The FASEB Journal express article 10.1096/fj.00-0336fje. Published online November 9, 2000.
HIV induces lymphocyte apoptosis by a p53-initiated, mitochondrial-mediated mechanism Davide Genini,*,†,4 Dennis Sheeter,*,†, 4 Steffney Rought,*,‡ John J. Zaunders, ‡ Santos A. Susin,§ Guido Kroemer,§ Douglas D. Richman,*,‡ Dennis A. Carson,*,† Jacques Corbeil,*,‡, 4 Lorenzo M. Leoni*,†,4 *
Departments of Medicine and †The Sam and Rose Stein Institute for Research on Aging, University of California San Diego, 9500 Gilman Drive, La Jolla, California 92093-0663; ‡San Diego Health Care System and Veterans Medical Research Foundation San Diego, 3350 La Jolla Village Drive, California 92161; and §Centre National de la Recherche Scientifique, UMR1599, Institut Gustave Roussy, 39 rue Camille-Desmoulins, F-94805 Villejuif, France. 4
The first two authors contributed equally to the study; the last two authors share senior authorship. Corresponding author: Lorenzo M. Leoni, Dept. Medicine-0663, University of California, San Diego, 9500 Gilman Drive, La Jolla Calif. 92093-0663. E-mail:
[email protected] ABSTRACT HIV-1 induces apoptosis and leads to CD4+ T-lymphocyte depletion in humans. It is still unclear whether HIV-1 kills infected cells directly or indirectly. To elucidate the mechanisms of HIV-1– induced apoptosis, we infected human CD4+ T cells with HIV-1. Enzymatic analysis with fluorometric substrates showed that caspase 2, 3, and 9 were activated in CD4+ T cells with peak levels 48 h after infection. Immunoblotting analysis confirmed the cleavage of pro-caspase 3 and 9, and of specific caspase substrates. Release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria was observed in HIV-infected cells. The cytochrome c and AIF release preceded the reduction of the mitochondrial transmembrane potential and nuclear chromatin condensation. HIV infection led to phosphorylation of p53 at the Ser15 residue, detectable as early as 24 h after infection. The p53 phosphorylation was followed by increased mRNA and protein expression of p21, Bax, HDM2, and p53. Up-regulation of surface FasL expression, accompanied by a down-regulation of Fas-associated proteins (FADD, DAXX, and RIP), was observed 72 h after infection. Our results suggest that HIV activates the p53 pathway, leading to cytochrome c and AIF release with ensuing caspase activation. Key words: caspases ^)DVOLJDQG^O\PSKRF\WHV^SKRVSKRU\ODWLRQ^F\WRFKURPHF he depletion of CD4+ T lymphocyte is a hallmark of human immunodeficiency virus 1 (HIV-1) infection. Several models have been proposed for this depletion, including apoptosis (1, 2). Recent studies have postulated that CD4+ T cell killing is a direct result of HIV-1 infection of the cell (3) and not an indirect induction of death of uninfected cells through aberrant signaling (4–6). Two main pathways are known to activate programmed cell death: an extrinsic death receptor-activated pathway and an intrinsic mitochondrial-mediated
T
pathway (7). Both pathways lead to the activation of effector enzymes collectively known as caspases (8, 9). Caspases are divided into two groups: The apical caspases (2, 8, 9, 10) initiate the cascade, and the executioner caspases (3, 6, 7) are the effectors, which result in cell and organelle dismantling and endonuclease-mediated DNA cleavage. The activation of the pathway requires interaction between the apical caspases and mediator proteins located at the cytosolic side of the cellular membrane or in the cytosol, leading to the formation of the death-inducing signal complex (DISC) (10), which is then responsible for activating the apoptotic cascade. The extrinsic Fas pathway is important in the regulation of lymphocyte homeostasis (11). The cytoplasmic domain of Fas receptor has no intrinsic activity but contains a death domain for protein interaction. An adaptor protein called FADD (Fas-associated death domain protein) specifically binds it through the death effector domain (DED), recruiting procaspase-8 through a caspase recruitment domain (CARD) and initiating the apoptotic cascade (12, 13). Several other cell-death induction proteins that interact with Fas receptors have been identified, and alternative pathways have been described for the Fas signaling pathway (14, 15). The intrinsic apoptotic pathway often involves damage to mitochondria, release of cytochrome c, and activation of caspase-9. Mitochondrial alterations are triggered by factors that induce apoptosis in peripheral blood lymphocytes (PBL) (16, 17) and consist of an alteration of the inner transmembrane potential and permeabilization of the outer mitochondrial membrane, which leads to the release from the intermembrane space into the cytosol of apoptotic effector proteins, including cytochrome c (7, 18, 19), apoptosis-inducing factor (AIF) (20, 21), and Caspase-2 and 9 (22). Caspase-9 reacts with the cytosolic apoptotic protease activating factor-1 (APAF-1) and, in the presence of dATP and cytochrome c, oligomerizes to form the apoptotic active complex called the apoptosome (23, 24). The apoptosome induces the cleavage of caspase-3. Mitochondrial-mediated apoptosis is regulated by Bcl-2 family proteins, which control the integrity of the mitochondrial membranes, inducing or preventing the release of cytochrome c and AIF (25, 26). The phosphorylation of p53, triggered by DNA damage and the activation of the kinases ATM or DNA-PK, induces the transcriptional activation of different genes related to apoptosis (27, 28). Up-regulation of p53 mRNA expression after HIV-1 infection in lymphocytes has been reported (29). Bax is thought to be involved in p53-induced apoptosis (30). In this study, a time-course of activation of the extrinsic and intrinsic apoptosis pathways after HIV-1 infection of CD4+ T lymphocytes was examined. We demonstrate that the intrinsic mitochondrial pathway of apoptosis is the primary mechanism that induces the killing of CD4+ T cells. Mitochondrial membrane permeabilization may be a consequence of the activation of the p53 pathway. Once phosphorylated, p53 induces up-regulation of Bax, which translocates to the mitochondrial membrane and promotes cytochrome c and AIF release. In contrast, the activation of the Fas/FasL-dependent extrinsic apoptotic pathway appears to be a later event in HIV-1 infection. METHODS
Isolation of PBL-CD4+ cells Three hundred milliliters of blood were drawn from normal healthy individuals. After centrifugation of the blood at 500 g for 15 min at room temperature, peripheral blood mononuclear cells (PBMC) located in the buffy coat fraction were separated from contaminating red blood cells via centrifugation of a Histopaque (Sigma, St. Louis, Mo.)/blood overlay at 500 g for 30 min at RT. After the cells were washed, CD4+ T lymphocytes were isolated by negative selection from approximately 300 x 106 PBL by using the Vario MACS CD4+ Cell Isolation Kit and Depletion Columns (Miltenyi Biotec, Auburn, Calif.) according to the manufacturer’s instructions. The purity of the CD4+ cell fraction (95%) was verified via flow cytometer analysis of anti-OKT3-FITC (Ortho-Diagnostic, Westwood, Mass.) and anti-CD4-Cychrome (Pharmingen, San Diego, Calif.). Cells were then cultured for 48 h in growth medium (RPMI supplemented with 10% fetal bovine serum and antibiotics) containing PHA (2 µg/ml) and infected with HIV-1. HIV infection Primary CD+ T cells were infected with the X4 strain HIV-1LAI (5 x 106 TCID50/ml) at a multiplicity of infection of 0.5 at 37°C in 5% CO2 for 2 h. The cells were washed with PBS (GIBCO/BRL), resuspended in culture medium (RPMI 1640, 10% fetal bovine serum, supplemented with 2 mM glutamine), and incubated at 37°C in 5% CO2; 50 µl of culture supernatant serially diluted was used to quantitate HIV-1 p24 antigen production (Coulter, Fla.). Cell cycle and apoptosis analysis Aliquots of cells (5 x 105) were collected, fixed in ice-cold 30% ethanol/PBS solution overnight, treated with 100 µg/ml of RNAse A, and stained with 50 µg/ml propidium iodide for 1 h at 37°C. The DNA content of the cells was analyzed by flow cytometry (Becton Dickinson FACScalibur), and the cell cycle distribution was determined by using the program ModFit LT 2.0 (Verity Software). Apoptosis was quantified by measuring the percentage of cells in the sub-G0/G1 region. Cytofluorimetric analysis of mitochondrial transmembrane potential (∆Ψm) and Fas ligand expression PBL (1 x 106) cells were incubated for 20 min at 37°C in culture medium that contained 150 nM Mitotracker Orange (Molecular Probe, Eugene, Ore.), washed in PBS, and resuspended in 50 µl PBS containing 3% FBS with 1 µg monoclonal antibody to Fas ligand FITC labeled (Clone H11, Apotech, Switzerland). Cells were incubated 30 min on ice, washed in PBS, and analyzed by flow cytometry. Cellular assay for caspase activity At the indicated time, infected cells were washed twice with PBS, the pellet was re-suspended in caspase buffer (50 mM Hepes, pH 7.4, 100 mM NaCl, 1 mM EDTA, 0.1% Chaps, and 5 mM
dithiothreitol) for 10 min at 4 °C. Lysates were then stored at -80 °C until analyzed. The caspase enzymatic assays were carried out in 96-well plates. Lysates (10–20 µg of total protein) were mixed with 50 µl of HEB buffer (PIPES 50 mM, KCl 20 mM, EGTA 5 mM, MgCl2 2 mM, and DTT 1 mM, pH 7), and reactions were initiated by addition of 100 µM of the respective specific substrates. After 1 h incubation at 37°C, caspase-3-like protease activity was measured with the substrate Ac-DEVD-AMC, caspase-9-like activity by using Ac-LEHD-AFC, caspase-6-like protease activity with the substrate Ac-VEID-AMC, caspase-8-like activity with Ac-IETD-AFC and caspase-2-like activity with Ac-VDVAD-AFC (Calbiochem, San Diego, Calif.). Activity was quantified by the release of 7-amino-4-trifluoromethyl-coumarin (AFC) or 7-amino-4methyl-cumarin (AMC) monitoring fluorescence at excitation and emission wavelengths of 400 and 505 nm, and 380 and 460 nm, respectively on a (Cytofluor 2000, Millipore) fluorometer. Immunoblotting Caspase-3, Caspase- 6, Caspase-9, DAXX, FADD, RIP were measured by immunoblotting. 2–4 x 106 CEM-GFP cells were lysed in 100 µl lysis buffer (25 mM Tris, pH 7.4, 150 mM KCl, 5 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 µg/ml aprotinin, 1 µg/ml leupeptin, 1 mM phenylmethanesulfonyl fluoride, 1 mM sodium orthovanadate, 1 mM sodium fluoride). Lysates were normalized for total protein content by using a modified Coomassie blue assay (Pierce, Rockford, Ill.). Proteins (30 µg per lane) were resolved at 125 V on pre-cast 4–20 and 14% Tris-gly polyacrylamide gels (Novex, San Diego, Calif.) and transferred to 0.2 µm polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, Mass.) for 2 h at 125 V. Membranes were blocked overnight in I-Block blocking buffer (Tropix, Bedford, Mass.). Blots were then probed for 1 h or overnight with specific antibodies to Caspase3 (CPP32, clone 19), FADD (clone 1), RIP (clone 38), all from Transduction Laboratories (Lexington, Ky.); and DAXX, Caspase-6, p53 (clones PAb 1801 and D01), HDM2 (clone SMP14) and p21 (clone SX118), all from Pharmingen (San Diego, Calif.). ATM (monoclonal clone B-12) and DNA-PK were from Santa Cruz Biotech (Santa Cruz, Calif.). X. Wang (University of Texas, South Western Medical School) graciously provided caspase-9; Bax was a gift from J.C. Reed (The Burnham Institute, La Jolla, Calif.). The phosphorylation of p53 at residue Ser-15 was detected by using a phospho-specific antibody (New England Biolabs). In preliminary experiments, we determined that this antibody is very sensitive for detecting DNAdamage-induced p53 phosphorylation in primary lymphocytes treated with anti-cancer drugs (data not shown). The blots were developed with species-specific antisera and visualized by peroxidase-based enhanced chemiluminescence (ECL, Amersham), according to the manufacturer's instructions. Immunocytochemistry Infected cells (105) were stained with 150 nm Mitotracker Orange (Molecular Probes, Ore.) for 30 min at 37°C for the detection of the mitochondrial membrane potential. Cells were cytospun at 300 g for 5 min on a slide, fixed 10 min in 4% paraformaldehyde, washed in PBS, and then incubated for 2 h with anti-AIF (Susin et al. 1999) and anti-cytochrome c (lot 65971A) (Pharmingen, San Diego, Calif.) antibodies, at a concentration of 2–10 µg/ml in I-Block blocking buffer (Tropix, Bedford, Mass.) supplemented with 0.05 % Triton X-100. Alexa 568 (red) species-specific secondary antibodies (Molecular Probes, Ore.) were used to visualize the
proteins. The nuclear DNA was stained by using DAPI. Slides were washed successively in PBS and deionized water for 5 min and mounted in Fluromount (Fisher, Calif.). Images were obtained with a Zeiss Axioscope microscope. PBMCs cells were recognized by staining with anti-human HIV p24 monoclonal antibody (Chemicon International, Inc., Temecula, Calif.). Gene-expression analysis Using the Perkin-Elmer ABI Prism 7700 and Sequence Detection System software, the levels of mRNA were quantified for human p53, HDM2, DAXX, Bax, p21, and GADD45. Total RNA was isolated by using the TRIzol Method (Gibco-BRL) and treated with deoxyribonuclease (Boehringer-Mannheim) to remove any contaminating genomic DNA. A control without RT was used for the efficiency of this process. Total RNA (5 µg) was used to generate cDNA by using a T7-poly dT oligodeoxynucleotide primer (ggc cag tga att gta ata cga ctc act ata ggg agg cgg-T), following the protocol for SuperScript II (Gibco-BRL). cDNA (50 ng) was used in triplicate and amplified with the TaqMan Master Mix supplied by Perkin-Elmer. Amplification efficiencies were validated and normalized against GAPDH and fold increases were calculated by using either the Comparative CT Method for quantitation or by generating a standard curve (Ref: ABI Prism 7700 SDS User Bulletin #2 P/N 4303859 Rev. A). Sequences for primers and probes TaqMan probes (T) were labeled with 5’ FAM and 3’ TAMRA, forward (F) and reverse (R) primers were unlabeled (IDT, Coralville, Iowa). DNA oligo sequences were written 5’ to 3’ as HDM2: follows: F-ctacagggacgccatcgaat; R-tgaatcctgatccaaccaatca; Tcggatcttgatgctggtgtaagtgaacattc; Bax alpha: F-ctgatcagaaccatcatgggc; R-gaggccgtcccaaccac; Ttccgggagcggctgttggg; P21: F-ctggagactctcagggtcgaa; R-cggcgtttggagtggtagaa; Tacggcggcagaccagcatgac; GADD45: F-tctgcagatccacttcaccct; R-gctgacgcgcaggatgtt; TP53: tccaggcgttttgctgcgagaac; F-gcgtgagcgcttcgagat; R-cagcctgggcatccttga; Tccgagagctgaatgaggccttggaa; DAXX: F-cttctccagcccggctgt; R-tggccacacttgtcttgcaa; Tccattcacaggctcctcggcctg. RESULTS Pattern of caspase activity in HIV-1-infected CD4+ T cells Productive HIV infection was monitored in CD4+ T cells by quantification of p24 in culture supernatants with an ELISA-based assay. p24 increased during the course of infection (Fig. 1A). The percentage of cells undergoing apoptosis was quantified by flow-cytometry by measuring the proportion of cells with sub-G1 DNA content and correlated with HIV production (Fig. 1B). Caspase activities were measured at multiple time points after infection by using specific fluorometric substrates (Fig. 2A). The catalytic activity of the apical caspase-2 and -9 increased after two days, concomitantly with the activation of the executioner caspase-3. Activated caspase-6 was detectable only 72 h after infection. No activity of the death-receptor-associated apical caspase-8 was recorded during the 72 h of the experiment.
Caspase enzymatic activities were corroborated by immunoblotting (Fig. 2B). Cleavage of the proform of caspase-3 was observed in all samples, but in HIV-1–treated cells, the ratio of the cleaved and uncleaved pro-caspase product was increased as early as 24 h and remained elevated through 72 h compared with the control. The intensity of the pro-caspase-9 and -6 product was reduced 48 and 72 h after infection. Activation of p53 pathway in HIV-infected cells To study the role of p53 in the initiation of the apoptotic pathway during HIV-1 infection, we measured the total level of p53, and its phosphorylation at residue Ser15, by using a phosphospecific antibody. Peptide-inhibition assays demonstrated its specificity for phosphorylated p53 and its lack of cross-reactivity with the non-phosphorylated forms (data not shown). In primary cells, both total and phosphorylated p53 levels were increased by 24 h after HIV-1 infection. This HIV-triggered phosphorylation of p53 peaked at 48 h and remained detectable through 72 h. After the initial increase, p53 levels returned to control levels by 72 h. Experiments performed by using the cell-permeable caspase inhibitor Z-VAD-fmk confirmed that the HIV-induced p53 phosphorylation was not caspase-dependent (data not shown). To confirm that phosphorylation and induction of p53 resulted in the activation of the p53 pathway, we analyzed the protein and mRNA levels of the p53-induced genes, p21/CIP1/WAF1 (p21), HDM2, and Bax. Both Bax and p21 levels were increased by 48 h after HIV-1 infection and HDM2 by 72 h, as compared with uninfected controls. In addition, HDM2 was cleaved, probably by caspases. p53 phosphorylation warranted an analysis of the expression level of two of the kinases that have been shown to phosphorylate p53 upon DNA damage: DNA-dependent protein kinase (DNA-PK) and ataxia-telangiectasia-mutated kinase (ATM). The protein level of DNA-PK decreased 24 h after infection and remained low through 72 h compared with the uninfected control. ATM was modulated similarly (Fig. 3A). Quantitative gene expression analysis with real-time RT-PCR confirmed the up-regulation of the mRNA levels of the p53-inducible genes Bax, p21, HDM2, and GADD45, corroborating the hypothesis of a p53-induced transcriptional activation induced by HIV (Fig. 3B). Furthermore, mRNA levels for ATM and DNA-PK were reduced after HIV infection, which validated the results obtained by immunoblotting (data not shown). HIV infection induced the downregulation at the transcriptional level of these two p53-phosphorylating kinases. Cytochrome c and AIF release occur prior to membrane potential alteration in HIV-1– infected CD4+ T cells Release of cytochrome c and AIF from mitochondria in the cells is characteristic of p53dependent apoptosis (27). We used a cell line to facilitate the immunofluorescence analysis of mitochondrial components. CEM-GFP cells are a CD4+ lymphoblastoid T cell line modified to express the green fluorescent protein (by coupling it to the HIV-LTR as a promoter) upon productive HIV-1 infection (31). When infected by HIV, this cell line undergoes characteristic changes, including cell cycle arrest in G2/M, apoptosis, and high levels of virion production. We performed with the CEM-GFP the same assays described with the human primary CD4+ T lymphocytes, and obtained similar results, including an identical pattern of caspase enzymatic
activation (data not shown). The fluorescence microscopy analysis of CEM-GFP demonstrated that HIV-1 infection led to the reduction of the mitochondrial transmembrane potential (Fig 4A, B) and to the release of the mitochondrial pro-apoptotic proteins cytochrome c and AIF. The HIV-1–infected cells, tracked by GFP expression, lost the punctuating cytochrome c staining typical of mitochondrial compartmentalization (Fig 4C, D), which suggests cytochrome c release. Finally, a similar staining pattern was observed when cells were probed with anti-AIF antibodies. The HIV-1–infected GFP+ cells displayed a diffuse cytoplasmic AIF staining, with some staining of the nuclear compartment. In the control cells, the AIF localize primarily in mitochondria (Fig. 4E, F). Alteration of mitochondrial transmembrane potential (∆Ψm) monitored by using Mitotracker-Orange was first detectable at 72 h after infection (Fig. 5A), well after cytochrome c and AIF release and caspase activation. This finding suggests either that alteration of the ∆Ψm is a late event in HIV-induced apoptosis or that the ∆Ψm assay, based on the fluorescence of MT-orange in fixed cells, lacks sensitivity to detect early alterations concomitant with cytochrome c and AIF release. Modulation of the Fas-signaling pathway in primary cells after HIV-1 infection In primary cells, the protein level of Fas receptor and of Fas ligand was not modulated by HIV infection (data not shown), but the expression of surface Fas ligand measured by flow cytometry increased significantly at 72 h (Fig. 5A). The expressions of signaling proteins potentially involved in the induction of apoptosis were tested by immunoblotting. The protein levels of DAXX, a Fas receptor binding protein involved in the induction of Fas-dependent apoptosis and activation of Jun N-terminal kinase (JNK) (14), FADD [a Fas-associated death domain protein (10, 12)], and RIP [a deat domain-containing protein that interacts with Fas/APO1 and causes cell death (15, 32, 33)], had reduced expression late in the process of infection (Fig. 5B). DISCUSSION Numerous mechanisms have been proposed to explain CD4+ T lymphocyte depletion in HIV-1 infection (34, 35). Apoptosis or dysregulation of apoptosis was proposed as a possible mechanism for this phenomenon (1, 2). Currently, two distinct pathways of apoptosis are recognized: an extrinsic pathway involving Fas-ligand binding to Fas receptor and an intrinsic pathway involving mitochondria. We found that both pathways eventually were activated after HIV-1 infection, but the intrinsic mitochondrial pathway was activated first. Consistent with these data, caspase inhibitors were found to block HIV-1 induced apoptosis in the H9 human T cell line, whereas Fas antagonists were ineffective (36). In our studies, caspase-9 activation occurred concomitantly with expression of the HIV core protein p24, initiated 24 h after infection. The peak of activation was reached at 48 h, when the infected cells released cytochrome c and AIF. Moreover, detectable alteration of mitochondrial membrane potential was demonstrated to be a late event (72 h). Previous studies have shown that cytochrome c release and mitochondrial membrane potential depolarization can be distinct and separate events in apoptosis (19). We observed initial activation of the effector caspase-3 and the apical caspase-2 48 h after infection, well after caspase 9-activation. Insofar as activation of p53 can trigger apoptosis through the intrinsic (37), we tested the status of p53 in HIV-1–infected of primary CD4+ T cells and observed phosphorylation and an increase
in the total amount of p53 at 24 h after infection. p53 is constitutively expressed in cells, and is exported from the nucleus to the cytoplasm after binding to HDM2, an ubiquitinase-like enzyme that targets p53 for degradation (28). Induction of DNA damage induces phosphorylation of p53 and thereby reduces its affinity for HDM2, inhibiting its export from the nucleus to the proteasome and consequently causing an increase in total p53 (38). Phosphorylated p53 induces transcriptional activation of numerous genes, which leads to cell cycle arrest or apoptosis. The pro-apoptotic Bcl-2 family member, Bax, is a candidate for p53 activation (27). As early as 24 h after HIV infection, p53 phosphorylation increased, at which time Bax levels were also elevated. The increased Bax may be responsible for the release of cytochrome c, leading to caspase activation. We have showed by high-density microarray gene expression analysis (Genechips) that the mRNA levels for a number of mitochondrial proteins declined in CEM cells during HIV infection (unpublished results). Integration of HIV-1 into the genome induces DNA strand breaks (39). This type of damage is quickly repaired in normal cells, but HIV-1 infection down-regulates both DNA-PK and ATM, two kinases essential for initiating DNA repair (40, 41). Viral inhibition of other enzymes involved in RNA and protein synthesis may further impair DNA excision-repair, leading to p53 activation. Fas ligand was expressed in HIV-1–infected cells as a late event. However, the Fas-binding proteins FADD, DAXX, and RIP were all down-regulated. The latter effects would be expected to inhibit FasL-Fas–induced apoptosis. Even though patients with HIV-1 infection have higher Fas-expression than uninfected people (42), in our experimental system we did not observe upregulation of Fas receptor. Moreover, the killing of CD4+ T lymphocyte occurs via a Fasindependent mechanism (3, 43). However, it is possible that Fas-ligand might play a role in the depletion of non-infected bystander cells and CD8+ T cells by up-regulating caspase-8 (44). We propose the following model for CD4+ T lymphocyte depletion induced by HIV-1 infection (Fig. 6). The virus enters the cell, viral mRNA is reverse-transcribed to DNA and integrated into host genomic DNA. The integrase initially induces DNA breaks, which are not repaired efficiently due to down-regulation of DNA-PK and ATM, as well as by the general suppression of gene-expression of the host cell. Subsequent p53 phosphorylation induces transcriptional activation of Bax, triggering cytochrome c and AIF release and activation of the intrinsic caspase cascade. This action culminates in the demise of the infected CD4+ T cells. ACKNOWLEDGMENTS This work was supported in part by grant GM23200 from the National Institutes of Health and the Universitywide AIDS Research Program (LL); by grant AI46237, the Center for AIDS Research Genomics Core Laboratory (Christine Plotkin and Pinyi Du) from the NIH, the Universitywide AIDS Research Program and the San Diego Veterans Medical Research Foundation (J.C.); by a grant from the Agence pour la Recherche sur le SIDA (to G.K. and S.A.S.), and by grants AI27670, AI38858, AI43638 and the Research Center for AIDS and HIV Infection of the San Diego Veterans Affairs Healthcare System (DDR). REFERENCES
1.
2.
3.
4.
5. 6. 7. 8.
9. 10.
11. 12.
13.
14. 15.
16.
17.
Terai, C., Kornbluth, R. S., Pauza, C. D., Richman, D. D., and Carson, D. A. (1991) Apoptosis as a mechanism of cell death in cultured T lymphoblasts acutely infected with HIV-1. J. Clin. Invest. 87, 1710–1715 Laurent-Crawford, A. G., Krust, B., Muller, S., Riviere, Y., Rey-Cuille, M. A., Bechet, J. M., Montagnier, L., and Hovanessian, A. G. (1991) The cytopathic effect of HIV is associated with apoptosis. Virology 185, 829–839 Gandhi, R. T., Chen, B. K., Straus, S. E., Dale, J. K., Lenardo, M. J., and Baltimore, D. (1998) HIV-1 directly kills CD4+ T cells by a Fas-independent mechanism. J. Exp. Med. 187, 1113–1122 Banda, N. K., Bernier, J., Kurahara, D. K., Kurrle, R., Haigwood, N., Sekaly, R. P., and Finkel, T. H. (1992) Crosslinking CD4 by human immunodeficiency virus gp120 primes T cells for activation-induced apoptosis. J. Exp. Med. 176, 1099–1106 Levy, J. A. (1993) Pathogenesis of human immunodeficiency virus infection. Microbiol Rev. 57, 183–289 Li, C. J., Friedman, D. J., Wang, C., Metelev, V., and Pardee, A. B. (1995) Induction of apoptosis in uninfected lymphocytes by HIV-1 Tat protein. Science 268, 429–431 Green, D. R., and Reed, J. C. (1998) Mitochondria and apoptosis. Science 281, 1309– 1312 Miura, M., Zhu, H., Rotello, R., Hartwieg, E. A., and Yuan, J. (1993) Induction of apoptosis in fibroblasts by IL-1 beta-converting enzyme, a mammalian homolog of the C. elegans cell death gene ced-3. Cell 75, 653–660 Martin, S. J., and Green, D. R. (1995) Protease activation during apoptosis: death by a thousand cuts? Cell 82, 349–352 Kischkel, F. C., Hellbardt, S., Behrmann, I., Germer, M., Pawlita, M., Krammer, P. H., and Peter, M. E. (1995) Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. Embo. J. 14, 5579– 5588 Nagata, S. (1997) Apoptosis by death factor. Cell 88, 355–365 Chinnaiyan, A. M., O'Rourke, K., Tewari, M., and Dixit, V. M. (1995) FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81, 505–512 Boldin, M. P., Varfolomeev, E. E., Pancer, Z., Mett, I. L., Camonis, J. H., and Wallach, D. (1995) A novel protein that interacts with the death domain of Fas/APO1 contains a sequence motif related to the death domain. J. Biol. Chem. 270, 7795–7798 Yang, X., Khosravi-Far, R., Chang, H. Y., and Baltimore, D. (1997) Daxx, a novel Fasbinding protein that activates JNK and apoptosis. Cell 89, 1067–1076 Stanger, B. Z., Leder, P., Lee, T. H., Kim, E., and Seed, B. (1995) RIP: a novel protein containing a death domain that interacts with Fas/APO-1 (CD95) in yeast and causes cell death. Cell 81, 513–523 Cossarizza, A., Mussini, C., Mongiardo, N., Borghi, V., Sabbatini, A., De Rienzo, B., and Franceschi, C. (1997) Mitochondria alterations and dramatic tendency to undergo apoptosis in peripheral blood lymphocytes during acute HIV syndrome. Aids 11, 19–26 Castedo, M., Macho, A., Zamzami, N., Hirsch, T., Marchetti, P., Uriel, J., and Kroemer, G. (1995) Mitochondrial perturbations define lymphocytes undergoing apoptotic depletion in vivo. Eur. J. Immunol. 25, 3277–3284
18. 19.
20.
21.
22.
23.
24.
25.
26.
27. 28. 29.
30. 31.
32.
33.
Susin, S. A., Zamzami, N., and Kroemer, G. (1998) Mitochondria as regulators of apoptosis: doubt no more. Biochim. Biophys. Acta 1366, 151–165 Bossy-Wetzel, E., Newmeyer, D. D., and Green, D. R. (1998) Mitochondrial cytochrome c release in apoptosis occurs upstream of DEVD- specific caspase activation and independently of mitochondrial transmembrane depolarization. Embo. J. 17, 37–49 Lorenzo, H. K., Susin, S. A., Penninger, J., and Kroemer, G. (1999) Apoptosis inducing factor (AIF): a phylogenetically old, caspase- independent effector of cell death. Cell Death Differ. 6, 516–524 Susin, S. A., Lorenzo, H. K., Zamzami, N., Marzo, I., Snow, B. E., Brothers, G. M., Mangion, J., Jacotot, E., Costantini, P., Loeffler, M., Larochette, N., Goodlett, D. R., Aebersold, R., Siderovski, D. P., Penninger, J. M., and Kroemer, G. (1999) Molecular characterization of mitochondrial apoptosis-inducing factor [see comments]. Nature 397, 441–446 Susin, S. A., Lorenzo, H. K., Zamzami, N., Marzo, I., Brenner, C., Larochette, N., Prevost, M. C., Alzari, P. M., and Kroemer, G. (1999) Mitochondrial release of caspase-2 and -9 during the apoptotic process. J. Exp. Med. 189, 381–394 Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S. M., Ahmad, M., Alnemri, E. S., and Wang, X. (1997) Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91, 479–489 Zou, H., Henzel, W. J., Liu, X., Lutschg, A., and Wang, X. (1997) Apaf-1, a human protein homologous to C. elegans CED-4, participates in cytochrome c-dependent activation of caspase-3 [see comments]. Cell 90, 405–413 Yang, J., Liu, X., Bhalla, K., Kim, C. N., Ibrado, A. M., Cai, J., Peng, T. I., Jones, D. P., and Wang, X. (1997) Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked [see comments]. Science 275, 1129–1132 Kluck, R. M., Bossy-Wetzel, E., Green, D. R., and Newmeyer, D. D. (1997) The release of cytochrome c from mitochondria: a primary site for Bcl-2 regulation of apoptosis [see comments]. Science 275, 1132–1136 Evan, G., and Littlewood, T. (1998) A matter of life and cell death. Science 281, 1317– 1322 Freedman, D. A., and Levine, A. J. (1998) Nuclear export is required for degradation of endogenous p53 by MDM2 and human papillomavirus E6. Mol. Cell Biol. 18, 7288–7293 McLinden, R. J., Lewis, B., Michael, N. L., Redfield, R. R., Birx, D. L., and Kim, J. H. (1997) Correlation of tumor suppressor P53 RNA expression with human immunodeficiency virus disease in rapid and slow progressors. J. Hum. Virol. 1, 30–36 Brady, H. J., and Gil-Gomez, G. (1998) Bax. The pro-apoptotic Bcl-2 family member, Bax. Int. J. Biochem. Cell Biol. 30, 647–650 Gervaix, A., West, D., Leoni, L. M., Richman, D. D., Wong-Staal, F., and Corbeil, J. (1997) A new reporter cell line to monitor HIV infection and drug susceptibility in vitro. Proc. Natl. Acad. Sci USA 94, 4653–4658 Ting, A. T., Pimentel-Muinos, F. X., and Seed, B. (1996) RIP mediates tumor necrosis factor receptor 1 activation of NF-kappaB but not Fas/APO-1-initiated apoptosis. Embo. J. 15, 6189–6196 Grimm, S., Stanger, B. Z., and Leder, P. (1996) RIP and FADD: two "death domain"containing proteins can induce apoptosis by convergent, but dissociable, pathways. Proc. Natl. Acad. Sci. USA 93, 10923–10927
34.
35.
36.
37. 38. 39. 40. 41. 42.
43.
44.
Lahdevirta, J., Maury, C. P., Teppo, A. M., and Repo, H. (1988) Elevated levels of circulating cachectin/tumor necrosis factor in patients with acquired immunodeficiency syndrome. Am. J. Med. 85, 289–291 Westendorp, M. O., Frank, R., Ochsenbauer, C., Stricker, K., Dhein, J., Walczak, H., Debatin, K. M., and Krammer, P. H. (1995) Sensitization of T cells to CD95-mediated apoptosis by HIV-1 Tat and gp120. Nature 375, 497–500 Glynn, J. M., McElligott, D. L., and Mosier, D. E. (1996) Apoptosis induced by HIV infection in H9 T cells is blocked by ICE- family protease inhibition but not by a Fas(CD95) antagonist. J. Immunol. 157, 2754–2758 Lowe, S. W. (1999) p53, Apoptosis, and Chemosensitivity. In Apoptosis and Cancer Chemotherapy (Hickman, J. A., and Dive, C., eds), Humana Press: Towota, N.J. Shieh, S. Y., Ikeda, M., Taya, Y., and Prives, C. (1997) DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2. Cell 91, 325–334 Daniel, R., Katz, R. A., and Skalka, A. M. (1999) A role for DNA-PK in retroviral DNA integration. Science 284, 644–647 Rotman, G., and Shiloh, Y. (1999) ATM: a mediator of multiple responses to genotoxic stress. Oncogene 18, 6135–6144 Featherstone, C., and Jackson, S. P. (1999) DNA double-strand break repair. Curr Biol 9, R759–761 Debatin, K. M., Fahrig-Faissner, A., Enenkel-Stoodt, S., Kreuz, W., Benner, A., and Krammer, P. H. (1994) High expression of APO-1 (CD95) on T lymphocytes from human immunodeficiency virus-1-infected children [letter]. Blood 83, 3101–3103 Noraz, N., Gozlan, J., Corbeil, J., Brunner, T., and Spector, S. A. (1997) HIV-induced apoptosis of activated primary CD4+ T lymphocytes is not mediated by Fas-Fas ligand. Aids 11, 1671–1680 Bartz, S. R., and Emerman, M. (1999) Human immunodeficiency virus type 1 Tat induces apoptosis and increases sensitivity to apoptotic signals by up-regulating FLICE/caspase-8. J. Virol. 73, 1956–1963 Received May 19, 2000; revised September 19, 2000.
Fig. 1
Figure 1. HIV-1 infection of CD4+ T cells and induction of apoptosis. Vario MACS isolated human CD4+ T cells were infected at a multiplicity of infection of 0.5 at 37°C in 5 % CO2 for 2 h. (A) Supernatants were used for measurement of the production of HIV-1 p24 by antigen capture ELISA assay. (B) Apoptosis was quantified by DNA content analysis, measuring the percentage of cells with hypodiploid DNA content in control uninfected cells ( -infected cells (
Fig. 2
Figure 2. Caspase activation in HIV-1 infected cells. At the indicated time points, 2 x 106 PBL were washed with PBS and lysed in Caspase Buffer. (A) Caspase activity of 10–20 µg of total protein was measured with specific substrates for caspase-2 (), 6 (), 8 () and 9 () (100 µM) after 1 h of incubation at 37°C. The cleavage of the fluorometric AMC/AFC was monitored fluorometrically at 400/380 nm excitation and 505/460 nm emission. Activity is represented in relative units to the control without HIV. (B) Immunoblot analysis was performed on total cell lysates of 5 x 106 cells in 100 µl lysing buffer at the indicated time points (24, 48, and 72 h). The protein concentration was quantified by Coomassie blue assay. Cell extract (30 µg per lane) was resolved by SDS-PAGE on 8%–20% gels and transferred on PVDF membranes. The indicated antibodies were visualized by enhanced chemiluminescence (ECL). The data shown are representative of three independent experiments.
Fig. 3
Figure 3. Activation of the p53-pathway by HIV-1 infection. (A) Immunoblot analysis was performed on total cell lysates of 5 x 106 cells in 100 µl lysing buffer as described for Figure 2. The same membranes were stripped and reblotted with specific antibodies, including a tubulin antibody that served as a control for loading. (B) Expression of mRNA of p53-inducible genes was quantified by real-time kinetic RT-PCR at 48 h. The results shown represent two independent experiments.
Fig. 4
Figure 4. Re-localization of mitochondrial proteins in CD4+ T lymphocytes infected with HIV-1. CEM-GFP cells were infected and cultured for 48 h. Cells were incubated for 30 min with Mitotracker Orange at a final concentration 150 nm; 2 x 104 cells were then cytospun at 300 g for 5 min on a slide and then fixed for 10 min in 4% paraformaldehyde. AIF and cytochrome c antibodies were used to stain for 2 h with the primary antibodies and washed following incubation for 1 h with the secondary Alexa-conjugated antibodies. Nuclear DNA (left panels in figure) was stained by using DAPI. HIV-1 infected CEM-GFP cells are green due to GFP expression. Control cultured cells do not express GFP. A composite picture displays DAPI stain of the nuclei, red stain of the mitochondria membrane potential intensity, stained with Mitotracker Orange, and green stain of the infection (A), whereas a picture of the membrane potential only is represented in (B). Cells were stained for cytochrome c (C, D) and AIF (E, F). Micrographs (600×) (were obtained with a Zeiss Axioscope microscope.
Fig. 5
Fas pathway regulation by HIV-1 infection. Human primary CD4+ cells were infected, as previously Figure 5. described, and at the indicated time points were incubated for 10 minutes at 37°C in 50 µl culture medium containing 150 nM Mitotracker Orange and 1 µg monoclonal antibody anti-Fas ligand FITC-labeled. Cells were fixed in ice-cold 30% ethanol PBS and analyzed by flow cytometry (A). Upper panels represent the Fas ligand expression on the surface of the cells for control in red and for HIV-1 infected cells in blue. The percentage of cells expressing Fas ligand is shown. Lower panels show the status of the membrane potential of mitochondria detected with incorporation of Mitotracker for control (red) and infected cells (blue). Values shown represent the mean fluorescence intensity. Cells were also probed by immunoblotting for DAXX, FADD and RIP (B).
Fig. 6
Figure 6. Model of HIV-1-induced apoptosis. HIV-1 enters the cell, and its genome is reverse transcribed and integrated into host DNA. Less than 24 h after infection, phosphorylation of p53 at residue Ser15 is observed. This p53 phosphorylation leads to its transcriptional activation, either by increasing its protein level or by a conformational modification. The activation of the p53 pathway increases the expression of the protein Bax. Bax multimerizes and generates pores in the mitochondrial membranes, and allows the release of the pro-apoptotic proteins cytochrome c and apoptosis-inducing factor (AIF). The released cytochrome c will bind to apaf-1 and, in presence of dATP, sequester and activate caspase-9 and caspase-3 leading to activation of the caspase proteolytic cascade resulting in apoptosis. The released AIF will localize to the nucleus and promote chromatin condensation.
