Histone deacetylase inhibitors sensitize glioblastoma cells to ... - Nature

Oncogene (2012) 31, 4677 - 4688 & 2012 Macmillan Publishers Limited All rights reserved 0950-9232/12 www.nature.com/onc

ORIGINAL ARTICLE

Histone deacetylase inhibitors sensitize glioblastoma cells to TRAIL-induced apoptosis by c-myc-mediated downregulation of cFLIP A Bangert1, S Cristofanon2, I Eckhardt2, BA Abhari2, S Kolodziej3, S Ha¨cker1, SHK Vellanki1, J Lausen3, K-M Debatin1 and S Fulda1,2 Glioblastoma is the most common primary brain tumor with a very poor prognosis, calling for novel treatment strategies. Here, we provide first evidence that histone deacetylase inhibitors (HDACI) prime glioblastoma cells for tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) -induced apoptosis at least in part by c-myc-mediated downregulation of cellular FLICE-inhibitory protein (cFLIP). Pretreatment with distinct HDACI (MS275, suberoylanilide hydroxamic acid, valproic acid) significantly enhances TRAIL-induced apoptosis in several glioblastoma cell lines. Monitoring a panel of apoptosisregulatory proteins revealed that MS275 reduces the expression of cFLIPL and cFLIPS. This leads to decreased recruitment of cFLIPL and cFLIPS and increased activation of caspase-8 to the TRAIL death-inducing signaling complex, resulting in enhanced cleavage of caspase-8, -9 and -3 and caspase-dependent apoptosis. Also, MS275 promotes TRAIL-triggered processing of Bid, activation of Bax, loss of mitochondrial membrane potential and release of cytochrome c. MS275-mediated downregulation of cFLIP occurs at the mRNA level independent of proteasome- or caspase-mediated degradation, and is preceded by upregulation of nuclear levels of c-myc, a transcriptional repressor of cFLIP. Notably, MS275 causes increased binding of c-myc to the cFLIP promoter and reduces cFLIP promoter activity. Indeed, knockdown of c-myc partially rescues cFLIPL from MS275-inferred downregulation and significantly decreases TRAIL- and MS275-induced apoptosis. Also, overexpression of cFLIPL or cFLIPS significantly reduces MS275- and TRAIL-induced apoptosis. Importantly, MS275 sensitizes primary cultured glioblastoma cells towards TRAIL and cooperates with TRAIL to reduce long-term clonogenic survival of glioblastoma cells and to suppress glioblastoma growth in vivo underscoring the clinical relevance of this approach. Thus, these findings demonstrate that HDACI represent a promising strategy to prime glioblastoma for TRAIL-induced apoptosis by targeting cFLIP. Oncogene (2012) 31, 4677 -- 4688; doi:10.1038/onc.2011.614; published online 23 January 2012 Keywords: apoptosis; TRAIL; glioblastoma; HDACI; cFLIP INTRODUCTION Glioblastoma is the most common malignant primary brain tumor.1 Despite multimodal treatment regimens including surgery, radiotherapy and chemotherapy the median survival of patients is less than 15 months after primary diagnosis,2 illustrating an urgent need for more effective treatments. Current treatment approaches aim to induce apoptosis in cancer cells, a form of programmed cell death responsible for tissue homeostasis.3 Extrinsic apoptosis signaling is initiated by binding of death receptor ligands such as tumor necrosis factorrelated apoptosis-inducing ligand (TRAIL) or CD95 ligand to their cognate death receptors at the cell membrane.4 Receptor trimerization leads to intracellular recruitment of adaptor proteins such as Fas-associated death domain (FADD) which in turn enables binding and activation of caspase-8 at the death-inducing signaling complex (DISC).5 Active caspase-8 can consecutively activate caspase-3 resulting in apoptosis.4 The intrinsic apoptosis pathway is initiated at the mitochondria that are permeabilized in response to intracellular death signals and release cytochrome c as well as other apoptogenic factors into the cytosol where caspase-9 and caspase-3 are activated.6 The extrinsic and the intrinsic pathways are linked by the BH3-only protein Bid, which

is truncated by active caspase-8 into tBid, and thereafter translocates to mitochondria to initiate mitochondrial outer membrane permeabilization.7 Apoptosis is controlled by various pro- and anti-apoptotic proteins, for example, members of the Bcl-2 family,8 inhibitor of apoptosis (IAP) proteins9 and other proteins like cellular FLICEinhibitory protein (cFLIP).10 Two major splice variants of cFLIP exist, that is, cFLIPL and cFLIPS, which both can block death-receptor signaling by interfering with caspase-8 activation at the DISC.10 Recombinant soluble TRAIL and agonistic TRAIL receptor antibodies are considered as promising cancer therapeutics as they have been shown to induce apoptosis in various cancer cells while leaving non-malignant cells unharmed.11 However, primary or acquired resistance limits their use as single agents in many cancers including glioblastoma,12 underscoring the importance of the development of combination treatments. Sensitivity to TRAIL can be restored in combination therapies, for example, together with histone deacetylase inhibitors (HDACI).13 HDACI can revert aberrant epigenetic states in cancer cells that result from aberrant expression or activity of HDACs and histone acetyl transferases.14 These enzymes determine the acetylation status of histones thereby affecting chromatin topology and gene

1 University Children’s Hospital, Ulm, Germany; 2Institute for Experimental Cancer Research in Pediatrics, Goethe-University, Frankfurt, Germany and 3Georg-Speyer-Haus, Institute for Biomedical Research, Frankfurt, Germany. Correspondence: Professor Dr S Fulda, Institute for Experimental Cancer Research in Pediatrics, Goethe-University Frankfurt, Komturstr. 3a, 60528 Frankfurt, Germany. E-mail: [email protected] Received 16 December 2010; revised and accepted 30 November 2011; published online 23 January 2012

HDACI prime glioblastoma towards TRAIL A Bangert et al

expression.15 In addition to histones, HDACs can target many nonhistone proteins and influence their activity, stability, localization or interaction with other proteins.16 For example, the transcription factors c-myc, E2F-1 and Foxo3a are modulated by their acetylation status.17 - 19 HDACI can induce differentiation, cell cycle arrest and apoptosis in various types of cancer.20 Searching for strategies to potentiate TRAIL-induced apoptosis in glioblastoma, we investigated in this study whether the HDACI MS275 (entinostat) is capable to enhance TRAIL-induced apoptosis in glioblastoma and investigated molecular mechanisms of cooperation. U87MG 12

0

U138MG

A172 0

24

12

RESULTS MS275 sensitizes glioblastoma cells for TRAIL-induced apoptosis To investigate whether HDAC inhibition is a feasible strategy to enhance TRAIL sensitivity in glioblastoma, we analyzed the effect of the HDACI MS275 on histone acetylation and TRAIL-induced apoptosis in a panel of glioblastoma cell lines. Treatment with MS275 resulted in marked acetylation of histone H3, which was taken as indicator for HDAC inhibition (Figure 1a). Importantly, pretreatment for 24 h with subtoxic doses of MS275 strongly increased TRAIL-induced apoptosis in different cell lines in a doseand time-dependent manner when compared with treatment

24

0

12

LN18

T98G

24

0

12 24

0

12

24

Ac-H3

17 kD

α-tubulin

50 kD

U87MG

100 90 80 70 60 50 40 30 20 10 0

0 μM MS275 8 μM MS275 #

# # # #

0

0.25

0.5

1

2.5

specific apoptosis [%]


time [h]

100 90 80 70 60 50 40 30 20 10 0

5

U138MG 0 μM MS275 8 μM MS275

#

0

0.5

1


#

# * 0.5

5

10

T98G #

#

0.25

2.5

TRAIL [ng/ml]

#

0 μM MS275 5 μM MS275

0

#

#

A172 100 90 80 70 60 50 40 30 20 10 0

#

#

TRAIL [ng/ml]


1

2.5

100 90 80 70 60 50 40 30 20 10 0

5

0 µM MS275 5 µM MS275

#

#

#

# #

# 0

0.5

TRAIL [ng/ml]

1

2.5

5

10

TRAIL [ng/ml]


4678

100 90 80 70 60 50 40 30 20 10 0

LN18 0 μM MS275 5 μM MS275

# # # #

# # 0

0.025

0.05

0.1

0.25

0.5

TRAIL [ng/ml]

Figure 1. MS275 sensitizes glioblastoma cells for TRAIL-induced apoptosis. (a) Glioblastoma cells were treated for the indicated times with 8 mM (U87MG, U138MG) or 5 mM (A172, T98G, LN18) MS275. Protein expression of acetylated histone H3 and a-tubulin was assessed by western blotting. (b) Cells were treated for 24 h with (black bars) or without (white bars) MS275, followed by addition of indicated concentrations of TRAIL for 24 h. Apoptosis was determined by FACS analysis of DNA fragmentation of propidium iodide-stained nuclei. Background apoptosis: U87MG: 14.4%, A172: 27.7%, U138MG 27.1%, T98G 8.8%, LN18: 6.4%. Mean±s.e.m. of at least three independent experiments carried out at least in duplicate are shown; *Po0.05, #Po0.001. (c) Cells were pre-treated for 24 h with 8 mM (U87MG) or 5 mM (A172) MS275, followed by treatment with 2.5 ng/ml (U87MG) or 0.5 ng/ml (A172) TRAIL for 24 h (‘pre-1’). Alternatively, cells were pre-treated for 24 h with 8 mM (U87MG) or 5 mM (A172) MS275 for 24 h, MS275 was removed and cells were stimulated with 2.5 ng/ml (U87MG) or 0.5 ng/ml (A172) for 24 h (‘pre-2’). For ‘co’-treatment, cells were simultaneously treated with 8 mM (U87MG) or 5 mM (A172) MS275 and 2.5 ng/ml (U87MG) or 0.5 ng/ml (A172) TRAIL for 24 h. ‘Post’-treated cells were treated first with TRAIL (U87MG: 2.5 ng/ml, A172: 0.5 ng/ml) for 24 h, followed by treatment with 8 mM (U87MG) or 5 mM (A172) MS275 for 24 h. Apoptosis was determined by FACS analysis of DNA fragmentation of propidium iodide-stained nuclei. Background apoptosis: U87MG: 12.3%, A172: 14.8%. Mean±s.e.m. of at least three independent experiments carried out in triplicate are shown; #Po0.001, NS., not significant. (d) Colony formation of glioblastoma cells was assessed after treatment for 24 h with or without 8 mM (U87MG) or 5 mM (A172) MS275 followed by addition of TRAIL (U87MG: 2.5 ng/ml for 10 h; A172: 0.5 ng/ml for 6 h) as described in Materials and methods. Oncogene (2012) 4677 -- 4688

& 2012 Macmillan Publishers Limited



4679 100 90 80 70 60 50 40 30 20 10 0

# # NS M

pre-1

T

M

pre-2 0


treatment schedule

U87MG

M

T

pre-1 pre-2

co

T

post

A172

100 90 80 70 60 50 40 30 20 10 0

#

M

co

#

T

#

T

post

M

0

M

T

pre-1 pre-2

co

post

0

U87MG control

TRAIL

Figure 1.

24

48

72

time [h]

A172 MS275

MS275+TRAIL

control

TRAIL

MS275

MS275+TRAIL

Continued.

with TRAIL alone (Figure 1b, Supplementary Figure 1a). Apoptotic cell death was confirmed by analyzing phosphatidylserine exposure on the outer plasma membrane using Annexin-V staining (Supplementary Figure 1b). Analysis of different application schedules revealed that preincubation with MS275 for 24 h followed by 24 h treatment with TRAIL (‘pre-1’ and ‘pre-2’) is superior to concomitant treatment with both substances (‘co’) and particularly to applying MS275 after TRAIL (‘post’) (Figure 1c). As more apoptosis was induced in A172 cells when MS275 was further supplied during TRAIL administration (‘pre-1’) than when MS275 was removed after the preincubation period (‘pre-2’), we subsequently used this schedule throughout the study. Colony formation assays showed that MS275 and TRAIL cooperated to reduce clonogenic growth (Figure 1d, Supplementary Figure 1c), demonstrating an effect also on long-term survival of glioblastoma cells. This set of experiments demonstrates that MS275 cooperates with TRAIL to induce apoptosis and to suppress clonogenic growth of glioblastoma cells. MS275 enhances TRAIL-induced caspase activation and mitochondrial outer membrane permeabilization To elucidate the molecular mechanism of HDACI-mediated sensitization to TRAIL, we tested whether this process is caspase-dependent by using the pan-caspase inhibitor zVAD.fmk. MS275- and TRAIL-induced apoptosis was almost completely & 2012 Macmillan Publishers Limited

abolished in the presence of zVAD.fmk, demonstrating that cell death relies on caspases (Figure 2a). This was supported by immunoblots showing that MS275 promoted TRAIL-induced cleavage of caspase-8, -3 and -9 into active fragments (Figure 2b). Interestingly, while treatment with TRAIL predominately generated the p20 inactive intermediate cleavage fragment of caspase-3, the addition of MS275 promoted the second step of caspase-3 activation and the generation of the active p17/p12 fragments (Figure 2b). Furthermore, combination treatment promoted accumulation of cleaved Bid (tBid) (Figure 2b) pointing to a possible link of the extrinsic to the intrinsic apoptosis pathway. As tBid translocates to mitochondrial membranes to initiate mitochondrial outer membrane permeabilization, we next analyzed tBid in the mitochondrial fraction. Interestingly, we found tBid in mitochondrial membranes predominately in cells that were cotreated with MS275 and TRAIL (Figure 2c). Similarly, we detected activated Bax in samples exposed to both MS275 and TRAIL but not to either agent alone (Figure 2d, upper panel). Also, MS275 profoundly enhanced loss of mitochondrial membrane potential and cytochrome c release upon exposure to TRAIL (Figure 2d, lower panel and 2c). Together, these experiments demonstrate that MS275 and TRAIL cooperate to trigger caspase activation, cleavage of Bid into tBid, translocation of tBid to mitochondrial outer membranes and mitochondrial outer membrane permeabilization. Oncogene (2012) 4677 - 4688


Downregulation of cFLIP by MS275 regulates sensitivity to TRAIL A survey of pro- and anti-apoptotic proteins revealed that both cFLIPL and cFLIPS were profoundly downregulated after treatment with MS275 (Figure 3a, Supplementary Figure 2a). Additionally, MS275 caused upregulation of Noxa (Figure 3a, Supplementary Figure 2a), whereas no alterations in surface expression of TRAIL receptors were found (Supplementary Figure 2b), and changes in expression of BimEL and cIAP-1 were not consistent in both cell lines (Figure 3a). MS275-mediated downregulation of survivin occurred at a later time point after the start of the MS275conferred sensitization to TRAIL in particular in A172 cells (Figure 3a), indicating that survivin is unlikely the key mediator of this sensitization. Importantly, decreased levels of cFLIPL and cFLIPS were also found at the TRAIL DISC of MS275-pretreated cells coinciding with a slight increase in caspase-8 cleavage fragments in the TRAIL DISC (Figure 3b). To test the hypothesis that downregulation of cFLIP by MS275 paves the way for unimpeded apoptosis signaling via TRAIL receptors, we overexpressed either isoform of cFLIP. Indeed, ectopic expression of cFLIPL or cFLIPS significantly decreased apoptosis induced by MS275 plus TRAIL (Figure 3c). The observed increased expression of endogenous

cFLIPL upon overexpression of cFLIPS might be caused by cFLIPstimulated activation of NF-kB,21 which in turn can induce cFLIPL expression.22 To further test the functional relevance of MS275mediated downregulation of cFLIP, we silenced cFLIP expression by RNA interference. Importantly, knockdown of cFLIP significantly increased TRAIL- or TRAIL and MS275-induced apoptosis (Supplementary Figure 3). This set of experiments indicates that modulation of cFLIP has an important role in the MS275-mediated sensitization to TRAIL-induced apoptosis. By comparison, knockdown of Noxa did not alter MS275- and TRAIL-induced apoptosis (Supplementary Figure 4), indicating that the MS275-mediated upregulation of Noxa is dispensable for the cooperative induction of apoptosis. c-myc is involved in cFLIP downregulation and MS275-mediated sensitization to TRAIL Kinetic analysis showed a time-dependent decrease of mRNA as well as protein levels of cFLIPL and cFLIPS by MS275 (Figure 4a). The observed downregulation of cFLIP over time in the absence of MS275 may involve JNK-mediated proteasomal degradation of cFLIP, as previously reported upon cell cycle arrest.23 To test

A172

60

no zVAD.fmk plus zVAD.fmk

50

#

40 30 20 10

*

*

0 MS275

control

TRAIL


U87MG specific apoptosis [%]

4680

100 90 80 70 60 50 40 30 20 10 0

M+T

no zVAD.fmk plus zVAD.fmk

* control MS275

time [h] MS275 TRAIL casp-8

1

2

TRAIL

M+T

A172

U87MG 0.5

#

3

6

- + - + + - + + - + + - + + - + - - + + - + + - + + - + + - + +

0.5

1

2

3

6

- + - + + - + + - + + - + + - + - - + + - + + - + + - + + - + + 55/53 kD 18 kD

casp-3

32 kD 20 kD 17 kD 12 kD

casp-9

45 kD 37 kD * 35 kD

Bid

22 kD

t-Bid

15 kD

GAPDH (36 kD)

α-tubulin (50 kD)

Figure 2. MS275 sensitizes for TRAIL-induced caspase activation and mitochondrial perturbations. Cells were pre-treated for 24 h with 8 mM (U87MG) or 5 mM MS275. (a) Pre-treatment was followed by addition of 2.5 ng/ml (U87MG) or 0.5 ng/ml (A172) TRAIL for 48 h (U87MG) or 24 h (A172) and MS275 in the presence (white bars) or absence (black bars) of 50 mM zVAD.fmk. Apoptosis was determined by FACS analysis of DNA fragmentation of propidium iodide-stained nuclei. Background apoptosis: U87MG: 9.5%, A172: 12.7%. Mean±s.e.m. of at least three independent experiments carried out in triplicate are shown; *Po0.05, #Po0.001. (b) Pre-treatment was followed by addition of 2.5 ng/ml (U87MG) or 0.5 ng/ml (A172) TRAIL for indicated times. Expression of caspase-8, -3, -9, Bid, GAPDH and a-tubulin was analyzed by western blotting. Arrows indicate cleavage fragments and asterisk indicates unspecific bands. (c) Pre-treatment was followed by addition of 2.5 ng/ml (U87MG) or 0.5 ng/ml (A172) TRAIL for 6 h (U87MG) or 3 h (A172). Cytochrome c and tBid were assessed by western blotting. Cytochrome c oxidase subunit IV (COX IV) and a-tubulin were used to control the purity of mitochondrial and cytosolic fractions, b-actin served as loading control. tBid is indicated by arrow. (d, upper panel) Pre-treatment was followed by addition of TRAIL (U87MG: 2.5 ng/ml for 3 h; A172 1 ng/ml for 2 h). Bax activation was assessed by immunoprecipitation using an active conformation-specific anti-Bax antibody and expression of Bax, b-actin and GAPDH was analyzed by western blotting. (d, lower panel) Pre-treatment was followed by addition of 2.5 ng/ml (U87MG) or 0.5 ng/ ml (A172) TRAIL. Mitochondrial transmembrane potential was analyzed by flow cytometry using the fluorescent dye CMXRos. Mean±s.e.m. of at least three independent experiments carried out in duplicate are shown. Oncogene (2012) 4677 -- 4688



4681 U87MG cytoplasm MS275 TRAIL -

+

+ -

A172 mitochondria

+ +

-

+ -

+

cytoplasm

+ +

-

+ -

+

mitochondria + +

-

+ -

+

+ + 22 kD

Bid

15 kD

cyt c

15 kD

COX IV

17 kD

α-tubulin

50 kD

β-actin

42 kD

A172

U87MG IP: activated Bax MS275 TRAIL

-

+

+ -

+ +

IP: activated Bax

lysate -

+ -

+

+ +

-

+ -

+

+ +

lysate -

+

+ -

+ +

Bax

21 kD

β-actin (42 kD)

GAPDH (36 kD)

loss of MMP [%]

U87MG 80 70 60 50 40 30 20 10 0

control MS275 TRAIL M+T

A172 #

*

#

*

1

2

3

6

80 70 60 50 40 30 20 10 0

12

#

*

# #

*

1

2

3

6

12

time [h]

Figure 2.

Continued.

whether MS275-triggered downregulation of cFLIP involves proteasomal degradation or cleavage by caspases, we used the proteasome inhibitor bortezomib and the pan-caspase inhibitor zVAD.fmk. Figure 4b shows that cFLIP protein is neither degraded in a proteasome- nor in a caspase-dependent manner, supporting the notion that cFLIP is regulated by MS275 at the mRNA level. Therefore, we hypothesized that MS275 upregulates a transcriptional repressor or downregulates a transcriptional activator of cFLIP and analyzed protein expression of several transcription factors known to regulate cFLIP expression.24 - 26 While treatment with MS275 resulted in upregulation of Foxo3a in cytosolic extracts (Supplementary Figure 5a), Foxo3a remained exclusively localized to the cytoplasm (Supplementary Figure 5c) and knockdown of Foxo3a did not protect U87MG cells from MS275induced downregulation of cFLIP (Supplementary Figure 5d). By comparison, c-myc was rapidly upregulated in nuclear extracts upon treatment with MS275 before the downregulation of cFLIP (Figure 4c, Supplementary Figures 5e and f). The transient upregulation of c-myc protein in A172 cells may reflect its tight control by various post-translational modifications.18 Importantly, knockdown of c-myc partially rescued cells from MS275-mediated downregulation of cFLIP and significantly reduced MS275- and TRAIL-induced apoptosis (Figure 4d). To investigate whether MS275 induces c-myc binding to the cFLIP promoter, we performed chromatin immunoprecipitation & 2012 Macmillan Publishers Limited

analysis. Importantly, treatment with MS275 stimulated increased binding of c-myc to the cFLIP promoter (Figure 4e). Also, MS275 caused an enrichment of c-myc at the Jun promoter, a known c-myc target gene that was used as a positive control (Figure 4e). By comparison, the binding of RNA polymerase II to the cFLIP promoter was decreased upon treatment with MS275 (Figure 4e), in line with decreased transcriptional activity of the cFLIP promoter upon treatment with MS275. To further determine the effect of MS275 on the transcriptional activity of the cFLIP promoter, we performed luciferase reporter assays. Of note, treatment with MS275 caused a significant decrease in cFLIP transcriptional activity, whereas stimulation with TNFa, which as used as a positive control, significantly increased the transcriptional activity of the cFLIP promoter (Figure 4f). Together, this set of experiments demonstrates that c-myc represses cFLIP expression at the transcriptional level upon MS275 stimulation and contributes to MS275-mediated sensitization towards TRAIL. Various HDACI sensitize glioblastoma cells for death receptorinduced apoptosis To assess the generality of our findings, we extended our studies to additional HDACI. Both valproic acid and suberoylanilide hydroxamic acid caused histone hyperacetylation (Figure 5a), decreased cFLIPL and cFLIPS protein levels (Figure 5b) and significantly increased Oncogene (2012) 4677 - 4688


from surgical specimens of astrocytoma grade III (GB2) and grade IV (GB1). Similarly, MS275-triggered hyperacetylation of histone H3, downregulated cFLIPL and cFLIPS expression and significantly increased TRAIL-induced apoptosis in primary cultured glioma cells (Figures 6a and b). Finally, we evaluated the antitumor activity of MS275 and TRAIL in an in vivo model using the chicken chorioallantoic membrane (CAM) assay, an established preclinical tumor model.27 U87MG cells were seeded on the CAM of chicken embryos, allowed to form tumors and were then topically treated

TRAIL-induced apoptosis (Figure 5c). Additionally, MS275 significantly enhanced apoptosis induced by an agonistic anti-CD95 antibody (Supplementary Figure 6). Thus, HDACI prime glioblastoma cells for death receptor-induced apoptosis. MS275 sensitizes primary glioblastoma cells for TRAIL-induced apoptosis and cooperates with TRAIL to suppress tumor growth in vivo To validate our data obtained in established cell lines, we extended our study to primary cultured glioma cells isolated

a

b

time [h]

U87MG 0 24 48

cFLIPL

cFLIPS Bak

A172 0 24 48

MS275 TRAIL

55 kD

26 kD

11 kD

BimEL

23 kD

cIAP-1

69 kD

cIAP-2

68 kD

XIAP

57 kD

survivin

16 kD

β-actin

42 kD

IP

- + - + - - + +

- + - + - - + +

lysate MS275 TRAIL

-

IP

+ - + - + +

- + - + - - + +

cFLIPL

55 kD

cFLIPL

55 kD

cFLIPS

26 kD

cFLIPS

26 kD

casp-8

55/53 kD

55/53 kD

casp-8

24 kD

Noxa

A172

U87MG lysate

43/41 kD

43/41 kD

18 kD

18 kD

FADD

28 kD

28 kD

FADD

49/43kD

TRAIL-R2 49/43kD

TRAIL-R2

c

EVL EVS

L

S

cFLIPL

55 kD

cFLIPS

26 kD

β-actin

42 kD


4682

70 60 50 40 30 20 10 0

# EVL EVS cFLIPL cFLIPS

#

* *

control

MS275

TRAIL

M+T

Figure 3. Downregulation of cFLIP by MS275 regulates sensitivity to TRAIL. (a) U87MG and A172 cells were treated with 8 mM (U87MG) or 5 mM (A172) MS275 for indicated times. Protein expression of cFLIP, Bak, Noxa, Bim, cIAP-1, cIAP-2, XIAP, survivin and b-actin was analyzed by western blotting. (b) Cells were treated with 8 mM (U87MG) or 5 mM (A172) MS275 for 24 h, followed by addition of 1 mg/ml Flag-tagged TRAIL for 1 h (U87MG) or 30 min (A172). DISC analysis was performed as described in Materials and methods by immunoprecipitation and western blotting. Arrows indicate cleavage products. (c) U87MG cells were transfected with cFLIPS, cFLIPL or corresponding empty vector (EV; empty vector cFLIPL: EVL, empty vector cFLIPS: EVS). Expression of cFLIPL and cFLIPS was determined by western blotting (left panel). Cells were treated for 24 h with 8 mM MS275, followed by addition of 2.5 ng/ml TRAIL for 24 h. Apoptosis was determined by FACS analysis of DNA fragmentation of propidium iodide-stained nuclei. Background apoptosis: EVL: 11.9%, EVS: 20.4%, cFLIPL: 11%, cFLIPS: 17.5%. Mean±s.e.m. of three independent experiments carried out in triplicate are shown; *Po0.05, #Po0.001.

Figure 4. c-myc is involved in cFLIP suppression and MS275-mediated sensitization to TRAIL. (a) U87MG and A172 cells were treated with 8 mM (U87MG) or 5 mM (A172) MS275 for indicated times. mRNA expression of cFLIPL and cFLIPS was determined by quantitative real-time PCR, normalized to GAPDH expression and is shown as x-fold mRNA expression compared with the control (upper panel). Mean±s.d. of three independent experiments are shown; *Po0.05, #Po0.001. cFLIPL and cFLIPS protein expression was analyzed by western blotting (lower panel). (b) Cells were treated for 24 h with 8 mM (U87MG) or 5 mM (A172) MS275 and/or 30 nM (U87MG) or 6 nM (A172) bortezomib and/or 50 mM zVAD.fmk (added 1 h before other substances). Expression of cFLIPL and cFLIPS was determined by western blotting. (c) Cells were treated with 8 mM (U87MG) or 5 mM (A172) MS275 for indicated times. Cytoplasmic and nuclear fractions of glioblastoma cells were probed for c-myc by western blotting. The purity of the fractions was assessed by lamin and a-tubulin/GAPDH. b-actin served as loading control. (d) A172 cells were transiently transfected with siRNA against c-myc or non-targeting control siRNA. In the left panel, cells were subsequently treated for 24 h with 5 mM MS275 and expression of cFLIPL, c-myc, GAPDH and b-actin was assessed by western blotting. cFLIPL levels were quantified densitometrically and are normalized to b-actin. Note that knockdown of c-myc partially restores the MS275-triggered downregulation of cFLIP protein. In the right panel, transfected cells were treated with 5 mM MS275 for 24 h, followed by addition of 0.5 ng/ml TRAIL for 24 h. Apoptosis was determined by FACS analysis of DNA fragmentation of propidium iodide-stained nuclei. Background apoptosis: si control: 6.3%, c-myc siRNA: 7.6%. Mean±s.e.m. of three independent experiments carried out in triplicate are shown; #Po0.001. (e) A172 cells were left untreated (UT) or were treated with 5 mM MS275 for 5 h. Binding of c-myc or RNA polymerase II to the cFLIP promoter was analyzed by ChIP assay. For binding of c-myc to c-Jun promoter and the GAPDH exon, six genomic loci were used as positive and negative controls, respectively. (f ) A172 cells were transiently transfected with constructs containing firefly and renilla genes. After stimulation with either 5 mM MS275 or 10 ng/ml TNFa for 8 h, cFLIP transcriptional activity was determined by dual luciferase assay. Firefly luciferase values were normalized to renilla luciferase values. Data are shown as fold increase of luciferase activity relative to unstimulated control out of three independent experiments performed in triplicate; *Po0.05, #Po0.001.

Oncogene (2012) 4677 -- 4688



Together, this set of experiments demonstrates the effectiveness of the combined treatment with MS275 and TRAIL also in primary cultured glioblastoma cells as well as in an in vivo model of glioblastoma.

U87MG cFLIPL

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

mRNA x-fold decrease


with TRAIL in the presence or absence of MS275. Remarkably, MS275 acted in concert with TRAIL to suppress tumor growth in vivo compared with treatment with either agent alone (Figure 6c).

* *

0

3

#

#

6 12 MS275 [h]

24

A172 cFLIPL

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

*

*

0

3



U87MG cFLIPS 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

*

*

*

0

3

6 12 MS275 [h]

6

MS275

-

12 +

-

24

A172 cFLIPS

* *

24

0

3

6 12 MS275 [h]

24

A172

24 +

6 12 MS275 [h]

*

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

U87MG time [h]

*

-

48 +

-

6 +

12

-

+

-

24 +

-

48 +

-

+

cFLIPL

55 kD

cFLIPS

26 kD

β-actin

42 kD U87MG -

MS275 bortezomib zVAD.fmk

+ -

+ -

A172

+

+ + -

+ +

-

+ + +

+ -

+ -

+

+ + -

+ +

+ + + 55 kD

cFLIPL

cFLIPS

26 kD

α-tubulin (50 kD)

GAPDH (36 kD) U87MG

A172

cytoplasm time [h]

0

3

6

nucleus

9 12 24 0

3

6

9 12 24

cytoplasm 0

3

6

nucleus

9 12 24 0

3

6

9 12 24 64 kD

c-myc

70/ 65kD

lamin A/C

GAPDH (36 kD)

β-actin

42 kD

MS275 si control si c-myc

-

+ -

+

+ -

+ + -

+ + 55 kD

cFLIPL 100 84

9

9

34

c-FLIPL/β-actin [%]

c-myc

64 kD

β-actin

42 kD



α-tubulin (50 kD)

100 90 80 70 60 50 40 30 20 10 0

#

si control c-myc siRNA

control

MS275

TRAIL

M+T

Oncogene (2012) 4677 - 4688

4683


4684 cFLIP Promoter

3

40 IgG anti-Myc

fold enrichment

fold enrichment

4

2 1

cFLIP Promoter IgG anti-Pol

30 20 10

0

0 UT

MS275

UT

cJun Promoter

15

GAPDH Exon 6 4

IgG anti-Myc

fold enrichment

fold enrichment

20

MS275

10 5 0

3

IgG anti-Myc

2 1 0

UT

MS275

UT

MS275

#

*

0.8 0.6 0.4 0.2

0 MS275

Figure 4.

Luciferase activity

Luciferase activity

1

- +

1.2 0.8 0.4 0 TNFα

-

+

Continued.

DISCUSSION In this study, we show for the first time that HDAC inhibitors such as MS275 enhance TRAIL-induced apoptosis in glioblastoma, including primary cultured glioblastoma cells and in an in vivo model of glioblastoma, at least in part by c-myc-mediated downregulation of cFLIP. Several independent lines of evidence support the notion that reduction of cFLIP is a critical event in the MS275-conferred sensitization to TRAIL. First, overexpression of cFLIPL or cFLIPS significantly decreases apoptosis that is induced by cotreatment with MS275 and TRAIL. Second, preventing the MS275-mediated upregulation of c-myc also abolishes the MS275-induced downregulation of cFLIP and sensitization to TRAIL-triggered apoptosis. Third, MS275 causes increased binding of c-myc to the cFLIP promoter and reduces cFLIP promoter activity. Fourth, both cFLIP isoforms are not only downregulated in their overall expression levels by MS275 but are also reduced at the functionally relevant subcellular location, that is, the TRAIL DISC. This leads to increased caspase-8 processing as well as enhanced activation of downstream apoptotic events such as cleavage of caspase-3, -9 and Bid, Bax activation, loss of mitochondrial membrane potential, cytochrome c release and DNA fragmentation. Fifth, cFLIP reduction upon HDAC inhibition is a common event in several glioblastoma cell lines and also in primary cultured glioblastoma cells, and occurs after treatment with different HDACI, underlining the general relevance of these findings. Sixth, HDAC inhibition enhances CD95-induced apoptosis, showing that this observation can be extended to other death receptor systems. Although suppression of cFLIP after HDACI treatment has previously been observed, for example, in colon cancer, chronic lymphocytic leukemia, osteosarcoma and hepatoma,28 - 31 we report here for the first time that this involves HDACI-triggered upregulation of c-myc. This conclusion is based on findings that Oncogene (2012) 4677 -- 4688

MS275 causes reduced cFLIP mRNA levels consistent with its regulation at the transcriptional level, whereas proteasomal breakdown or caspase-mediated cleavage of cFLIP are not primarily involved. Analysis of several transcriptional activators and repressors of cFLIP identifies c-myc as the candidate that is rapidly upregulated in the nucleus upon treatment with MS275. Importantly, MS275-mediated upregulation of c-myc contributes to cFLIP downregulation and sensitization to TRAIL-induced cell death by MS275, as knockdown of c-myc by RNAi partially rescues cells from MS275-triggered cFLIP downregulation and apoptosis sensitization. c-myc is a transcription factor that can on one side drive cellular proliferation and on the other side also induce apoptosis by altering the expression of pro- and anti-apoptotic proteins.32 - 35 As c-myc has previously been reported to repress cFLIP transcription,24 our study is the first to show that upregulation of c-myc by MS275 contributes to MS275-mediated sensitization to TRAIL. By comparison, the expression of other cmyc target genes analyzed, such as TRAIL-R1,24 TRAIL-R2,33 Bak34 and Bim,35 was not consistently altered after MS275 treatment, suggesting that distinct transcriptional programs can be initiated in a context-dependent manner. Given that glioblastoma is the most aggressive primary brain tumor that is still incurable, our findings have important clinical implications. Previously, HDACI-mediated sensitization to TRAIL has been described in various solid and hematological cancer cell lines,36 - 40 including one report in glioblastoma.41 In the present study, we show for the first time that MS275 enhances TRAILinduced apoptosis in primary cultured glioblastoma cells in addition to several established cell lines. Our data proposing MS275 as a suitable combination partner for TRAIL are supported by a recent publication showing that MS275 as single agent inhibits the growth of glioma-derived neurospheres.42 Furthermore, undermining the therapeutic potential of MS275 and TRAIL, we show that long-term survival of glioblastoma cells is markedly decreased by the combination treatment as is tumor growth in vivo. A previous report demonstrated that MS275 is cytotoxic to glioma cells but not to surrounding brain tissue using organotypic slice cultures of rat brain.43 The use of MS275 in glioma therapy is further encouraged by the ability of MS275 to cross the blood -brain barrier.43,44 MS275 is already in phase I and II clinical trials for the treatment of several solid and hematological malignancies14 and TRAIL as well as agonistic TRAIL receptor antibodies are currently being investigated clinically, indicating the feasibility to translate this combination strategy of MS275 and TRAIL into a clinical application. Thus, our findings have important implications for the development of novel treatment strategies in glioblastoma.

MATERIALS AND METHODS Cell culture and reagents Glioblastoma cell lines were obtained from the American Type Culture Collection (Manassas, VA, USA) and maintained in Dulbecco’s modified Eagle’s medium (Life Technologies, Eggenstein, Germany), supplemented with 10% fetal calf serum (Biochrom, Berlin, Germany), 1 mM L-glutamine (Invitrogen, Karlsruhe, Germany), 1% penicillin/streptomycin (Invitrogen) and 25 mM HEPES (Biochrom) as described previously.45 To generate stable cell lines, cells were seeded in six-well tissue culture plates and transfected with cFLIPL in pBABE, cFLIPS in pCFG5-IEGZ and corresponding empty vectors using FuGENE 6 (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s recommendations and selected using 1 mg/ml puromycin or 667 mg/ml Zeocin (InvivoGen, San Diego, CA, USA). MS275 was kindly provided by Bayer Schering (Berlin, Germany), suberoylanilide hydroxamic acid (SAHA) was purchased from Alexis Biochemicals (San Diego, CA, USA), non-tagged TRAIL from R&D Systems (Wiesbaden, Germany), bortezomib from Janssen-Cilag (Neuss, Germany), N-benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (zVAD.fmk) from Bachem (Heidelberg, Germany), agonistic mouse anti-CD95 antibody was & 2012 Macmillan Publishers Limited


4685 U87MG VA

SAHA

U87MG time [h]

0

12

A172 24

0

12

U87MG 24

0

VA SAHA

A172

12 24 0

12 24 17 kD

α-tubulin

50 kD

U87MG

100 90 80 70 60 50 40 30 20 10 0

0 mM VA 10 mM VA #

#

*

# #

0

0.25

0.5 1 2.5 TRAIL [ng/ml]

0 mM VA 8 mM VA

#

#

#

# * *

0

0.25

0.5 1 2.5 TRAIL [ng/ml]

5



A172 100 90 80 70 60 50 40 30 20 10 0

-

+ -

-

+

A172 -

+ 55 kD

cFLIPS

26 kD

β-actin

42 kD

U87MG 0 µM SAHA 4 µM SAHA

# # # #

# * 0

5

+ -

U87MG

cFLIPL

100 90 80 70 60 50 40 30 20 10 0



Ac-H3

-

A172

0.25

0.5 1 2.5 TRAIL [ng/ml]

5

A172

100 90 80 70 60 50 40 30 20 10 0

0 µM SAHA 3 µM SAHA #

#

#

#

#

#

0

0.25

0.5

1

2.5

5

TRAIL [ng/ml]

Figure 5. Several HDACI sensitize glioblastoma cells for TRAIL-induced apoptosis. Cells were treated for the indicated times with 10 mM (U87MG) or 8 mM (A172) valproic acid (VA) or 4 mM (U87MG) or 3 mM (A172) suberoylanilide hydroxamic acid (SAHA). (a) Expression of acetylated histone H3 and a-tubulin was determined by western blotting. (b) Expression of cFLIP and b-actin was assessed by western blotting. (c) Cells were pre-treated for 24 h with (black bars) or without (white bars) VA (left panels) or SAHA (right panels), followed by addition of indicated concentrations of TRAIL for 24 h. Apoptosis was determined by FACS analysis of DNA fragmentation of propidium iodide-stained nuclei. Background apoptosis: U87 VA: 10.7%, U87 SAHA: 13.1%, A172 VA: 15.28%, A172 SAHA: 15.32%. Mean±s.e.m. of at least three independent experiments carried out in triplicate are shown; *Po0.05, #Po0.001.

previously described.46 Other chemicals were purchased from Sigma (Deisenhofen, Germany) unless otherwise stated.

RNA interference For transient knockdown of c-myc, cells were transfected with 150 pmol Stealth RNAi siRNA directed against c-myc (HSS181389) or non-targeting control siRNA (Invitrogen) using TransMessenger transfection reagent (Qiagen, Hilden, Germany) or with 120 pmol Stealth RNAi siRNA directed against Foxo3a (HSS103720, HSS103721 and HSS103722; 60 pmol each; Invitrogen).

Determination of apoptosis, cell density and clonogenic survival Apoptosis was determined by fluorescence-activated cell sorting analysis (FACScan, BD Biosciences, Heidelberg, Germany) of DNA fragmentation of propidium iodide-stained nuclei as described previously.47 Specific apoptosis [%] was calculated as follows: 100 [percentage of apoptotic cells in a samplemean percentage of spontaneous apoptosis in controls]/ [100mean percentage of spontaneous apoptosis in controls]. To assess cell density, cells were stained with crystal violet solution (0.75% crystal violet, 50% ethanol, 0.25% NaCl and 1.57% formaldehyde), washed with water, solubilized with 1% SDS solution and absorbance was measured at & 2012 Macmillan Publishers Limited

550 nm. For clonogenic assay, cells were pre-treated with MS275 for 24 h, trypsinized and incubated at 37 1C suspended in TRAIL solution. Treatment was stopped by addition of 14 the volume of complete medium and cells were seeded in 10 cm-dishes (10 000 cells per dish). The medium was exchanged 2 days (U87MG, A172) and 10 days (A172) after seeding. At 15 days (U87MG) or 28 days (A172) after seeding, colonies were fixed in 3.7% paraformaldehyde solution and stained with crystal violet solution (see above).

Western blot analysis and preparation of nuclear extracts Western blot analysis was performed as described previously.47 The following antibodies were used: caspase-8, cFLIP, Noxa (all from Alexis Biochemicals), Bak, caspase-9, cytochrome c (all from BD Pharmingen, San Diego, CA, USA), FADD, XIAP (both from BD Transduction Laboratories, Heidelberg, Germany), Bid, Bim, caspase-3, c-myc, Foxo3a (all from Cell Signaling, Beverly, MA), TRAIL receptor 2 (Chemicon, Billerica, MA, USA), cIAP-2 (Epitomics, Burlingname, CA, USA), OxPhos Complex IV (Invitrogen), cIAP-1, survivin (both from R&D Systems), c-myc (N-262), E2F-1 (both from Santa Cruz Biotechnology, Santa Cruz, CA, USA), acetylated histone H3, BaxNT (both from Upstate Biotechnology, Lake Placid, NY, USA) and lamin (Vision Biosystems, Norwell, MA, USA). GAPDH (HyTest, Turku, Finland), a-tubulin (Calbiochem, San Diego, CA, USA) or b-actin (Sigma) were used Oncogene (2012) 4677 - 4688


4686 GB1 time [h]

0

12

GB2 0

24

12

Ac-H3

17 kD

α-tubulin

50 kD GB1

time [h]

0

12

GB2 24

0

cFLIPL

55 kD

cFLIPS

26 kD

α-tubulin (50 kD)

GAPDH (36 kD)

#

# * 0.05

0.1 0.25 0.5 TRAIL [ng/ml]

1

120 #

# # #

*

100 80 60 40 20

* 0

*

140

0 µM MS275 2.5 µM MS275

tumor area (% of control)

#

100 90 80 70 60 50 40 30 20 10 0



GB2

0 μM MS275 2 μM MS275

0

24

12

GB1 100 90 80 70 60 50 40 30 20 10 0

24

0.25

0.5

2.5

TRAIL [ng/ml]

5

0 MS275 TRAIL

-

+ -

+

+ +

Figure 6. MS275 sensitizes primary glioblastoma cells for TRAIL-induced apoptosis and cooperates with TRAIL to suppress tumor growth in vivo. (a-c) Primary cultured glioblastoma cells were treated for the indicated times with 2 mM (GB1) or 2.5 mM (GB2) MS275. (a) Expression of acetylated histone H3 and a-tubulin was assessed by western blotting (upper panels) and expression of cFLIP, a-tubulin and b-actin was assessed by western blotting (lower panels). (b) Primary cultured glioblastoma cells were pre-treated for 24 h with MS275, followed by treatment with indicated concentrations of TRAIL for 24 h. Apoptosis was determined by FACS analysis of DNA fragmentation of propidium iodide-stained nuclei. Background apoptosis: GB1: 23.8%, GB2: 11.6%. Mean±s.e.m. of three independent experiments carried out in duplicate (GB1) or triplicate (GB2) are shown; *Po0.05, #Po0.001. (c) U87MG cells were seeded on the CAM of chicken embryos and treated as described in Materials and methods with MS275 and/or TRAIL. Tumor growth was analyzed using hematoxylin/eosin-stained paraffin sections of the CAM. Shown is tumor area, error bars indicate mean±s.d. of six samples per group; *Po0.01. Similar results were obtained in two independent experiments.

as loading controls. Goat anti-mouse IgG, goat anti-rabbit IgG conjugated to horseradish peroxidase (Santa Cruz Biotechnology) and goat anti-mouse IgG1, goat anti-mouse IgG2b or goat anti-mouse kappa (Southern Biotech, Birmingham, UK) conjugated to horseradish peroxidase were used as secondary antibodies. Enhanced chemiluminescence was used for detection (Amersham Bioscience, Freiburg, Germany). To prepare nuclear fractions, cells were suspended in hypotonic buffer (10 mM HEPES-OH (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 1 mM sodium vanadate and protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany)) and incubated on ice. Swelled cells were lysed by vortexing with 1% (v/v) Ipegal CA-630 (Sigma) for 30 s and centrifuged (3000 r.p.m, 5 min, 4 1C) to obtain cytosolic fractions (supernatants). The pellet was washed twice in isotonic buffer (10 mM Tris--Hcl (pH 7.4), 150 mM NaCl), resuspended in high salt buffer (20 mM HEPES-OH (pH 7.9), 420 mM NaCl, 1.5 mM MgCl2, 0.5 mM EDTA, 25% glycerol, 0.5 mM DTT, 1 mM sodium vanadate, protease inhibitor cocktail) and incubated on ice for 15 min. Nuclear extracts were cleared by centrifugation (14 000 r.p.m., 10 min, 4 1C) and analyzed by western blotting. Anti-lamin, anti-GAPDH and anti-a-tubulin antibodies were used to control the purity of the fractions.

incubated with rabbit anti-mouse F(ab0 )2 IgG/biotin (BD Biosciences) for 20 min at 4 1C in the dark, washed in phosphate-buffered saline containing 1% fetal calf serum, incubated with streptavidin-phycoerythrin (BD Biosciences) for 20 min at 4 1C in the dark and analyzed by flow cytometry.

TRAIL DISC analysis Cells were pre-treated with or without MS275 for 24 h and were incubated for 1 h (U87MG) or 30 min (A172) at 37 1C with 1 mg/ml Flag-tagged TRAIL (Alexis Biochemicals) or left untreated. After lysis using a buffer containing 50 mM Tris--HCl (pH 8.0), 150 mM NaCl, 1% (v/v) Triton-X 100 and protease inhibitor cocktail, 1 mg/ml Flag-tagged TRAIL was also added to the MS275treated and untreated samples. The TRAIL receptor-associated DISC was immunoprecipitated from the lysates using 1.25 mg/ml mouse anti-Flag M2 antibody (Sigma). 10 ml pan-mouse IgG Dynabeads (Invitrogen) were added and it was incubated overnight at 4 1C. Samples were washed three times with buffer containing 50 mM Tris--HCl (pH 8.0), 500 mM NaCl and 1% (v/v) Ipegal CA-630, and once with buffer containing 25 mM Tris--HCl (pH 7.7). Recruitment of TRAIL-R2, FADD, cFLIP and caspase-8 was analyzed by western blotting.

Staining of cell surface receptors

Immunoprecipitation of activated Bax

To determine the surface expression of TRAIL receptors and CD95, cells were incubated with mouse antibodies for TRAIL-R1 to -R4 (all from ApoTech Corporation, Epalinges, Switzerland) or CD9546 for 30 min at 4 1C, washed in phosphate-buffered saline containing 1% fetal calf serum,

For determination of Bax activation, cells were lysed in CHAPS lysis buffer (10 mM HEPES (pH 7.4), 150 mM NaCl, 1% CHAPS, protease inhibitor cocktail). 1 mg protein was incubated with 8 mg mouse anti-Bax antibody (clone 6A7, Sigma) and pan-mouse IgG Dynabeads (10 ml; Invitrogen)

Oncogene (2012) 4677 -- 4688



4687 overnight at 4 1C. Beads were washed with CHAPS lysis buffer and samples were analyzed by western blotting using rabbit anti-BaxNT antibody.

Determination of mitochondrial membrane potential and cytochrome c release To assess changes in mitochondrial transmembrane potential, cells were incubated with 1 mM CMXRos (Molecular Probes, Karlsruhe, Germany) for 30 min at 37 1C and immediately analyzed by flow cytometry. For determination of cytochrome c and Bid in cytosolic and mitochondrial fractions, cells were incubated for 3 min in lysis buffer (2 mM NaH2PO4, 16 mM Na2HPO4, 150 mM NaCl, 500 mM sucrose, 1 mM DTT, protease inhibitor cocktail, 1 mg/ml digitonin; pH 7.4) and centrifuged (14 000 r.p.m., 1 min, 4 1C). The supernatant (cytosolic fraction) was collected and the pellet was incubated for 2 h at 4 1C in lysis buffer (30 mM Tris--HCl (pH 7.5), 150 mM NaCl, 1% (v/v) Triton-X 100, 10% glycerol (Invitrogen), protease inhibitor cocktail). Mitochondrial fractions were cleared by centrifugation (14 000 r.p.m., 20 min, 4 1C). Protein expression of cytochrome c and Bid were analyzed by western blotting. OxPhos Complex IV (Cox IV) and a-tubulin were used to control the purity of the fractions.

Reverse transcription and quantitative real-time PCR Total RNA was isolated using RNeasy Mini Kit (Qiagen). A total of 1 mg of RNA was transcribed with ImProm-II Reverse transcription system (Promega, Madison, WI, USA) according to the manufacturer’s instructions. For quantitative real-time PCR analysis, the LightCycler FastStart DNA Master SYBR Green I Kit (Roche Diagnostics) was used according to the manufacturer’s recommendations with 40 cycles, 2 mM MgCl2 and the following primers: cFLIPL forward: 50 -GAACATCCACAGAATAGACC-30 , cFLIPL reverse: 50 -GTATCTCTCTTCAGGTATGC-30 ; cFLIPS forward: 50 -GAACATCCA CAGAATAG ACC-30 , cFLIPS reverse: 50 -TTTCAGATCAGGACAATGGG-30 ; and GAPDH forward: 50 -TGTTCGTCATGGGTGTGAACC-30 , GAPDH reverse: 50 -GCAGTGATGGCAT GGACTGTG-30 . PCR conditions were as follows: (1) 15 s at 95 1C, (2) 30 s at 58 1C and (3) 30 s at 72 1C.

elution buffer (1% SDS, 100 mM NaHCO3) and incubated for 15 min at 30 1C. The eluate was subjected to RNAse digestion for 5 min at 37 1C. Crosslinking was reversed by adding proteinase K and shaking at 65 1C for at least 4 h. The DNA was precipitated and purified by phenolchloroform extraction, washed two times with 100% ethanol, dried and solved in water. Quantitative PCR was performed using SYBR-green (Eurogentec, Liege, Belgium) and LightCycler 480 (Roche). Primer sequences were: cFLIP forward: GTGTAGGAGAGAAGCGCCGCGAAC, cFLIP reverse: GTGTAGGAGAGAAGCGCCGCGAAC; c-Jun forward: TCCCTGGAGC GAGCTGGTGA, c-Jun reverse: CTGCGCGCACAAGTTTCGGG; and GAPDH exon 6 forward: GCCAAGGCTGTGGGCAAGGT, GAPDH exon 6 reverse: CCTCCGACGCCTGCTTCACC.

Chorioallantoic membrane assay CAM assay was done as described previously.27 Briefly, 1 106 cells were resuspended in 10 ml serum-free medium in the presence or absence of TRAIL (5 ng/egg) and 10 ml Matrigel matrix (BD Biosciences) after treatment with or without 8 mM MS275 for 24 h and implanted on the CAM of fertilized chicken eggs on day 8 of incubation. Next day, cells were treated with MS275 (715 ng/egg) or TRAIL (0.075 ng/egg). Four days after inoculation, tumors were excised with the surrounding CAM, fixed in 4% paraformaldehyde, embedded in paraffin, cut in 5 mm-sections and stained with 1:1 hematoxylin and 0.5% eosin solution for histological analysis. Images were digitally recorded with an AX70 microscope (Olympus, Center Valley, PA, USA), and tumor areas were analyzed with ImageJ digital imaging software.

Statistical analysis Statistical significance was assessed by Student’s t-test (two-tailed distribution, two-sample, unequal variance).

CONFLICT OF INTEREST The authors declare no conflict of interest.

Luciferase assay The Dual-Luciferase Reporter Assay System (Promega) was used to determine firefly and renilla luciferase activities as described previously.48 Cells were transiently transfected with firefly luciferase vector containing a 1460-bp sequence of the promoter region of the cFLIP gene24 or with renilla luciferase vector under the control of the ubiquitin promoter. Transfection was done using Fugene 6 Transfection Reagent (Roche, Mannheim, Germany) in serum-free medium. After 24 h, cells were stimulated appropriately, thereafter lysed with passive lysis buffer and luciferase activity was determined. Firefly luciferase values were normalized to renilla luciferase values, and fold increase in luciferase activity is shown.

Chromatin immunoprecipitation assay A172 cells were treated with 5 mM MS275 for 5 h. Cells were crosslinked on the plate for 15 min with 0.75% formaldehyde. Crosslinking was stopped by adding glycine to a final concentration of 125 mM. Cells were scraped, washed three times with ice-cold phosphate-buffered saline and lysed for 1 h in 1200 ml FA lysis buffer (50 mM HEPES-KOH pH7.5, 140 mM NaCl, 1 mM EDTA pH8, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS). Chromatin was fragmented to an average of 500 bp length by sonication using a Bioruptor (Diagenode, Liege, Belgium), centrifuged at full speed for 5 min and the supernatant was diluted 1:5 in SDS-free RIPA buffer (50 mM Tris--HCl pH8, 150 mM NaCl, 2 mM EDTA pH8, 1% NP-40, 0.5% sodium deoxycholate). 10 mg anti-c-myc (N-262, Santa Cruz) or 3 mg of anti-RNA Polymerase II antibody (Abcam, Cambridge, UK) and magnetic protein-G beads were added to lysates and incubated on a rotating wheel at 4 1C overnight. The next day beads were captured using a magnetic rack, the supernatant was discarded and beads were washed four times with washing buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA pH8, 150 mM NaCl, 20 mM Tris--HCl pH8) and once with final washing buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA pH8, 500 mM NaCl, 20 mM Tris--HCl pH8). For elution of captured chromatin, the bead pellet was resuspended in 120 ml & 2012 Macmillan Publishers Limited

ACKNOWLEDGEMENTS We thank O Micheau (Dijon, France) and M providing cFLIP vectors. This work has been the Deutsche Forschungsgemeinschaft, Else Community (ApopTrain, APO-SYS) and IAP6/18

Leverkus (Mannheim, Germany) for partially supported by grants from Kro¨ner-Fresenius-Stiftung, European (to SF).

REFERENCES 1 Van Meir EG, Hadjipanayis CG, Norden AD, Shu HK, Wen PY, Olson JJ. Exciting new advances in neuro-oncology: the avenue to a cure for malignant glioma. CA Cancer J Clin 2010; 60: 166 - 193. 2 Stupp R, Hegi ME, Mason WP, van den Bent MJ, Taphoorn MJ, Janzer RC et al. Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 2009; 10: 459 - 466. 3 Hengartner MO. The biochemistry of apoptosis. Nature 2000; 407: 770 - 776. 4 Gonzalvez F, Ashkenazi A. New insights into apoptosis signaling by Apo2L/TRAIL. Oncogene 2010; 29: 4752 - 4765. 5 Pennarun B, Meijer A, de Vries EG, Kleibeuker JH, Kruyt F, de Jong S. Playing the DISC: turning on TRAIL death receptor-mediated apoptosis in cancer. Biochim Biophys Acta 2010; 1805: 123 - 140. 6 Kroemer G, Galluzzi L, Brenner C. Mitochondrial membrane permeabilization in cell death. Physiol Rev 2007; 87: 99 - 163. 7 Li H, Zhu H, Xu CJ, Yuan J. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 1998; 94: 491 - 501. 8 Adams JM, Cory S. Bcl-2-regulated apoptosis: mechanism and therapeutic potential. Curr Opin Immunol 2007; 19: 488 - 496. 9 LaCasse EC, Mahoney DJ, Cheung HH, Plenchette S, Baird S, Korneluk RG. IAPtargeted therapies for cancer. Oncogene 2008; 27: 6252 - 6275. 10 Micheau O. Cellular FLICE-inhibitory protein: an update. In: Debatin KM, Fulda S (eds). Apoptosis and Cancer Therapy. Wiley-VCH: Heidelberg, 2006, pp 120 - 157. 11 Ashkenazi A. Directing cancer cells to self-destruct with pro-apoptotic receptor agonists. Nat Rev Drug Discov 2008; 7: 1001 - 1012.

Oncogene (2012) 4677 - 4688


4688 12 Kuijlen JM, Bremer E, Mooij JJ, den Dunnen WF, Helfrich W. Review: on TRAIL for malignant glioma therapy? Neuropathol Appl Neurobiol 2010; 36: 168 - 182. 13 Fulda S. Modulation of TRAIL-induced apoptosis by HDAC inhibitors. Curr Cancer Drug Targets 2008; 8: 132 - 140. 14 Ellis L, Atadja PW, Johnstone RW. Epigenetics in cancer: targeting chromatin modifications. Mol Cancer Ther 2009; 8: 1409 - 1420. 15 Bolden JE, Peart MJ, Johnstone RW. Anticancer activities of histone deacetylase inhibitors. Nat Rev Drug Discov 2006; 5: 769 - 784. 16 Minucci S, Pelicci PG. Histone deacetylase inhibitors and the promise of epigenetic (and more) treatments for cancer. Nat Rev Cancer 2006; 6: 38 - 51. 17 Martinez-Balbas MA, Bauer UM, Nielsen SJ, Brehm A, Kouzarides T. Regulation of E2F1 activity by acetylation. EMBO J 2000; 19: 662 - 671. 18 Vervoorts J, Luscher-Firzlaff J, Luscher B. The ins and outs of MYC regulation by posttranslational mechanisms. J Biol Chem 2006; 281: 34725 - 34729. 19 Weidinger C, Krause K, Klagge A, Karger S, Fuhrer D. Forkhead box-O transcription factor: critical conductors of cancer’s fate. Endocr Relat Cancer 2008; 15: 917 - 929. 20 Frew AJ, Johnstone RW, Bolden JE. Enhancing the apoptotic and therapeutic effects of HDAC inhibitors. Cancer Lett 2009; 280: 125 - 133. 21 Kataoka T, Budd RC, Holler N, Thome M, Martinon F, Irmler M et al. The caspase-8 inhibitor FLIP promotes activation of NF-kappaB and Erk signaling pathways. Curr Biol 2000; 10: 640 - 648. 22 Micheau O, Lens S, Gaide O, Alevizopoulos K, Tschopp J. NF-kappaB signals induce the expression of c-FLIP. Mol Cell Biol 2001; 21: 5299 - 5305. 23 Sanchez-Perez T, Ortiz-Ferron G, Lopez-Rivas A. Mitotic arrest and JNK-induced proteasomal degradation of FLIP and Mcl-1 are key events in the sensitization of breast tumor cells to TRAIL by antimicrotubule agents. Cell Death Differ 2010; 17: 883 - 894. 24 Ricci MS, Jin Z, Dews M, Yu D, Thomas-Tikhonenko A, Dicker DT et al. Direct repression of FLIP expression by c-myc is a major determinant of TRAIL sensitivity. Mol Cell Biol 2004; 24: 8541 - 8555. 25 Skurk C, Maatz H, Kim HS, Yang J, Abid MR, Aird WC et al. The Akt-regulated forkhead transcription factor FOXO3a controls endothelial cell viability through modulation of the caspase-8 inhibitor FLIP. J Biol Chem 2004; 279: 1513 - 1525. 26 Salon C, Eymin B, Micheau O, Chaperot L, Plumas J, Brambilla C et al. E2F1 induces apoptosis and sensitizes human lung adenocarcinoma cells to death-receptormediated apoptosis through specific downregulation of c-FLIP(short). Cell Death Differ 2006; 13: 260 - 272. 27 Hacker S, Dittrich A, Mohr A, Schweitzer T, Rutkowski S, Krauss J et al. Histone deacetylase inhibitors cooperate with IFN-gamma to restore caspase-8 expression and overcome TRAIL resistance in cancers with silencing of caspase-8. Oncogene 2009; 28: 3097 - 3110. 28 Hernandez A, Thomas R, Smith F, Sandberg J, Kim S, Chung DH et al. Butyrate sensitizes human colon cancer cells to TRAIL-mediated apoptosis. Surgery 2001; 130: 265 - 272. 29 Aron JL, Parthun MR, Marcucci G, Kitada S, Mone AP, Davis ME et al. Depsipeptide (FR901228) induces histone acetylation and inhibition of histone deacetylase in chronic lymphocytic leukemia cells concurrent with activation of caspase 8-mediated apoptosis and down-regulation of c-FLIP protein. Blood 2003; 102: 652 - 658. 30 Watanabe K, Okamoto K, Yonehara S. Sensitization of osteosarcoma cells to death receptor-mediated apoptosis by HDAC inhibitors through downregulation of cellular FLIP. Cell Death Differ 2005; 12: 10 - 18. 31 Pathil A, Armeanu S, Venturelli S, Mascagni P, Weiss TS, Gregor M et al. HDAC inhibitor treatment of hepatoma cells induces both TRAIL-independent apoptosis and restoration of sensitivity to TRAIL. Hepatology 2006; 43: 425 - 434.

32 Mitchell KO, Ricci MS, Miyashita T, Dicker DT, Jin Z, Reed JC et al. Bax is a transcriptional target and mediator of c-myc-induced apoptosis. Cancer Res 2000; 60: 6318 - 6325. 33 Wang Y, Engels IH, Knee DA, Nasoff M, Deveraux QL, Quon KC. Synthetic lethal targeting of MYC by activation of the DR5 death receptor pathway. Cancer Cell 2004; 5: 501 - 512. 34 Nieminen AI, Partanen JI, Hau A, Klefstrom J. c-Myc primed mitochondria determine cellular sensitivity to TRAIL-induced apoptosis. EMBO J 2007; 26: 1055 - 1067. 35 Kotliarova S, Pastorino S, Kovell LC, Kotliarov Y, Song H, Zhang W et al. Glycogen synthase kinase-3 inhibition induces glioma cell death through c-MYC, nuclear factor-kappaB, and glucose regulation. Cancer Res 2008; 68: 6643 - 6651. 36 Guo F, Sigua C, Tao J, Bali P, George P, Li Y et al. Cotreatment with histone deacetylase inhibitor LAQ824 enhances Apo-2L/tumor necrosis factor-related apoptosis inducing ligand-induced death inducing signaling complex activity and apoptosis of human acute leukemia cells. Cancer Res 2004; 64: 2580 - 2589. 37 Singh TR, Shankar S, Srivastava RK. HDAC inhibitors enhance the apoptosisinducing potential of TRAIL in breast carcinoma. Oncogene 2005; 24: 4609 - 4623. 38 Aguilera DG, Das CM, Sinnappah-Kang ND, Joyce C, Taylor PH, Wen S et al. Reactivation of death receptor 4 (DR4) expression sensitizes medulloblastoma cell lines to TRAIL. J Neurooncol 2009; 93: 303 - 318. 39 Carlisi D, Lauricella M, D’Anneo A, Emanuele S, Angileri L, Di Fazio P et al. The histone deacetylase inhibitor suberoylanilide hydroxamic acid sensitises human hepatocellular carcinoma cells to TRAIL-induced apoptosis by TRAIL-DISC activation. Eur J Cancer 2009; 45: 2425 - 2438. 40 Inoue S, Harper N, Walewska R, Dyer MJ, Cohen GM. Enhanced Fas-associated death domain recruitment by histone deacetylase inhibitors is critical for the sensitization of chronic lymphocytic leukemia cells to TRAIL-induced apoptosis. Mol Cancer Ther 2009; 8: 3088 - 3097. 41 Kim EH, Kim HS, Kim SU, Noh EJ, Lee JS, Choi KS. Sodium butyrate sensitizes human glioma cells to TRAIL-mediated apoptosis through inhibition of Cdc2 and the subsequent downregulation of survivin and XIAP. Oncogene 2005; 24: 6877 - 6889. 42 Sun P, Xia S, Lal B, Eberhart CG, Quinones-Hinojosa A, Maciaczyk J et al. DNER, an epigenetically modulated gene, regulates glioblastoma-derived neurosphere cell differentiation and tumor propagation. Stem Cells 2009; 27: 1473 - 1486. 43 Eyupoglu IY, Hahnen E, Trankle C, Savaskan NE, Siebzehnrubl FA, Buslei R et al. Experimental therapy of malignant gliomas using the inhibitor of histone deacetylase MS-275. Mol Cancer Ther 2006; 5: 1248 - 1255. 44 Simonini MV, Camargo LM, Dong E, Maloku E, Veldic M, Costa E et al. The benzamide MS-275 is a potent, long-lasting brain region-selective inhibitor of histone deacetylases. Proc Natl Acad Sci USA 2006; 103: 1587 - 1592. 45 Opel D, Westhoff MA, Bender A, Braun V, Debatin KM, Fulda S. Phosphatidylinositol 3-kinase inhibition broadly sensitizes glioblastoma cells to death receptorand drug-induced apoptosis. Cancer Res 2008; 68: 6271 - 6280. 46 Trauth BC, Klas C, Peters AM, Matzku S, Moller P, Falk W et al. Monoclonal antibody-mediated tumor regression by induction of apoptosis. Science 1989; 245: 301 - 305. 47 Fulda S, Sieverts H, Friesen C, Herr I, Debatin KM. The CD95 (APO-1/Fas) system mediates drug-induced apoptosis in neuroblastoma cells. Cancer Res 1997; 57: 3823 - 3829. 48 Karl S, Pritschow Y, Volcic M, Hacker S, Baumann B, Wiesmuller L et al. Identification of a novel pro-apopotic function of NF-kappaB in the DNA damage response. J Cell Mol Med 2009; 13: 4239 - 4256.

Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc)

Oncogene (2012) 4677 -- 4688
