Molecular & Biochemical Parasitology 119 (2002) 265– 271 www.parasitology-online.com
Histone H1 is phosphorylated in non-replicating and infective forms of Trypanosoma cruzi Rafael Marques Porto, Roge´rio Amino, Maria Carolina Quartim Elias, Marcella Faria, Sergio Schenkman * Departamento de Microbiologia, Imunologia a Parasitologia, Escola Paulista de Medicina, UNIFESP, R. Botucatu, 862 /8a, Sa˜o Paulo, SP 04023 -062, Brazil Received 19 July 2001; received in revised form 20 September 2001; accepted 2 November 2001
Abstract The nuclear structure changes during the differentiation from growing to infective stages of Trypanosoma cruzi. As histone modifications have been correlated with structural and functional changes of chromatin, we investigated whether histones in T. cruzi are modified during the life cycle of this protozoan parasite. We found that histone H1 isolated from proliferating forms (epimastigotes) and from differentiated/infective forms (trypomastigotes) have a distinct migrating pattern in Triton–acetic acid–urea gel electrophoresis. While epimastigotes contain predominantly a fast migrating form, a slow migrating band is prominent in trypomastigotes. By metabolically labeling the cells with radioactive phosphate, we demonstrated that the slow migrating histone H1 band is phosphorylated, and that after alkaline phosphatase treatment, it migrates as the fast form. Parasites arrested at the onset of the S phase of the cell cycle with hydroxyurea (HU) also predominantly have the phosphorylated form of histone H1, suggesting that phosphorylation occurs in non-replicating stages of T. cruzi. We also found that the phosphorylated histone H1 is more weakly associated with the chromatin, being preferentially released at 150 mM NaCl. Therefore, histone H1 phosphorylation varies during the life cycle of T. cruzi, and might be related to changes in the chromatin structure. © 2002 Elsevier Science B.V. All rights reserved. Keywords: Histone; Chromatin; Trypanosoma cruzi
1. Introduction Chromatin is a highly dynamic structure composed of DNA –histone complexes, which are the substrates for the transcription and replication machineries. The DNA is wrapped around a dimer of the four histones, H2a, H2b, H3 and H4. A fifth linker histone H1, further stabilizes chromatin and helps condense it into higher order structures by interacting with the core histones and the DNA on either side of the nucleosome. Post-translational core histone modifications regulate chromatin structure and gene transcription by changing their affinity for DNA, and by allowing specific binding Abbre6iations: HU, hydroxyurea; Mnase, Micrococcus nuclease; TAU-PAGE, triton– acetic acid–urea PAGE. * Corresponding author. Tel.: + 55-11-5575-1996; fax: + 55-115571-5877. E-mail address:
[email protected] (S. Schenkman).
of regulatory proteins to defined chromatin targets [1–3]. Less is known about the linker histones and the role of their post-translational modifications [4]. In higher eukaryotes, H1 histones are formed by a globular domain, which interacts with the nucleosomal DNA and the core histones, and two less structured N- and C-terminal sequences [5]. These latter sequences are rich in lysine, serine, alanine and proline, and participate in the interaction with the linker DNA. The presence of histone H1 results in chromatin condensation. In addition to control chromatin condensation, H1 histones are involved in the control of gene transcription [4,6], and in chromatin remodeling [7]. These controls depend on phosphorylation of the different histone H1 domains and on the expression of different histone H1 genes [8]. Addition of phosphate groups introduces a negative charge and decreases the interaction of the protein with DNA [9]. Histone H1 phosphorylation is
0166-6851/02/$ - see front matter © 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 6 8 5 1 ( 0 1 ) 0 0 4 3 0 - 3
266
R. Marques Porto et al. / Molecular & Biochemical Parasitology 119 (2002) 265–271
lower in the G1 phase of the cell cycle, increasing continuously when cells enter S phase to become hyperphosphorylated when chromosome condensation is maximal during mitosis and meiosis [8]. At this point, it has been proposed that hyperphosphorylation is linked to high chromatin condensation, possibly by allowing the binding of accessory factors (see Ref. [10]). The function of histone H1 is even less clear in early eukaryotes such as the Entamoebida, Kinetoplastids, Ciliates and Dinoflagellates. They lack the central globular domain of histone H1, which, together with the carboxy-terminal domain, is necessary for chromatin condensation in higher ordered structures [5]. Accordingly, no 30 nm chromatin condensation is observed in these organisms. Histone H1 knockouts in Tetrahymena are still viable and some genes have their transcription increased, and others decreased [11]. Mutants containing glutamic acid in place of the phosphorylated serines have the same effect as histone H1 knockouts. Thus, charges introduced by phosphorylation may displace the histone H1 protein from the chromatin, allowing binding of specific regulating factors [12]. Deletion of histone H1 genes has no major detectable effect in yeast cell viability and gene expression [13]. In Kinetoplastids, where histones have been well characterized [14–16], different forms of histone H1 are present through the different developmental stages of these organisms [17– 23]. Phosphorylation has been suggested to occur in the histone H1 of the Kinetoplastid Trypanosoma cruzi, the agent of Chagas’ disease [24]. Since we found that this protozoan undergoes nuclear structure reorganization during the life cycle [25], we asked whether the observed chromatin changes could be related to histone modifications. Here we examined the phosphorylation state of histone H1 in the proliferating epimastigote forms versus non proliferating and differentiated trypomastigote forms.
2. Materials and methods
2.1. Parasites and cell cultures T. cruzi epimastigote forms (Y strain and G strain) were cultured in liver infusion tryptose medium supplemented with 10% fetal bovine serum (FBS) at 28 °C. Metacyclic forms were obtained from aged epimastigote cultures from G-strain epimastigotes and purified as described [26]. Trypomastigote forms were derived from infected LLCMK2 mammalian cells (ATCC) maintained in low glucose Dulbeco’s modified Eagle medium containing 10% FBS at 37 °C and 5% CO2. When trypomastigotes emerged from the cells the culture medium was collected. The medium containing epimastigotes or trypomastigotes was collected and centrifuged at 1000× g, and the pellets were washed with
phosphate buffered saline (PBS) and immediately used, or stored at −70 °C. Epimastigotes at 6× 106 parasites per ml (log phase of growth) were synchronized by incubation with 20 mM hydroxyurea (HU) for 24 h, and the parasites were collected and stored as above. The HU treatment blocks the culture in G1/S transition as seen by FAGS analysis using ethidium bromide as stain. HU treated parasites were viable and re-enter the cell cycle in a few hours. For in vivo labeling, log phase epimastigotes (6×106 ml − 1), were centrifuged, washed, and resuspended to 1× 107 ml − 1 in Dulbecco’s modified Eagle medium lacking phosphate (Invitrogen-Life Technologies). After a starvation period of 90 min, we added 0.025 mCi ml − 1 of phosphorus-33 radionuclide (40–158 Ci mg − 1, Perkin–Elmer Life Sciences), and the cells were incubated for an additional 90 min at 28 °C. To label trypomastigotes, infected LLCMK2 cells were washed twice with PBS, and with Dulbecco’s modified Eagle medium lacking phosphate. After 90 min, 25 mCi ml − 1 of [33P] radionuclide was added and the culture was maintained for 24 h at 37 °C. The released parasites were collected and processed as above.
2.2. Nuclei purification and histone extraction Frozen, or freshly collected parasites (109) were washed and resuspended in 1 ml of 10 mM potassium glutamate, 250 mM sucrose, 2.5 mM CaCl2, 1 mM phenyl-methylsulfonyl fluoride (suspension buffer). Lysis was completed by addition of 0.1 Triton X100, the lysate was centrifuged, washed, and resuspended in 1 ml of suspension buffer. The lysate was then layered on the top of a 50% Percoll solution (Amersham Pharmacia) in suspension buffer (4 ml), and centrifuged at 63 000× g at 4 °C for 2 h [27]. The band formed at the bottom of the self-forming Percoll gradient, containing nuclei, was recovered, and washed in suspension buffer. Parasite lysates, or Percoll purified nuclei, were washed twice with suspension buffer lacking sucrose, and acid extracted with 0.25 N HCl, or 5% perchloric acid, for 2 h at 4 °C under agitation, as described [21]. The insoluble material was removed by centrifugation at 12 000× g for 15 min at 4 °C; acid soluble proteins were precipitated with eight volumes of acetone, washed three times with acetone/HCl 0.1 M 10:1, and twice with pure acetone, then vacuum dried. For phosphatase treatments, HCl extracts were neutralized with 1 M Tris-base (40% v/v). Perchloric acid extracts were dialyzed overnight at 4 °C against 0.25 N HCl, and neutralized as above. These solutions were treated with 10 U of shrimp alkaline phosphatase in the presence of 10 mm MgCl2, 0.1 mM phenyl-methyl-sulfonyl fluoride for 4 h at 37 °C. The solutions were dialyzed 14 h at 4 °C against 0.25 N HCl and the soluble proteins
R. Marques Porto et al. / Molecular & Biochemical Parasitology 119 (2002) 265–271
precipitated with acetone and washed, as described above.
2.3. Triton–acetic acid– urea page and immunoblot Extracts were fractionated in a 15% acrylamide/ bisacrylamide (19:1) gel containing 6 M urea, 0.38% Triton DF16 (Sigma) and 5% acetic acid. The stacking gel contained 12% acrylamide/bisacrylamide, and the electrophoresis buffer was 5% acetic acid. A first prerun was made at 20 mA constant until the voltage stabilized. The wells were then loaded with 1 M b-mercaptoethanolamine, and the gel was again pre-run for 1 h. Dried samples were resuspended in sample buffer containing 2.5 M urea, 5% acetic acid, 0.01% pyronin G, 3% b-mercaptoethanol, incubated for 5 min at 65 °C and applied into the gel. The gel was run at 20 mA, then stained with Coomassie Blue. Alternatively, proteins were transferred to nitrocellulose membranes, which were stained with Ponceau S and blocked with 5% non-fat milk in PBS for 1 h. Membranes were incubated with antibodies diluted in PBS-milk, and detected with peroxidase labeled anti-rabbit IgG antibody and DAB reagent (BioRad). The histone H1 gene was amplified using total T. cruzi DNA, and the primers TCHEnpet (5%GGAATTCCATATGTCTGACGCCGCCGT) and H1BamRev (5%-CGGATCCCTTCTTCTTCGGCGCCTTC), based on the published histone H1 gene sequences [24]. The amplified product was cloned in the pGEM T-Easy (Promega) and then transferred to the NdeI and BamH1 sites of pET 14b vector. The recombinant H1 was produced in E. coli BLB 21 D3 containing the histone H1 gene cloned in pET14b (Novagen). The recombinant protein was purified using a Ni– NTA column (QIAGEN). Anti-T. cruzi histone H1 antibodies were prepared by immunizing rabbits with a histone H1 recombinant protein in Freund’s complete adjuvant, and by purifying monospecific antibodies by using a Tresyl activated agarose resin (Affinica) containing the recombinant histone H1. Total RNA from epimastigote forms were obtained by Trizol (Invitrogen-Life Technologies) extraction, submitted to reverse-transcriptase reaction using Superscript II and random hexanucleotide primers, and histone H1 cDNAs were amplified by PCR using the primers described above. The expected products were cloned in pGEM T-easy, and sequenced by using an ABI 377 automatic sequencing apparatus.
2.4. Nuclease treatment of chromatin Parasite lysates or Percoll purified nuclei were incubated in 100 ml of suspension buffer containing different amounts of MNase for 3 min at 37 °C. Reaction were stopped by the addition of 400 ml proteinase K
267
buffer containing 5 mM EDTA, 10 mM Tris–HCl pH 8, 0.5% SDS, and 50 mg proteinase K followed by 3 h incubation at 56 °C. Alternatively, the samples in 40 mM Tris – HCl pH 7.4, 6 mM MgCl were treated with different amounts of DNase I for 5 min at 37 °C. Reactions were stopped as above. DNA was extracted with phenol/chloroform, treated with 1 mg RNase A and analyzed by 1.5% agarose gel electrophoresis in TAE buffer.
3. Results
3.1. Histone H1 is phosphorylated in trypomastigotes Purified nuclei of trypomastigote and epimastigote T. cruzi forms were extracted with 0.25 N HCl, and the soluble proteins were precipitated with acetone and dried. The samples were fractionated in SDS-PAGE. As shown in Fig. 1A, this system did not separate histones with enough resolution to show subtle differences between the two parasite stages. Histone H1 could not be distinguished from the core histones by this method. Therefore, we have analyzed the extracted samples by Triton, acetic acid and Urea-PAGE (TAU-PAGE). This system separates proteins according to their charge and hydrophobicity, the more hydrophobic proteins being slowed by the Triton detergent. As shown in Fig.
Fig. 1. Histone pattern of T. cruzi trypomastigotes and epimastigotes. Nuclei from epimastigotes (Epi) and trypomastigote forms of T. cruzi (Trypo) were purified by Percoll gradient, extracted with 0.25 M HCl, and the soluble proteins were precipitated with acetone and analyzed by SDS-PAGE (A), or by TAU-PAGE (B). Gels were stained with Coomassie Blue R250. The arrows indicate the markers sizes and the histone positions.
268
R. Marques Porto et al. / Molecular & Biochemical Parasitology 119 (2002) 265–271
antibody in epimastigotes, but its nature is unknown. By extracting nuclei with 5% perchloric acid, which selectively extracts histone H1 [21], and analyzing the material by TAU-PAGE, followed by Coomassie staining, we also detected the two fast migrating bands in both epimastigotes and trypomastigotes (lanes e and f).
3.2. Phosphorylated forms of histone H1 of trypomastigotes are con6erted into the unphosphorylated form in epimastigotes
Fig. 2. Fast migrating bands in TAU-PAGE are histone H1-like proteins. Lysates of epimastigotes (Epi) and trypomastigotes (Trypo) were extracted with 0.25 N HCl (lanes a – d), or with perchloric acid (lanes e and f) and analyzed by TAUPAGE. The gels were transferred to nitrocellulose membranes and stained with Ponceau (P, lanes a and c), or labeled with anti-H1 mono-specific antibodies (Ab, lanes b and d). The lanes a and f were detected by Coomassie Blue R250 staining.
1B, core histones migrated slowly as found in superior eukaryotes, but histone H1 like proteins, which are extremely hydrophilic in trypanosomes, migrated at the gel front, as shown before [22]. In T. cruzi the front bands appeared in our system as a duplex in both epimastigote and trypomastigote forms. Interestingly, the faster migrating band in epimastigotes was more intense than the slower migrating one, as opposed to trypomastigotes, where the slower migrating band was predominant. The histone pattern of metacyclic-trypomastigotes, derived from aged epimastigote cultures, was the same as the histone pattern of trypomastigotes derived from infected mammalian cells (not shown). In this case we used the G strain because it differentiates into metacyclic-trypomastigotes better than the Y strain used in the other experiments. To be certain that the two faster migrating bands were indeed histone H1 proteins, epimastigote and trypomastigote nuclei were extracted with 0.25 N HCl, transferred to nitrocellulose membranes, stained with Ponceau, and incubated with mono-specific anti-serum prepared against a recombinant histone H1 of T. cruzi. As shown in Fig. 2, the fast migrating bands reacted with the antibody (lanes b and d). A band migrating slower than histone H3 was also recognized by the
As a family of genes encodes histone H1 proteins in T. cruzi [24], the various parasite stages could be expressing different members of this gene family as found in Leishmania [23]. Alternatively, the two different histone H1 forms could reflect different post-translational modifications. As phosphorylation is the principal posttranslational modification of histone H1, we labeled the parasites with [33P]-PO4, and analyzed the perchloric acid extracts in TAU-PAGE. As seen in Fig. 3A, only the slow migrating histone H1 bands were radiolabeled (lanes c and g). After phosphatase treatment the labeling disappeared (lanes d and h), the slower Coomassie bands also disappeared, and fast bands became stronger. Differences in the recovery were due to the multiple dialysis and washes of each sample. This result strongly suggests that the slow migrating band, present in the non-replicating trypomastigotes, represents a phosphorylated form of the fast migrating band, more abundant in epimastigotes.
Fig. 3. The upper histone H1 band is a phosphorylated form of the lower band. A. Epimastigotes (lanes a – d) and trypomastigotes (lanes e-h) were labeled with [33P]PO24 − and extracted with perchloric acid, untreated (lanes a, c, e, g), and treated (lanes b, d, f, h) with shrimp alkaline phosphatase, precipitated and analyzed by TAUPAGE. The gel was Coomassie stained (C) and exposed to X-ray films (33P). Lanes i and j show, respectively, the Coomassie staining (C) and the autoradiogram (33P) of epimastigotes labeled with [33P]-PO24 − and extracted with 0.25 N HCl. The thick arrow on the right indicates the position of the phosphorylated H1. The thin arrow shows the position of an unknown phosphorylated protein.
R. Marques Porto et al. / Molecular & Biochemical Parasitology 119 (2002) 265–271
269
epimastigotes may represent cells at the onset of Sphase, or cells undergoing differentiation to metacyclictrypomastigotes, which, like trypomastigotes, are arrested in a GO-like stage.
3.4. Phosphorylated histone H1 is weakly bound to the chromatin
Fig. 4. Hydroxyurea arrested epimastigotes present the histone H1 pattern similar to trypomastigotes. Epimastigotes were incubated in regular medium for 12 h in the absence ( −) and presence of 20 mM hydroxyurea ( +). The parasites were lysed, extracted with 0.25 N HCl, and the proteins analyzed by TAU-PAGE. Alternatively, HUtreated parasites were lysed, extracted 5% perchloric acid, and the soluble fractions were treated ( +), or untreated ( − ) with alkaline phosphatase. The samples were analyzed by TAU-PAGE, and Coomassie stained. The arrows indicate the position of histone H1 proteins.
When radiolabeled parasites were extracted with 0.25 N HCl, an additional band was detected. This band migrated above the band corresponding to histone H2b (Fig. 3, lane j) and comigrated with a protein that accumulates in the stationary growth-phase epimastigotes (not shown).
3.3. Histone H1 is phosphorylated at the onset of S phase of the cell cycle of epimastigotes Trypomastigotes are differentiated and non-dividing forms of T. cruzi. To find out whether the phosphorylation state of histone H1 is correlated with the cell cycle, exponentially growing epimastigotes were treated with 20 mM HU, which arrests the parasites at the onset of the S phase. As shown in Fig. 4, G1 arrested epimastigotes presented a histone H1 pattern in TAU-PAGE similar to the one found in trypomastigotes. Phosphatase treatment also converted the slow migrating histone H1 band of HU-arrested epimastigotes into the fast migrating band. Therefore, the presence of some phosphorylated histone H1 in exponentially growing
Phosphorylation of histone H1 has been shown to weaken the binding of the protein to the chromatin [12]. Similar release can be obtained by treating nuclei with salt [21]. Therefore, we expected that phosphorylated H1 would be released at lower salt concentration than non-phosphorylated histone H1. We then incubated epimastigote nuclei with increasing concentrations of NaCl and analyzed the histone H1 content that remained associated with the insoluble chromatin. Bound histone H1 were extracted with perchloric acid, separated by TAU-PAGE, Coomassie stained and the gel was scanned at high resolution. We measured the density of each band using the SCION-IMAGE Software. As shown in Fig. 5, the phosphorylated band was lost preferentially as the NaCl concentration increased from 100 to 150 mM, while the ratio of the phosphorylated histone H1 to non-phosphorylated form dropped from 0.3 to 0.1. Micrococcus nuclease (MNase) digests linker DNA. As histone H1 also binds to the linker DNA, it is assumed that it protects the chromatin from digestion with this nuclease. Therefore, we also studied the susceptibility of the epimastigote chromatin to MNase of nuclei treated at low or high salt concentrations. As expected, the chromatin of parasites treated at high salt was more susceptible to MNase (Fig. 5C).
4. Discussion In this work, we have demonstrated that histone H1 in non-proliferating forms of T. cruzi, such as trypomastigotes and epimastigotes arrested at the onset of S phase, is predominantly phosphorylated, while in replicating epimastigote forms, histone H1 is present mainly in a non phosphorylated form. We also found that phosphorylated histone H1 is more weakly bound to the chromatin in T. cruzi than the nonphosphorylated forms. As T. cruzi histone H1 is encoded by a multi-gene family [24], we cannot exclude the possibility that different H1 histone genes are expressed during the parasite life cycle, and that only some of them contain phosphorylation sites. Thus, it is possible that the slower migrating band is composed by phosphorylated forms of histone H1, while the faster migrating band contains a mixture of histone H1 proteins, of which some might not contain phosphorylation sites.
270
R. Marques Porto et al. / Molecular & Biochemical Parasitology 119 (2002) 265–271
The fact that salt preferentially releases phosphorylated histone H1 from chromatin suggests that histone H1 phosphorylation might be involved in the chromatin reorganization. Results obtained by Burri and coworkers [28] also support this; after alkaline phosphatase treatment, T. brucei histone H1 induces the in vitro formation of a more condensed chromatin in reconstituted nucleosomes, than the condensation observed with the heterogeneous histone H1 population. Moreover, it has also been shown by electron microscopy that at 380 nm NaCl, when all histone H1 is released, the chromatin is seen at its less condensed state in T. cruzi [21]. Interestingly, the chromatin from trypomastigote forms, which contains predominantly the phosphorylated histone H1, was more susceptible to
Fig. 5. In the presence of salt the chromatin of epimastigotes becomes more accessible to MNase and histone H1 is preferentially solubilized. A. Epimastigote nuclei were treated with the same amount of MNase at different NaCl concentrations. After the salt treatment, the nuclei above were extracted with perchloric acid and analyzed by TAU-PAGE. B. The gels were scanned at high resolution and the amount of gray was quantified with the SCION IMAGE software under non-saturating acquisitions. The graph shows the ratio of phosphorylated over the unphosphorylated histone C. Nuclei of epimastigotes were resuspended in 10 mM potassium glutamate, 0.25 M sucrose (0), or the same buffer with 150 mM NaCl (150), treated with the indicated amounts of MNase and analyzed by agarose gel electrophoresis.
MNase than epimastigote chromatin, while they were equally susceptible to DNase I (not shown). Whether this increased susceptibility was related to the phosphorylation of histone H1, remains to be determined. Other factors than histone H1 phosphorylation could be involved in the nucleosomal reorganization. Why does histone H1 phosphorylation, weakening the interaction of histone H1 with the DNA, occur in trypomastigotes, if these cells are less active in transcription, replication, and are expected to contain a more condensed chromatin structure? In histone H1 of higher eukaryotes, which contains a globular domain, the extent of phosphorylation has a dual effect in the chromatin structure [10]. It is absent in the G0 phase of the cell cycle, increasing during G1 and S-phases. At this point, phosphorylation seems to weaken the interaction with DNA, facilitating the replication and the correct positioning of the newly synthesized histone proteins. In mitosis, histone H1 becomes hyperphosphorylated, a condition that could facilitate the interaction with the DNA minor grove, allowing the approach of factors involved in metaphasic chromosome condensation [9]. This dual phosphorylation effect seems to be related to different phosphorylation sites and kinases involved: the cyclic AMP dependent phosphorylation occurs mainly in non-replicating cells, while other, cell cycle dependent (cdc) kinases act from S to M phase [29]. In histone H1 that lacks the globular domain, such as the histone H1 of Tetrahynaena, phosphorylation releases the protein from DNA, activating some genes, or decreasing the transcription of others, depending on the promoter context [12]. This may not be the case of T. cruzi, which regulates expression of specific genes mainly at the post-transcriptional level [30]. Histone H1 of T. cruzi contains typical KKAAP sequences and at least one (S/T)-P-X (K/R) site that is known to be phosphorylated by cdc2-related kinases present in kinetoplastids [31,32]. Alignment of these sequences with the ones from Tetrahymena, and the prototype histone H1 from Strongylocentrotus purpuratus [5], showed that the putative phosphorylation sites are different, although conserved among T. brucei and T. cruzi sequences (GenBank AY046273 and AY046274). In the future, identification of the phosphorylation sites, and the enzymes involved in these reactions can help to understand the mechanism that control the cell cycle and differentiation in Kinetoplastids. In addition, these studies challenge present theories on the role of histone H1 phosphorylation in eukaryotes.
Acknowledgements We thank Dr Beatriz Amaral de Castilho for reading the manuscript. This work was supported by grants
R. Marques Porto et al. / Molecular & Biochemical Parasitology 119 (2002) 265–271
from Fundac¸ a˜ o de Amparo a Pesquisa do Estado de S. Paulo (FAPESP) and Conselho Nacional de Desenvolvimento Cientifico e Tecnologico (CNPq).
References [1] Cheung P, Allis CD, Sassone-Corsi P. Signaling to chromatin through histone modifications. Cell 2000;103:263 –71. [2] Rice JC, Allis CD. Histone methylation versus histone acetylation: new insights into epigenetic regulation. Curr Opin Cell Biol 2001;13:263 – 73. [3] Strahl BD, Allis CD. The language of covalent histone modifications. Nature 2000;403:41 –5. [4] Thomas JO. Histone H1: location and role. Curr Opin Cell Biol 1999;11:312 – 7. [5] Kasinsky HE, Lewis JD, Dacks JB, Ausio J. Origin of H1 linker histones. FASEB J 2001;15:34 –42. [6] Wolffe AP. Histone H1. Int J Biochem Cell Biol 1997;29:1463 – 6. [7] Wolffe AP, Hansen JC. Nuclear visions: functional flexibility from structural instability. Cell 2001;104:631 –4. [8] Hohmann P. Phosphorylation of H1 histones. Mol Cell Biochem 1983;57:81 – 92. [9] Halmer L, Gruss C. Effects of cell cycle dependent histone H1 phosphorylation on chromatin structure and chromatin replication. Nucleic Acids Res 1996;24:1420 –7. [10] Roth SY, Allis CD. Chromatina condensation. Does H1 dephosphorylation play a role? Trends Biochem Sci 1992;17:93 – 8. [11] Dou Y, Mizzen CA, Abrams M, Allis CD, Gorovsky MA. Phosphorylation of linker histone H1 regulates gene expression in vivo by mimicking H1 removal. Mol Cell 1999;4:641 – 7. [12] Dou Y, Gorovsky MA. Phosphorylation of linker histone H1 regulates gene expression in vivo by creating a charge patch. Mol Cell 2000;6:225 – 31. [13] Hellauer K, Sirard E, Turcotte B. Decreased expression of specific genes in yeast cells lacking histone H1. J Biol Chem 2001;276:13587 – 92. [14] Hecker H, Betschart B, Bender K, Burri M, Schlimme W. The chromatin of trypanosomes. Int J Parasitol 1994;24:809 –19. [15] Galanti N, Galindo M, Sabaj V, Espinoza I, Toro GC. Histone genes in Trypanosomatids. Parasitol Today 1998;14:64 –9. [16] Belli SI. Chromatin remodelling during the life cycle of trypanosomatids. Int J Parasitol 2000;30:679 – 87. [17] Toro GC, Galanti N. H1 histone and histone variants in Trypanosoma cruzi. Exp Cell Res 1988;174:16 –24. [18] Toro GC, Galanti N, Hellman U, Wernstedt C. Unambiguous identification of histone H1 in Trypanosoma cruzi. J Cell Biochem 1993;52:431 –9.
271
[19] Burri M, Schlimme W, Betschart B, Kampfer U, Schaller J, Hecker H. Biochemical and functional characterization of histone H1-like proteins in procyclic Trypanosoma brucei brucei. Mol Biochem Parasitol 1993;79:649 – 59. [20] Schlimme W, Burri M, Bender K, Betschart B, Hecker H. Trypanosoma brucei brucei: differences in the nuclear chromatin of blood stream forms and procyclic culture forms. Parasitology 1993;72:76 – 86. [21] Schlimme W, Burri M, Betschart B, Hecker H. Properties of the histories and functional aspects of the soluble chromatin of epimastigote Trypanosoma cruzi. Acta Trop 1995;60:141 –54. [22] Espinoza I, Toro GC, Hellman U, Galanti N. Histone H1 and core histories in Leishmania and Crithidia: comparison with Trypanosoma. Exp Cell Res 1996;224:1 – 7. [23] Noll TM, Desponds C, Belli SI, Glaser TA, Fasel NJ. Histone H1 expression varies during the Leishmania major life cycle. Mol Biochem Parasitol 1997;84:215 – 7. [24] Aslund L, Carlsson L, Henriksson J, et al. A gene family encoding heterogeneous histone H1 proteins in Trypanosoma cruzi. Mol Biochem Parasitol 1994;65:317330. [25] Elias MC, Marques-Porto R, Freymuller E, Schenkman S. Transcription rate modulation through the Trypanosoma cruzi life cycle occurs in parallel with changes in nuclear organisation. Mol Biochem Parasitol 2001;112:79 – 90. [26] Acosta-Serrano A, Schenkman S, Yoshida N, Mehlert A, Richardson JM, Ferguson MAJ. The lipid structure of the GPI-anchored mucin-like sialic acid acceptors of Trypanosoma cruzi changes during parasite differentiation from epimastigotes to infective metacyclic trypomastigote forms. J Biol Chem 1995;270:27244 – 53. [27] Shapiro SZ, Doxsey SJ. Purification of nuclei from a flagellate protozoan, Trypanosoma brucei. Anal Biochem 1982;127:112 –5. [28] Burri M, Schlimme W, Betschart B, et al. Partial amino acid sequence and functional aspects of histone H1 proteins in Trypanosoma brucei. Biol Cell 1995;83:23 – 31. [29] Gurley LR, Valdez JG, Buchanan JS. Characterization of the mitotic specific phosphorylation site of histone H1. Absence of a consensus sequence for the p34cdc2/cyclin B kinase. J Biol Chem 1995;270:27653 – 60. [30] Abuin G, Freitas-Junior LHG, Colli W, Alves MJ, Schenkman S. Expression of trans-sialidase and 85 kDa glycoprotein genes in Trypanosoma cruzi is differentially regulated at the post-transcriptional level by labile protein factors. J Biol Chem 1999;274:13041 – 7. [31] Gomez EB, Santori MI, Laria S, et al. Characterization of the Trypanosoma cruzi Cdc2p-related protein kinase 1 and identification of three novel associating cyclins. Mol Biochem Parasitol 2001;113:97 – 108. [32] Grant KM, Hassan P, Anderson JS, Mottram JC. The crk3 gene of Leishmania mexicana encodes a stage-regulated cdc2-related histone H1 kinase that associates with p12. J Biol Chem 10153;273:10159.
