed to normalize their distribution and then subjected to analyses of variance for each sampling year. When significant differences were detected, means were separated with Fisher’s protected least significant difference tests. All statistical
analyses were performed with the R Statistical Program (R Development Core Team, Auckland, New Zealand).
Results Nosema spp. prevalence Of the samples collected in 2008, 2010 and 2012, 39, 60 and 45 % were positive for Nosema spp. spores by microscopic examination. After PCR identification (Fig. 1), N. ceranae infections were found to be significantly more prevalent than N. apis and mixed infections in the colonies sampled in Ontario in 2008 and 2012. Similarly, in Alberta, a higher proportion of positive colonies had N. ceranae infections, although these cases were not significantly higher than those of N. apis. Mixed infections were less common than single Nosema spp. infections, and were significantly less frequent than N. ceranae infections in all cases (Table 1). Nosema spp. infection levels Due to the relatively low sample size of the hives surveyed in Alberta and to the low frequency of N. apis-infected colonies detected in 2012 in Ontario, only the data of the 2008 survey was analyzed by county. No significant effect of microsporidia species, locality or interaction between locality and parasite species was detected for levels of infection (P>0.05), thus data are presented by province and sampling year. N. ceranae infection levels were significantly higher than those of N. apis (3–5 times higher) in the tested colonies from the three different surveys in both provinces. Colonies where mixed infections were detected had significantly higher spore counts than colonies infected by a single microsporidium in the two Ontario surveys (2–12 times higher) but not in Alberta, where no differences in number of Nosema spores were found between N. ceranae-infected colonies and colonies with mixed infections, although mixed infections in
Fig. 1 Co-amplification of the 16S rRNA PCR product specific for either Nosema apis (321 bp) or Nosema ceranae (218 bp) and the PCR product specific for the honey bee house-keeping gene, RpS5 (115 bp). Lane 1 shows duplex PCR products from a sample of bees infected with N. apis (a) or N. ceranae (b) and the RpS5 gene amplified (a and b). Lane 2 (a and b) shows the RpS5 PCR product from DNA of healthy bees (Nosema-free), using the two pairs of primers. Lane 3 shows a reaction without bee DNA using the two pairs of primers. Lane M (far left) is a 100-bp DNA ladder
Author's personal copy Parasitol Res Table 1 Proportion of adult bee samples infected by Nosema ceranae or Nosema apis and by both Nosema species from 169 and 181 honey bee colonies in Ontario (ON) and from 76 colonies in Alberta (AL), Canada that tested positive to Nosema spp. infections in the springs of 2008, 2012 and 2010, respectively Nosema spp. infection
ON 2008 ON 2012 AL 2010
Nosema ceranae
0.51
0.91
0.41
Nosema apis N. apis + N. ceranae χ2 N. ceranae vs N. apis χ2 N. ceranae vs N. apis + N. ceranae χ2 N. apis vs N. apis + N. ceranae
0.34 0.15 12.5** 68.6*** 25.0***
0.04 0.05 283.0*** 277.7*** 0.1n.s.
0.34 0.25 0.9 n.s. 5.8* 2.2 n.s.
n.s. non-significant *P
