hMCP - The Journal of Immunology

IFN-g Induction of the Human Monocyte Chemoattractant Protein (hMCP)-1 Gene in Astrocytoma Cells: Functional Interaction Between an IFN-g-Activated Site and a GC-Rich Element1 Z-H Lucy Zhou,* Priya Chaturvedi,* Yu-long Han,* Sumer Aras,* Yi-shuan Li,‡ Pappachan E. Kolattukudy,‡ Dongsheng Ping,§ Jeremy M. Boss,§ and Richard M. Ransohoff*2† We characterized regulation of the human monocyte chemoattractant protein-1 (hMCP-1) gene by IFN-g in astrocytoma cells, because astroglial cells express chemokines in several central nervous system inflammatory states. It was found that IFN-ginduced hMCP-1 transcription was rapid, transient, and mediated by a 213-bp promoter-proximal regulatory region of the gene. Our studies on both in vitro and in vivo states of the hMCP-1 regulatory region established requirement of an IFN-g-activated site (GAS) and the presence of IFN-g-inducible GAS-binding activity involving at least STAT-1a for IFN-g-induced hMCP-1 expression. Unexpectedly, in vivo genomic footprinting of the proximal regulatory region of the IFN-g-induced gene revealed protection of a GC-rich sequence (GC box) with the same temporal pattern as that seen at the GAS; in vitro, this GC-rich element is associated with nuclear factor Sp1. These observations suggested a cooperative interaction between the GAS and the GC box element. Interestingly, site-specific mutations that abolished GC-box or GAS-element function produced clearly disparate results. Disruption of the GC box did not affect fold induction by IFN-g but reduced promoter-reporter expression by half. Conversely, GAS mutation abrogated induction but did not affect the magnitude of expression. These results establish the importance of the GAS element for induction of hMCP-1 and further our understanding of IFN-g-mediated transcriptional induction by providing the first evidence in vivo for inducible signaling to the GC box by this cytokine. The Journal of Immunology, 1998, 160: 3908 –3916.

S

ignal transducers and activators of transcription (STATs), latent cytosolic transcription factors, are essential signaling molecules in cytokine-mediated gene stimulation. Upon activation by tyrosine phosphorylation, the STATs homo- or heterodimerize, translocate to the nucleus, bind to specific DNA palindromic sequences, and activate transcription of target genes (1– 4). Much is known about activation of STATs and the requirement of this event for transcriptional responses to IFNs. It remains to be defined fully, however, how STAT activation is coupled to transcription of target genes or how STATs determine gene-specific or cell type-specific patterns of transcriptional activation. IFN-g is a T cell-secreted proimflammatory cytokine important for leukocyte recruitment and endothelial activation in inflammation. Within target tissues, IFN-g induces expression of chemo-

*Department of Neurosciences, Research Institute, and †Department of Neurology and The Mellen Center for Multiple Sclerosis Treatment and Research, Cleveland Clinic Foundation, Cleveland, OH 44195; ‡Medical Biochemistry and Neurobiotechnology Center, The Ohio State University, Columbus, OH 43210; and §Department of Microbiology and Immunology, Emory University School of Medicine, Atlanta, GA 30322 Received for publication September 8, 1997. Accepted for publication December 19, 1997. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported by National Institutes of Health Grants NS32151 and CA62220 (to R.M.R.), American Heart Association of Northeast Ohio Affiliate Fellowship Award 96-355-F (to Z.-H.L.Z.), and the Williams Family Fund for Multiple Sclerosis Research. 2 Address correspondence and reprint requests to Dr. Richard M. Ransohoff, Department of Neurosciences, Research Institute, Cleveland Clinic Foundation, Cleveland, OH 44195.

Copyright © 1998 by The American Association of Immunologists

kines, further enhancing endothelial adhesiveness for leukocytes and providing signals for leukocyte extravasation and tissue invasion. The diverse functions of IFN-g are mediated through an intracellular signaling mechanism termed the Janus-protein tyrosine kinase (JAK)3-STAT pathway. Specifically, binding of IFN-g to its receptor leads to oligomerization of the receptor and the rapid phosphorylation of JAK1 and JAK2 tyrosine kinases and the receptor a-chain, which forms a specific docking site for the SH2 domain of STAT-1a (5, 6). Phosphorylated STAT-1a monomers assemble in a homodimeric complex, accumulate in the nucleus, and bind to a palindromic DNA motif, the IFN-g-activated site (GAS), the consensus sequence of which is TTNCNNNAA (7, 8). Although the notion that a single STAT-1a dimer bound to a single GAS element is sufficient to activate transcription may still be valid for many genes, recent studies in many laboratories point to another level of specificity and complexity in STAT-1a-regulated transcriptional activation. As indicated by Xu et al. (9), specificity of gene activation can be achieved through cooperative binding of STAT-1a to several adjacent consensus sites. Guyer et al. (10) have shown that IFN-g activates a novel factor called gRF-1, which binds to an imperfect tandem GAS palindrome in the 59flanking region of the mig gene. This gRF-1 consists of at least STAT-1a and a 130-kDa protein. Protein-protein interactions can also occur between STAT1 and other nuclear factors. Myeloid 3 Abbreviations used in this paper: JAK, Janus protein tyrosine kinase; MCP, monocyte chemoattractant protein; hMCP, human MCP; mMCP, murine MCP; GAS, IFNg-activated site; Sp-1, nuclear factor Sp1; GC box, GC-rich sequence; TRE, 12-otetradecanoylphorbol 13-acetate-response element; Ap-1, activator protein-1; CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility shift assay; IVGF, in vivo genomic footprinting. CNS, central nervous system; DMS, dimethyl sulfate.

0022-1767/98/$02.00

The Journal of Immunology cell-restricted induction by IFN-g of the gene encoding the human high-affinity Fcg receptor (FcgR1) requires the cooperation of STAT-1a and a B cell- and myeloid cell-specific factor, PU.1/Spi-1 (11). Recently, it was reported that induction by IFN-g-mediated trans-activation of the ICAM-1 gene depended on interaction of STAT-1a with another transcriptional activator, nuclear factor Sp1 (Sp-1; Ref. 12). Specifically, the functional significance of STAT-1a and Sp-1 binding sites for IFN-g-responsiveness of the ICAM-1 gene was evaluated using promoter/luciferase-reporter constructs in transient transfection assays. Mutations that eliminated binding activities to either site abolished IFN-g responsiveness of the promoter. Interestingly, the trans-activation domain of Sp-1 in the context of a Gal4/Sp-1 fusion protein functioned fully for driving IFN-g-mediated transcription of a synthetic promoter containing ICAM-1 59-flanking sequence with a Gal4 binding site in place of the Sp-1 binding site. This result raised the possibility that the trans-activation domain of Sp-1 was sufficient for functional interaction between the two transcription factors. STAT-1a and Sp-1 were coimmunoprecipitated from cell lysates; the significance of this result was uncertain, because the interaction was only partially activation dependent. Monocyte chemoattractant proteins (MCP), members of the chemokine b subfamily, are implicated in wound healing, the pathogenesis of atherosclerosis, immune and inflammatory responses, and modulation of tumor immunity (13, 14). Four human MCP (hMCP) have been identified and share ;65% amino acid identity (hMCP-1, -2, -3, and -4) (15, 16). Recent work from the laboratories of A.D. Luster (17) and J.C. Gutierrez-Ramos (18) sheds unexpected light on the structure and function of hMCP-1. They have independently identified a novel chemokine named murine MCP-5 (mMCP-5), which exhibits high sequence homology to hMCP-1. The mature mMCP-5 protein is 66% identical to the mature hMCP-1 protein, while JE, another murine homologue of hMCP-1, is 55% identical to hMCP-1. Functional studies revealed that mMCP-5 and hMCP-1 were more potent agonists of the hMCP-1 receptor (CCR2b) than was JE, with mMCP-5 a full agonist for CCR2b. hMCP-1 appears likely to be the functional equivalent of the JE gene product during various inflammatory responses in vivo, given that hMCP-1 and the JE gene products are widely and abundantly expressed following varied immune, traumatic, and toxic insults to nervous system and other tissues (19 –23). JE was the first MCP-1 gene cloned (24), and its transcriptional regulation by mediators including platelet-derived growth factor and TNF-a have been characterized extensively. Both TNF-a and phorbol esters are potent inducers of hMCP-1 expression in various cell types (25, 26). Transient transfection experiments with hMCP-1 promoter constructs indicated that two distal kB sites (27) are important for TNF-a-mediated induction, and two proximal activator protein-1 (AP-1) sites (25, 28) for TPA-induced enhancer activity, respectively. A GC box between bp 64 and 59 was found necessary for the maintenance of basal transcription activity (27). IFN-g selectively induces expression of MCP-1 in mesenchymal and epithelial cells (29, 30). Dexamethasone, an antiinflammatory agent, on the other hand, significantly down-regulates MCP-1 transcript levels (31). In vivo, MCP-1 is expressed by astrocytes in both immune-mediated and posttraumatic inflammation of the central nervous system (CNS), and mechanisms that govern MCP-1 expression in astrocytes have not been defined. To address this issue, we established a tissue-culture model of astrocyte lineage-specific expression of hMCP-1 and used this system to address IFN-g-mediated hMCP-1 stimulation. Our results indicate that IFN-g induces hMCP-1 transcription in human astrocy-

3909 toma cells in rapid, transient fashion. IFN-g-induced hMCP-1 transcription is mediated by a 213-bp promoter-proximal regulatory region of the gene. Studies on both in vitro and in vivo states of this regulatory region of the hMCP-1 gene before and during exposure to IFN-g provide documentation of the requirement of a GAS and STAT-1a for IFN-g-induced hMCP-1 expression. In vivo genomic footprinting (IVGF) of the IFN-g-induced gene further demonstrated IFN-g-inducible occupancy of a GC box that was shown in vitro to bind specifically to Sp-1. Site-specific mutations in the GAS element abrogated IFN-g hMCP-1 induction, while disruption of the GC box reduced the efficiency of promoterreporter expression. Our results provide insight into the mechanism of IFN-g action toward the hMCP-1 gene, which requires cooperativity between a GAS element and a GC box for optimal expression.

Materials and Methods Cell culture The CRT astrocytoma cell line, as previously described (32), was derived from a grade IV human astrocytoma and is .60% glial fibrillary acidic protein (GFAP) positive. Experiments reported here were done between passages 20 and 40. CRT cells were routinely maintained in RPMI 1640, supplemented with 2 mM L-glutamine and 10% FBS (complete medium; Life Technologies, Grand Island, NY). The CRT cell line has been extensively characterized as a model system for analyzing cytokine regulation of gene expression in human astrocytic cells (33, 34).

Reagents Purified human recombinant IFN-g (1.9 3 107 U/mg protein) was generously provided by Genentech (South San Francisco, CA). Polybrene (hexadimethrine bromide) and DMSO were purchased from Sigma Chemical Co. (St. Louis, MO).

Promoter construction and PCR-mediated mutagenesis The construction of the expression plasmid, pMCP-1(3.5)chloramphenicol acetyltransferase (CAT), was detailed by Li and Kolattukudy (28): the putative promoter region of the hMCP-1 gene was amplified by PCR using the cloned hMCP-1 gene (25) as a template. A 486-bp fragment of 59flanking sequence, including the transcription start site, was subcloned into the HindIII/XbaI site of pCAT-basic (Promega, Madison, WI) to generate pMCP-1(486)CAT. An additional 3-kb HindIII fragment of immediately contiguous upstream sequence was then subcloned into the HindIII site of pMCP-1(486)CAT in the appropriate orientation to generate pMCP1(3.5)CAT. A serial deletion of the 59 region was done by ExoIII digestion from the 2378-bp PstI site upstream of the transcription start site (28) to obtain pMCP-1(349)CAT, pMCP-1(292)CAT, pMCP-1(213)CAT, and pMCP-1(147)CAT. pCAT-basic is a promoterless expression vector. A 213-bp fragment with 59-HindIII- and 39-NcoI-sites was also generated from pMCP-1(213)CAT DNA by PCR, using 59-CCTTAAGCTTTTCCT GGAAATCCACAGGATGC-39 and 59-GCGTCTTCCATGGTGGCTT TCTAGAGGCGAGAGTGCGAG-39 as forward and backward primers, respectively. The fragment was excised with HindIII and NcoI and subcloned into the promoterless pGL3-basic vector (Promega) via HindIII/ NcoI sites to generate pGL3-213. Site-directed mutagenesis of GAS and GC box to abolish binding activities of STAT1a and Sp-1 was achieved by PCR-mediated mutagenesis as detailed by Aiyar et al. (35), using pGL3–213 as a template and corresponding primers containing mutated nucleotides. The primers used to make GAS mutant pGL3-mGAS were 59-CCTTAAGCTTTGCATG GCAATCCAC-39 (forward primer, with GAS consensus underlined and mutagenized nucleotides in bold) and 59-GCGTCTTCCATGGTGGCTT TCTAGAGGCGAGAGTGCGAG-39 (backward primer). The PCR product was then digested with HindIII/NcoI and subcloned into pGL3-basic vector via HindIII/NcoI sites to generate a full-length GAS-mutagenized 213-bp fragment. Three rounds of PCR using two sets of primers were performed to obtain GC box mutant PGL3-mGC. The first pair of primers comprised 59-CCTTAAGCTTTTCCTGGAAATCCACAGGATGC-39 and 59-AGGGAGAGAGCTCGGAGTCAAGCAGGAGG-39, with the GC box consensus underlined and mutagenized nucleotides in bold. The second pair was made up of 59-CCTCCTGCTTGACTCCGAGCTCTCTCCC-39 and 59-GCGTCTTCCATGGTGGCTTT-CTAGAGGCGAGAGTGC GAG, with the GC box consensus underlined and mutagenized nucleotides in bold. The first two rounds of PCR produced two PCR products, with 20

IFN-g REGULATION OF hMCP-1 TRANSCRIPTION

3910 bp of overlap covering the entire GC box motif. These two products were gel purified and used as the templates for a third round of PCR with 59CCTTAAGCTTTTCCTGGAAATCCACAGGATGC-39 and 59-GCGTC TTCCATGGT-GGCTTTCTAGAGGCGAGAGTGCGAG as primers. The PCR product was then excised with HindIII/NcoI and subcloned into pGL3-basic vector via HindIII/NcoI sites to generate a full-length GCmutagenized 213-bp fragment. A promoter/reporter construct containing either a 5-bp or 10-bp insertion between the GC box and GAS element was obtained similarly using PCR-mediated site-directed mutagenesis. The first pairs of primers were 59-CCTTAAGCTTTTCCTGGAAATCCACAG GATGC-39 and 59-CGGAGTCAAGGATATCAGGAGGAGGGATCTT CC-39 for 5-bp insertion and 59-CCTTAAGCTTTTCCTGGAAATC CACAGGATGC-39 and 59-GAGTCAAGTTTTTGAATTCAGGAG GAGGGATCTTCC for 10-bp insertion. The inserted sequences are underlined. The second pairs of primers were 59-CCTGATATCCTT GACTCCGCCCTCTCTCCC-39 and 59-GCGTCTTCCATGGTGGCTT TCTAGAGGCGAGAGTGCGAG-39 for 5-bp insertion and 59-CCTCCT GAATTCAAAAACTTGACTCCGCCCTCTCTCCC-39 and 59-GCGTCT TCCATGGTGGCTTTCTAGAGGCGAGAGTGCGAG-39 for 10-bp insertion. The inserted sequences are underlined. kB and TPA-response element (TRE) mutants of the hMCP-1 promoter were generated by two of us (Y-s.L., P.E.K.) at The Ohio State University (28).

Transient Transfection The Polybrene (Sigma) method (36) with 50 mg of supercoiled plasmid DNA was used to transfect human astrocytoma cells (CRT cells). Briefly, confluent cells (6 3 106) were passed (1:2) 1 day before transfection on 150-mm dishes and then incubated in 8 ml of transfection medium (10 mg/ml of Polybrene and 50 mg of plasmid DNA in complete medium). After incubation for 6 h at 37°C with intermittent gentle shaking, cells were subjected to 1.5 min of shock (30% DMSO in incomplete medium, which was RPMI 1640 supplemented with 2 mM L-glutamine), rinsed twice in incomplete medium, and incubated for 12–16 h in complete medium. Cells were then pooled and split (1:2) into smaller 100-mm dishes to control for differential transfection efficiency, incubated for another 5 to 7 h, and reserved as controls or treated with 100 U/ml IFN-g for various periods of time, washed, and rested overnight to allow CAT or luciferase protein to accumulate. For the CAT assay, cell lysates were prepared by three freeze-thaw cycles, and protein amount was quantitated by the Bradford method (BioRad, Richmond, CA). CAT assays were performed as described previously (36). For the luciferase assay, cells were lysed and luciferase activity was assayed using a luciferase assay kit (Promega) with a Luminometer (Dynatech Laboratories, Chantilly, VA). Results presented in this article were obtained from two to four separate experiments. One microgram of a SV40 promoter-b-galactosidase reporter plasmid, pCH110 (Pharmacia, Piscataway, NJ), was cotransfected with the test plasmids as an internal control to normalize for transfection efficiency. b-Galactosidase activity was measured in cell lysates by using the b-galactosidase enzyme assay system kit (Promega). Luciferase or CAT activity of the transiently transfected cells were normalized to b-galactosidase activity.

RNase Protection Assay The hMCP-1 probe for the assay protects a 560-bp fragment of hMCP-1 mRNA and was generated after the pGEM-hJE34 (a generous gift from Dr. B.J. Rollins at Dana-Farber Cancer Institute) was linealized with HindIII. The linealized hMCP-1 DNA was then transcribed with T7 RNA polymerase. Probe for g-actin was also used as a control for mRNA loading (37). Total cellular RNA was isolated from 90% confluent CRT cells using the TRIzol method (Life Technologies). Total RNA (10 mg) was denatured and used for hybridization with the corresponding ribonucleotide probes. The labeling and hybridization conditions were detailed by Rani et al. (37). Data reported were obtained from three separate experiments.

Nuclear run-on analysis For each data point, 5 3 106 cells at 70 – 80% confluency were washed and scraped in ice-cold 13 PBS and pelleted. Nuclei were isolated by lysing the cells in hypotonic Nonidet P-40 lysis buffer and incubated in a solution containing 148.5 mM KCl; 5 mM MgCl2; 1 mM MnCl2; 10 mM Tris-HCl, pH 8.0; 10% glycerol; 1 mM each of ATP, GTP, and CTP, 2 mM DTT; and 0.144 mCi of [32P]UTP (3000 Ci/mmol; Amersham Life Sciences, Arlington Heights, IL) at 25°C for 45 min. After the reaction, nuclei were lysed with 0.5 ml of RNAzol (Cinna/Biotecx Laboratories, Friendswood, TX) and 100 ml of chloroform-isoamyl alcohol (24:1), and RNAs were pelleted using isopropanol. As hybridization substrates, plasmid DNAs were denatured and spotted onto nitrocellulose membranes (Nitrobind; Micron Sep-

arations, Westboro, MA). Labeled transcripts were recovered by hybridization in a solution containing 1 3 107 cpm/ml of 32P-labeled RNA at 42°C for 3 days. Autoradiography was generated on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA) and quantitated with ImageQuant. Transcriptional activation was calculated as the hMCP-1/b-actin ratio.

Preparation of nuclear extract and electrophoretic mobility shift assay (EMSA) Nuclear extracts were prepared by a modified method of Dignam et al. (51), as described by Ohmori and Hamilton (38). For binding reactions, nuclear extracts containing 10 mg of protein were incubated with 5 mg of polydeoxyinosinic-deoxycytidylic acid for 15 min at 4°C. The 32P-labeled oligonucleotide probe (20,000 cpm) in 9 ml of binding buffer (6 mM HEPES, 1 mM DTT, and 6% glycerol) was then added to the reaction mixture and incubated for 20 min at room temperature. The oligonucleotide probe was labeled using T4 polynucleotide kinase (Boehringer Mannheim, Indianapolis, IN). For supershift experiments, rabbit antisera against STAT1a (39) or Sp-1 (Santa Cruz Biotechnology, Santa Cruz, CA) were incubated with nuclear extract for 20 min at 4°C before addition of polydeoxyinosinic-deoxycytidylic acid and oligonucleotide probe. The reaction products were analyzed by electrophoresis in a 6% polyacrylamide gel. The oligonucleotide probes for the GAS-binding assay were 59-CCT TAAGCTTTTCCTGGAAATCCACAGGATGC for the wild-type GAS element and 59-CCTTAAGCTTTGCATGGCAATCCAC for the mutagenized GAS element. GAS consensus sequences are underlined, and mutagenized nucleotides appear in bold. The probes for Sp-1 were 59CCTCCTGCTTGACTCCGCCCTCTCTCCC for the wild-type GC box and 59-CCTCCTGCTTGACTCCGAGCTCTCTCCC for the mutagenized GC box, with the GC box consensus sequences underlined and mutagenized nucleotides in bold.

IVGF In vivo methylation of cellular DNA and DNA preparation were performed as described by Mueller et al. (40). Ligation-mediated PCR was conducted according to the procedure of Mueller et al. (40), with minor modifications as described by Ping et al. (41). The 213-bp promoter proximal region of the hMCP-1 gene was analyzed by one set of coding-strand and one set of noncoding-strand primers. Primers for the coding strand were 59-TGTG GTTCAAGGAGAAGAAGAGGG-39, 59-GCTATGAGCAGCAGGCAC AGAAGG-39, and 59-CAGGCACAGAAGGGCGGCAGAGAC-39. The annealing temperatures for this set of primers were 59°C, 66°C, and 69°C, respectively. Primers for the noncoding strand were 59-CCCTCTTAGT TCACATCTGTGGTCAG-39, 59-CCCATCCTCCCCATTTGCTCAT-T39, and 59-TCCCCATTTGCTCATTTGGTCTCAGCAG-39. The annealing temperatures were 59°C, 66°C, and 69°C, respectively.

Results

IFN-g induces hMCP-1 expression hMCP-1 is produced by a variety of cells on stimulation with cytokines and bacterial and viral products of mitogens. It plays an important role in the recruitment of monocytes at sites of inflammation (14). There is relatively little known, however, of regulation of hMCP-1 by these inflammatory stimuli. Astrocytes participate in the pathophysiology of CNS inflammatory diseases. Their expression of adhesion molecules, chemokines, and MHC antigens may contribute to these inflammatory processes. Our previous studies showed that astrocytes were the major source of mRNAs encoding MCP-1 and multiple other chemokines in the CNS of experimental autoimmune encephalomyelitis (EAE) mice, in which a transient burst of MCP-1 mRNA accumulation occurred at the onset of CNS inflammation and neurologic signs (19 –22). hMCP-1 is also prominently expressed in active multiple sclerosis lesions by parenchymal astrocytes (52). To initiate our studies of hMCP-1 gene regulation in an astrocyte-specific tissue model and to determine the time course of expression of MCP-1 mRNA in human astrocytic cells, we first examined the effects of proinflammatory cytokine, IFN-g, on hMCP-1 mRNA expression. CRT cells were treated with IFN-g (100 U/ml) for varying times, and mRNA accumulation was evaluated by RNase protection assay. hMCP-1 mRNA appeared rapidly and reached maximum by 8 h, decaying significantly by 24 h in the continued presence of stimulus (Fig. 1).

The Journal of Immunology

FIGURE 1. Time course of hMCP-1 mRNA accumulation induced by IFN-g. CRT cells were treated with IFN-g (100 U/ml) for the indicated times. hMCP-1 mRNA expression was analyzed by RNase protection assay as described in Materials and Methods.

This observation indicated that IFN-g-induced hMCP-1 mRNA expression was rapid, transient, and down-regulated, consistent with prior in vivo studies. To investigate whether IFN-g-induced steady-state hMCP-1 mRNA accumulation was associated with an increase in the transcriptional rate of the gene, hMCP-1 transcription was evaluated in nuclei isolated from CRT cells after stimulation with IFN-g. hMCP-1 transcription was not detected in untreated cells; active transcription of the gene was observed after 2 h of IFN-g treatment, with a pronounced decrease 1 h later (Fig. 2). After 4 h of IFN-g treatment, the transcription rate declined to a barely detectable level (not shown). Activation of transcription is mediated by a 213-bp upstream region of the hMCP-1 gene The above observations led to subsequent experiments to test whether transcriptional induction of hMCP-1 by IFN-g was gov-

FIGURE 2. IFN-g activated hMCP-1 transcription. Transcription rates of hMCP-1, IP-10, and actin were measured by nuclear run-on assays with isolated nuclei from CRT cells treated with IFN-g (100 U/ml) for the indicated times.

3911 erned by upstream elements of the hMCP-1 transcription unit. We asked whether individual plasmids containing upstream elements of the hMCP-1 gene fused to a reporter, CAT, could be stimulated by cytokines to inducible expression. pMCP-1(3.5)CAT, a promoter/reporter construct containing 3.5 kb of 59-flanking sequences driving expression of the reporter gene CAT, was used for transient transfection experiments. IFN-g induced a 7.5-fold induction of hMCP-1 promoter-driven CAT activity (Fig. 3, 3.5 kb, lane 1 vs lane 2). This induction was significant ( p , 0.005; t test). Serial deletion constructs containing various length of 59-flanking sequences were then tested for cytokine induction. Substantial cytokine-induced CAT activities were also observed with constructs containing 349 and 292 bp of the hMCP-1 promoter (Fig. 3, lane 3 vs lane 4 and lane 5 vs lane 6). A construct containing 213 bp upstream of the transcription start site was fully capable of responding to IFN-g stimulation (Fig. 3, 213 bp, lane 7 vs lane 8; p , 0.001), while an hMCP-1 promoter-reporter construct truncated at 2147 bp failed to respond to stimulation (Fig. 3, 147 bp, lane 9 vs lane 10). The 213-bp element was previously shown to be competent to direct TPA response in human glioma cells, while a minimal element comprising 128 bp was required for basal expression. Consistent with published reports, basal expression of the 147-bp construct was comparable with that of constructs containing additional upstream sequence content (28). GAS element is required for IFN-g-induced hMCP-1 gene activation A computer-assisted motif search of the proximal promoter between 2213 bp and 2147 bp revealed a consensus GAS (59 terminus of GAS at 2212 bp relative to the transcription start site), an NF-kB binding site (59 at 2149), and an (AP-1)-binding element (also called the TRE site, 59 at 2156). As a first step in analyzing the proximal regulatory elements, site-directed mutagenesis was used to disrupt GAS2212, kB2149, and TRE2156. IFN-g responsiveness of the mutant promoters was assessed by transient transfection experiments. As shown in Fig. 4, in the absence of a functional NF-kB or AP-1 binding site, IFN-g-induced CAT activity remained intact, suggesting that these two regulatory elements are dispensable for IFN-g induction. In contrast, disruption of GAS2212 eliminated IFN-g responsiveness of the gene. To investigate further the role of GAS in the expression of the hMCP-1 gene, EMSA was performed using oligonucleotide probe containing GAS2212. EMSA analysis revealed an IFN-g-inducible protein-DNA complex (Fig. 5, complex a), which reached maximal abundance at 30 min after IFN-g treatment and declined as the treatment continued (Fig. 5, lanes 1–3). The complex was specific for the GAS probe, as nonlabeled GAS oligonucleotides were able to compete with the probe for DNA-binding activity (Fig. 5, lane 4). The mutant GAS motif used in transient transfections was completely inert for factor binding (Fig. 5, lane 7). Antisera directed against STAT-1a were also used in EMSA supershift assay. Complex a was specifically supershifted by antisera to STAT-1a, producing complex b (Fig. 5, lanes 5 and 6). We also used the STAT-1a-deficient U3A cell line to confirm the involvement of STAT-1a in IFN-g-mediated hMCP-1 expression (42). As expected, no hMCP-1 message was detected in U3A cells after IFN-g treatment, while in wild-type 2fTGH cells, robust hMCP-1 expression was detected (data not shown). Taken together, transient transfections, in vitro binding assays, and studies in genetically modified cells provide the first evidence favoring a requirement of a GAS regulatory element for IFN-g-induced hMCP-1 expression. An IFN-g-inducible GAS-binding activity containing STAT-1a contributes to this gene activation.

3912


FIGURE 3. IFN-g-induced hMCP-1 transcription is mediated by 213 bp upstream of the structural hMCP-1 gene. Plasmid pMCP-1(3.5 kb)CAT is schematically represented. G signifies GAS element, T signifies Ap-1 binding site, and K signifies kB binding site. CRT cells were transfected with various hMCP-1/CAT plasmid constructs, untreated, or treated with IFN-g (100 U/ml) for 2 h. Lanes 1 and 2 were transfected with pMCP-1(3.5 kb)/CAT, lanes 3 and 4 with pMCP-1(349)/CAT, lanes 5 and 6 with pMCP-1(292)/CAT, lanes 7 and 8 with pMCP-1(213)/CAT, and lanes 9 and 10 with pMCP-1(147)/ CAT. Lanes 1, 3, 5, 7, and 9 were untreated, and lanes 2, 4, 6, 8, and 10 were IFN-g treated. Results were obtained from three separate experiments. Means and SDs are shown.

GAS and GC box in the proximal regulatory region of the hMCP-1 gene are occupied in vivo after IFN-g treatment IVGF permits analysis of protein-DNA interactions in intact cells, by reduction (dimethyl sulfate (DMS) resistance/protection) or enhancement (DMS hypersensitivity) of DMS methylation of guanine residues, which are displayed as alterations in the intensity of specific bands in a guanine sequence ladder. DMS protection results from sequence-specific protein-DNA interactions. Protein-

FIGURE 4. GAS element is required for IFN-g induction. Site-directed mutagenesis was conducted to make mutant promoter/CAT constructs with deficient GAS, kB, or Ap-1 binding site, respectively. CRT cells were transiently transfected with these mutant promoter/reporter constructs in the presence (lane 2) or absence (lane 1) of IFN-g for 2 h, and promoter activities were analyzed by CAT assay. mGAS, mkB, and mTRE signify mutations at GAS, kB, or Ap-1 binding site, respectively. Mutagenized nucleotides are shown in italics.

DNA interaction may result in conformational changes in the DNA and therefore increased accessibility of DMS to the DNA, leading to DMS hypersensitivity in neighboring regions. This approach has the advantage of revealing protein-DNA interactions in intact cells; furthermore, all sequences within a given region are examined by IVGF without preconception about the cis elements involved in regulation of a given gene under defined circumstances. It should be emphasized, however, that IVGF does not address the identity of nuclear proteins that interact with protected sites in vivo. To determine the in vivo state of the regulatory region from 2213 to 2147 of the hMCP-1 gene in untreated and IFN-g-treated cells, IVGF was conducted. After 30 min of IFN-g treatment, a protection on the noncoding strand of consensus GAS at core residue G2209 and a partial protection on the coding strand at G2207 were observed (Fig. 6). This protection decayed by 5 h of treatment. The protection on the coding strand at GAS core residue

FIGURE 5. IFN-g-activated STAT-1a binds to GAS element. EMSA was performed on nuclear extracts prepared from CRT cells, which were untreated (lane 1) or were treated with IFN-g for 30 min (lane 2) and 5 h (lane 3). The oligonucleotide probe contains the GAS sequence. The protein-DNA complex is indicated as complex a. EMSA of nuclear extracts from cells treated with IFN-g for 30 min was conducted in the presence of unlabeled GAS DNA (lane 4), STAT-1a antisera (lane 5), preimmune antisera (lane 6), or labeled DNA containing mutagenized GAS sequence (lane 7). Complex b reacts with STAT-1a antisera.

The Journal of Immunology

3913

FIGURE 6. The GAS is occupied in vivo after IFN-g treatment. IVGF was conducted using CRT cells treated with IFN-g for 30 min or 5 h or left untreated. Occupancy on the GAS of both coding and noncoding strands is shown. Lanes marked V indicate in vitro methylated DNA. Arrows indicate DMS-protected region, and circle represents DMS hypersensitivity. Protected guanine residues appear in bold.

G2207 was weaker (60% protection) but highly reproducible through three independent experiments. IFN-g treatment also resulted in DMS hypersensitivity downstream of GAS at G2201 on the noncoding strand. The in vivo protection pattern correlated closely with the profile of IFN-g-induced in vitro GAS-binding activity, which peaked at 30 min and declined during 5 h of treatment (Fig. 5, lanes 2 and 3). The time course of factor binding in vivo was also consistent with the time course of transcription activation of hMCP-1 in IFN-g-treated cells (not shown). Two other regions in the hMCP-1 promoter were found to be occupied after IFN-g treatment. The GC box of the noncoding strand was very weakly protected under basal conditions but became highly DMS resistant (at G2109, G2117, G2119, G2120, G2121, G2123, and G2126 of the noncoding strand) upon IFN-g treatment (Fig. 7). An additional region upstream of the consensus GC box located at 2134 to 2138 (G2134, G2135, G2137, G2138 of the noncoding strand), although weakly DMS resistant under basal conditions, was found to be inducibly protected as well. No significant DMS protection was observed at the above region of the coding strand, in which the footprinting pattern precisely corresponded to that produced by deproteinized genomic DNA. Upstream of the expanded GC box, a residue (G2154) at the core of TRE was found to be DMS hypersensitive, while G2156 was constitutively protected. Interestingly, IFN-g-induced protection at the GC box displayed the same temporal pattern of protection as seen at the GAS. Protection peaked at 30 min of IFN-g treatment but decreased with longer treatment. This IFN-g-induced concerted binding to several proximal regulatory sites is novel and suggests that events beyond STAT-1a homodimer binding to GAS element may be implicated in transcriptional induction of responsive genes. To determine the nature of binding activity at the GC box, EMSA was performed. Constitutive factor binding at the GC box was observed. Sp-1 was identified within the complex by supershift analysis (Fig. 8, lane 3).

These findings indicate that STAT-1a binds the hMCP-1 GAS and activates suboptimal transcription in the absence of a functional GC box/Sp-1-binding element and therefore argue against an obligatory physical interaction between Sp-1 and STAT-1a for inducing hMCP-1 by IFN-g in human astrocytoma cells. Consistent with the lack of association between the two factors under

Indirect interaction between the hMCP-1 gene GAS and GC box in response to IFN-g The functional significance of GC box and GAS was further studied to investigate the nature of cooperation between Sp-1 and STAT-1a for IFN-g responsiveness of the hMCP-1 gene. An hMCP-1 (213 bp)/luciferase-reporter construct containing mutations of core residues at the Sp-1-binding GC box was used in transient transfection assays. This mutation, which blocked Sp-1 binding to the GC box (Fig. 8, lane 5), failed to block IFN-g inducibility of the promoter/reporter construct in transient transfection (Fig. 9). Fold induction of hMCP-1 mGC promoter-reporter mutant by IFN-g was equivalent to that observed for the wild-type 2213 hMCP-1/luciferase plasmid. Basal expression and maximal IFN-g responsiveness, however, were proportionally reduced by more than 50% in the GC mutant.

FIGURE 7. IFN-g induces binding to the GC box in vivo. IVGF was performed using CRT cells treated with IFN-g for 30 min or 5 h or left untreated. Occupancy on the GC box and TRE sites of both coding and noncoding strands is shown. Lanes marked V indicate in vitro methylated DNA. Filled arrows indicate IFN-g-induced binding of transcription factor(s) that results in the DMS protection. Protected guanine residues appear in bold. Open arrow indicates constitutive DMS-protection; open circle, constitutive DMS hypersensitivity. A summary of Figs. 6 and 7 is shown at the bottom, with filled circles representing IFN-g-induced DMS hypersensitivity.

3914

FIGURE 8. Sp-1 constitutively binds to the GC box in vitro. EMSA of nuclear extracts from untreated CRT cells (lane 1) or cells treated with IFN-g (100 U/ml) for 4 h (lane 2) was conducted, with the oligonucleotide probe containing the GC box sequence. The protein-DNA complex is indicated as complex a. EMSA was also performed using nuclear extracts from untreated cells in the presence of Sp-1 antisera (lane 3), unlabeled GC-containing oligonucleotides (lane 4), or unlabeled oligonucleotides containing mutagenized GC box (lane 5). Complex b reacts with Sp-1 antisera.

these conditions, immunoprecipitation experiments with wholecell extracts from untreated or IFN-g-treated cells showed that anti-Sp-1 antisera failed to coprecipitate STAT-1a (data not shown). To determine whether the cooperation between STAT-1a and Sp-1 was affected by spacing between GAS and GC box, insertions of 5, one-half turns of the DNA helix, or 10 nucleotides, were introduced between the two sites. Neither insertion significantly affected efficiency or IFN-g inducibility of the promoter/reporter construct in transient transfection assays (data not shown). Taken together, results described in this section favor indirect cooperation between the GAS and GC-rich element of the hMCP-1 gene in responding to IFN-g.

Discussion The present study identified regulatory sites in the proximal region of the IFN-g-activated hMCP-1 gene. Their functional analysis extends our understanding of the mechanism by which IFN-g induces hMCP-1 gene expression. In particular, it is demonstrated that IFN-g-induced hMCP-1 transcription is mediated through a 213-bp upstream region of the gene, containing a GAS and GCrich element. Furthermore, the GAS and GC box are shown by site-specific mutagenesis to mediate separable functions in the induction of the gene: GAS was required for response to IFN-g, while the GC box was essential for efficient gene expression. In vitro factor-binding studies showed that STAT-1a complexes bound inducibly to the GAS, while Sp-1 was capable of binding to the GC box. Although the binding of Sp-1 in vitro was not regulated by IFN-g, mutations that disrupted factor binding also abrogated efficient gene expression. Finally, our results provide the first demonstration in vivo that IFN-g signals to the GC box, as well as


FIGURE 9. Both the GAS element and GC box are required for optimal IFN-g induction of the hMCP-1 gene. CRT cells were transfected with an hMCP-1 promoter/luciferase reporter construct containing 213 bp of the hMCP-1 promoter (2213) or the same sequence with mutations at the GAS (mGAS) or GC box (mGC). Transfected cells were treated in the presence (lane 2) or absence (lane 1) of IFN-g (100 U/ml) for 6 h, and cell extracts were analyzed for luciferase activity. Results were obtained from three separate experiments. Means and SDs are shown.

the GAS. Taken together, these observations indicate that IFN-g treatment orchestrates cooperation between the GAS and the GC box in inducing efficient transcription of the hMCP-1 gene. IFN-g induction of hMCP-1: molecular mechanism IFN-g, alone or in combination with other proinflammatory cytokines, induces hMCP-1 gene expression and secretion in multiple cell types. Transcriptional regulation by IFN can be achieved in several ways: binding of single STAT to a single cis element, cooperative binding of STATs to several adjacent consensus sites, and interaction of STATs with other nuclear factors. In this report, the role of a single GAS element was established through the analysis of the GAS-deficient promoter in a transient transfection assay. EMSA subsequently identified STAT-1a to be the GAS-binding factor. More compelling was the observation that the GAS element in the hMCP-1 promoter was occupied in vivo after IFN-g treatment. Unexpectedly, IFN-g-induced protection was also found at the GC box, a sequence constitutively involved in basal transcription of many TATA-less “housekeeping” genes. EMSA identified Sp-1 as a potential GC box-binding factor that was abundant in nuclei of resting and IFN-g-stimulated cells. In vivo binding activities at both GAS and GC box peaked 30 min after IFN-g treatment and declined at 5 h. The observation that IFN-g promotes factor binding at the GC box of the hMCP-1 gene is novel and suggests that this event is pertinent for gene expression. Further support for this interpretation came from disrupting the GC site in the context of the intact hMCP-1 promoter-reporter; in transient transfection assays, this GC-deficient construct was inducible by IFN-g but was expressed at .50% reduced efficiency. These observations raise the possibility that there are functional interactions between the GAS and GC box in the hMCP-1 gene. Because the best established DNA-binding factor in the IFN-g signaling pathway is composed of STAT-1a homodimers, one potential

The Journal of Immunology mechanism of such an interaction would suggest that STAT-1a binding may perturb DNA and render the GC site accessible to Sp-1 binding. Alternatively, STAT-1a could facilitate recruitment of Sp-1 through direct protein-protein interaction. Functional interaction between GAS and GC-rich element in IFN-g induction of hMCP-1 Our data suggest in two respects that functional interaction between the GAS element and the GC box for IFN-g-inducible hMCP-1 transcription in astrocytoma cells may be indirect: first, the promoter is insensitive to the spacing between the GAS and the GC box; second, coimmunoprecipitation experiments failed to show an association of Sp-1 and STAT-1a in IFN-g-activated nuclear extracts. A direct protein-protein interaction between STAT-1a and Sp-1 was proposed to mediate IFN-g activation of the ICAM-1 gene promoter (12) in which the GAS element is 7 nucleotides upstream of GC box. Arguing somewhat against this interpretation, the trans-activation domain of Sp-1 was found to be sufficient to mediate a functional interaction with STAT-1a and stimulate ICAM-1 transcription (12). Most importantly, disruption of either the GAS or the Sp-1 site in the ICAM-1 promoter had similar effects and completely disabled the promoter. This result stands in direct contrast to the consequences of corresponding mutations in hMCP-1 gene promoter (Fig. 9). These disparate results suggest that detailed mechanisms of GAS/GC box cooperativity may be governed in large part by spacing between cognate binding sites. We observed a discrepancy between EMSA and IVGF for analyzing factor binding to GC box of the hMCP-1 promoter, since Sp-1 binding to the GC box was constitutive in vitro, but protection of the GC element was IFN-g-inducible in vivo. Such an observation is not without precedent in studies of GC box function. In particular, the myeloid-specific CD11b gene promoter contains a GC element that bound Sp-1 in vitro in extracts prepared from multiple cell types. In vivo, the CD11b GC box was protected only in myeloid cells that expressed the gene, and not in HeLa cells in which the gene was silent (43). A compatible observation was made in studying the transformation-dependent expression of the TGF-a promoter. These investigators found that Sp-1 mRNA and protein were present at similar levels in normal and transformed cells that expressed TGF-a at markedly different levels. Occupancy of potential Sp-1-binding GC-rich sites occurred only in cells actively transcribing TGF-a (44). The putative interaction between GAS and GC-rich elements of the hMCP-1 gene in the IFN-g response is likely not a universal phenomenon: in the IFN regulatory factor-1 promoter, in which a GAS element is 56 bp upstream of GC box, IFN-g-induced in vivo protection at GAS was demonstrated, while occupancy of the GC box was constitutive (45). It is shown in this report by site-directed mutagenesis that the sequence (59-CCCGCC) of the GC box is required for optimal hMCP-1 promoter activity. In vivo footprinting revealed an Sp-1 binding footprint that covered a region longer than the previously described consensus binding site. Similar observations were made in studies of the CD11b promoter (43). No DMS protection at GC box on the coding strand was observed; this pattern is consistent with binding in vivo of Sp-1, a zinc finger protein that binds in the major groove of B-DNA and contacts principally the guanine-rich strand of the binding site (46). As we note above, however, IVGF does not address the nature of DNA-bound components. Sp-1 is universally expressed and has long been thought to regulate basal levels of transcription, primarily for housekeeping genes. However, recent evidence suggests that its activity can be modulated through regulation of its level of expression (47), bind-

3915 ing affinity (48), and posttranslational modifications such as phosphorylation and glycosylation (49, 50), to confer gene or tissue specificity. The present study is the first to document IFN-g-inducible protection of a potential Sp-1 binding site in vivo and suggests a possible role for Sp-1 in this induction event. hMCP-1 gene expression is up-regulated in multiple pathologic and physiologic states of the CNS and PNS, presumably through distinct cis elements and trans-acting factors (21). It will be interesting in the future to determine whether interactions between cytokine-regulated cis elements and the GC-rich motif provide a general mechanism by which transcription of hMCP-1 is up-regulated by multiple independent stimuli.

Acknowledgments We thank Donal Luse (Department of Molecular Biology, The Lerner Research Institute, Cleveland Clinic Foundation) for helpful discussions.

References 1. Schindler, C., and J. E. Darnell, Jr. 1995. Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu. Rev. Biochem. 64:621. 2. Darnell, J. E., Jr., I. M. Kerr, and G. R. Stark. 1994. JAK-STAT pathways and transcriptional activation in response to interferons and other extracellular signaling proteins. Science 264:1415. 3. Ihle, J. N., and I. M. Kerr. 1995. JAKs and STATs in signaling by the cytokine receptor superfamily. Trends Genet. 11:69. 4. Shuai, K. 1994. Interferon-activated signal transduction to the nucleus. Curr. Opin. Cell Biol. 6:253. 5. Greenlund, A. C., M. A. Farrar, B. L. Viviano, and R. D. Schreiber. 1994. Ligand-induced IFN-g receptor tyrosine phosphorylation couples the receptor to its signal transduction system (p91). EMBO J. 13:1591. 6. Greenlund, A. C., M. O. Morales, B. L. Viviano, H. Yan, J. Krolewski, and R. D. Schreiber. 1995. STAT recruitment by tyrosine-phosphorylated cytokine receptor: an ordered reversible affinity-driven process. Immunity 2:677. 7. Lew, D. J., T. Decker, I. Strehlow, and J. E. Darnell. 1991. Overlapping elements in the guanylate-binding protein gene promoter mediate transcriptional induction by a- and g-interferons. Mol. Cell. Biol. 11:182. 8. Shuai, K., C. M. Horvath, L. H. Huang, S. A. Qureshi, D. Cowburn, and J. E. Darnell, Jr. 1994. Interferon activation of the transcription factor STAT91 involves dimerization through SH2-phosphotyrosyl peptide interactions. Cell 76: 821. 9. Xu, X., Y.-L. Sun, and T. Hoey. 1996. Cooperative DNA binding and sequenceselective recognition conferred by the STAT amino-terminal domain. Science 273:794. 10. Guyer, N. B., C. W. Severns, P. Wong, C. A. Feghali, and T. M. Wright. 1995. IFN-g induces a p91/STAT1a-related transcription factor with distinct activation and binding properties. J. Immunol. 155:3472. 11. Perez, C., E. Coeffier, F. Moreau-Gachelin, J. Wietzerbin, and P. D. Benech. 1994. Involvement of the transcription factor PU.1/Spi-1 in myeloid cell-restricted expression of an interferon-inducible gene encoding the human highaffinity Fcg receptor. Mol. Cell. Biol. 14:5023. 12. Look, D. C., M. R. Pelletier, R. M. Tidwell, W. T. Roswit, and M. J. Holtzman. 1995. STAT1 depends on transcriptional synergy with Sp1. J. Biol. Chem. 270: 30264. 13. Leonard, E. J., and T. Yoshimura. 1990. Human monocyte chemoattractant protein-1 (MCP-1). Immunol. Today 11:97. 14. Rollins, B. J. 1996. Monocyte chemoattractant protein 1: a potential regulator of monocyte recruitment in inflammatory disease. Mol. Med. Today 2:198. 15. Proost, P., A. Wuyts, and J. Van Damme. 1996. Human monocyte chemotactic protein-2 and -3: structural and functional comparison with MCP-1. J. Leukocyte Biol. 59:67. 16. Garcia-Zepeda, E. A., M. E. Combardiere, M. E. Rothenberg, M. Safari, Q. Hamid, P. M. Murphy, and A. D. Luster. 1996. Human monocyte chemoattractant protein (MCP)-4: a novel CC chemokine with activities on monocytes, eosinophiles, and basophils, induced in allergic and nonallergic inflammation, that signals through the CC chemokine receptors CKR-2 and CCR-3. J. Immunol. 157:5613. 17. Sarafi, M. N., E. A. Garcia-Zepeda, J. A. MacLean, I. F. Charo, and A. D. Luster. 1997. Murine monocyte chemoattractant protein (MCP)-5: a novel CC chemokine that is a structural and functional homologue of human MCP-1. J. Exp. Med. 185:99. 18. Jia, G.-Q., J. A. Gonzalo, C. Lloyd, L. Kremer, L. Lu, C. Martinez-A, B. K. Wershil, and J. C. Gutierrez-Ramos. 1996. Distinct expression and function of the novel mouse chemokine monocyte chemotactic protein-5 in lung allergic inflammation. J. Exp. Med. 184:1939. 19. Ransohoff, R. M., T. A. Hamilton, M. Tani, M. H. Stoler, H. E. Shick, J. A. Major, M. L. Estes, D. M. Thomas, and V. K. Tuohy. 1993. Astrocyte expression of mRNA encoding cytokines IP-10 and JE/MCP-1 in experimental autoimmune encephalomyelitis. FASEB J. 7:592.


3916 20. Ransohoff, R. M., A. Glabinski, and M. Tani. 1996. Chemokines in immunemediated inflammation of the central nervous system. Cytokine Growth Factor Rev. 7:35. 21. Ransohoff, R. M. 1997. Chemokines in neurological disease models: correlation between chemokine expression patterns and inflammatory pathology. J. Leukocyte Biol. 62:645. 22. Glabinski, A. R., M. Tani, R. M. Strieter, V. K. Tuohy, and R. M. Ransohoff. 1997. Synchronous synthesis of a- and b-chemokines by cells of diverse lineage in the central nervous system of mice with relapses of chronic experimental autoimmune encephalomyelitis. Am. J. Pathol. 150:617. 23. Taub, D. D. 1996. Chemokine-leukocyte interactions. Cytokine Growth Factor Rev. 7:355. 24. Cochran, B. J., A. C. Reffel, and C. D. Stiles. 1983. Molecular cloning of gene sequences regulated by platelet-derived growth factor. Cell 33:939. 25. Shyy, Y., Y. S. Li, and P. E. Kolattukudy. 1990. Structure of human monocyte chemotactic protein gene and its regulation by TPA. Biochem. Biophys. Res. Commun. 169:346. 26. Sica, A., J. M. Wang, F. Colotta, E. Dejana, A. Mantovani, J. J. Oppenheim, C. G. Larsen, C. O. C. Zachariae, and K. Matsushima. 1990. Monocyte chemotactic and activating factor gene expression induced in endothelial cells by IL-1 and tumor necrosis factor. J. Immunol. 144:3034. 27. Ueda, A., K. Okuda, S. Ohno, A. Shirai, T. Igarashi, K. Matsunaga, J. Fukushima, S. Kawanmoto, Y. Ishigatsubo, and T. Okubo. 1994. NF-kB and Sp-1 regulate transcription of the human monocyte chemoattractant protein-1 gene. J. Immunol. 153:2052. 28. Li, Y.-S., and P. E. Kolattukudy. 1994. Functional role of the cis-acting elements in human monocyte chemotactic protein-1 gene in the regulation of its expression by phorbol ester in human glioblastoma cells. Mol. Cell Biochem. 141:121. 29. Satriano, J. A., K. Hora, Z. Shan, E. R. Stanley, T. Mori, and D. Schlondorff. 1993. Regulation of monocyte chemoattractant protein-1 and macrophage colony-stimulating factor-1 by IFN-g, tumor necrosis factor-a, IgG aggregates, and cAMP in mouse mesangial cells. J. Immunol. 150:1971. 30. Narumi, S., L. M. Wyner, M. H. Stoler, C. S. Tannenbaum, and T. A. Hamilton. 1992. Tissue specific expression of murine IP-10 mRNA following systemic treatment with interferon g. J. Leukocyte Biol. 52:27. 31. Brach, M. A., G. Hans, D. Riedel, Y. Asano, S. DeVos, and F. Herrmann. 1992. Effect of antiinflammatory agents on synthesis of MCP-1/JE transcripts by human blood monocytes. Mol. Pharmacol. 43:63. 32. Estes, M. L., R. M. Ransohoff, J. T. McMahon, B. S. Jacobs, and B. P. Barna. 1990. Inhibition of interferon-g-induced gene transcription by interferon b and type b 1 transforming growth factor in human astrocytoma cells: definition of cis element. J. Neurosci. Res. 27:697. 33. Ransohoff, R. M., C. Devajyothi, M. L. Estes, G. Babcock, R. A. Rudick, E. M. Frohman, and B. P. Barna. 1991. Interferon-b specifically inhibits interferon-g-induced class II major histocompatibility complex gene transcription in a human astrocytoma cell line. J. Neuroimmunol. 33:103. 34. Johns, L. D., G. Babcock, D. Green, M. Freedman, S. Sriram, and R. M. Ransohoff. 1992. Transforming growth factor-b 1 differentially regulates proliferation and MHC class-II antigen expression in forebrain and brainstem astrocyte primary cultures. Brain Res. 585:229. 35. Aiyar, A., Y. Xiang, and J. Leis. 1996. Site-directed mutagenesis using overlap extension PCR. Methods Mol. Biol. 57:177. 36. Devajyothi, C., I. Kalvakolanu, G. T. Babcock, H. A. Vasavada, P. H. Howe, and R. M. Ransohoff. 1993. Inhibition of interferon-g-induced gene transcription by

37.

38.

39.

40.

41.

42.

43.

44.

45.

46. 47. 48.

49.

50. 51.

52.

interferon-b and type b 1 transforming growth factor in human astrocytoma cells: definition of cis element. J. Biol. Chem. 268:18794. Rani, M. R. S., G. R. Foster, S. Leung, D. Leaman, G. R. Stark, and R. M. Ransohoff. 1996. Characterization of b-R1, a gene that is selectively induced by interferon b compared with interferon-a. J. Biol. Chem. 271:22878. Ohmori, Y., and T. A. Hamilton. 1995. The interferon-stimulated response element and a kB site mediate synergistic induction of murine IP-10 gene transcription by IFN-g and TNF-a. J. Immunol. 154:5235. Lu, H. T., J. L. Riley, G. T. Babcock, M. Huston, G. R. Stark, J. M. Boss, and R. M. Ransohoff. 1995. Interferon-b acts downstream of IFN-g-induced CIITA mRNA accumulation to block MHC class II gene expression and requires the 48-kDa DNA-binding protein, ISGF3-g. J. Exp. Med. 182:1517. Mueller, P. R., P. A. Garrity, and B. Wold. 1994. Ligation-mediated PCR for genomic sequencing and footprinting. In Current Protocols in Molecular Biology. John Wiley and Sons, New York, p. 15.5. Ping, D.-S., P. Jones, and J. M. Boss. 1996. TNF regulates the in vivo occupancy of both distal and proximal regulatory regions of the MCP-1/JE gene. Immunity 4:455. Muller, M., C. Laxton, J. Briscoe, C. Schindler, T. Improta, J. E. Darnell, Jr., G. R. Stark, and I. M. Kerr. 1993. Complementation of a mutant cell line: central role of the 91 kDa polypeptide of ISGF3 in the interferon-a and -g signal transduction pathways. EMBO J. 12:4221. Chen, H.-M., H. L. Pahl, R. J. Scheibe, D.-E. Zhang, and D. G. Tenen. 1993. The Sp-1 transcription factor binds the CD11b promoter specially in myeloid cells in vivo and is essential for myeloid-specific promoter activity. J. Biol. Chem. 268: 8230. Chen, X., K. L. Wright, E. A. Berkowitz, J. C. Azizkhan, J. P.-Y. Ting, and D. C. Lee. 1994. Protein interactions at Sp-1-like sites in the TGFi promoter as visualized by in vivo genomic footprinting. Oncogene 9:3179. Rein, T., M. Muller, and H. Zorbas. 1994. In vivo footprinting of the IRF-1 promoter: inducible occupation of a GAS element next to a persistent structural alteration of the DNA. Nucleic Acids Res. 22:3033. Pabo, C. O. 1992. Transcription factors: structural families and principles of DNA recognition. Annu. Rev. Biochem. 61:1053. Saffer, J. D., S. P. Jackson, and M. B. Annarella. 1991. Developmental expression of Sp1 in the mouse. Mol. Cell. Biol. 11:2189. Borellini, F., Y. F. He, A. Aquino, G. Yu, S. F. Josephs, and R. I. Glazer. 1991. Increased DNA binding and transcriptional activity associated with transcription factor Sp1 in K562 cells transfected with the myeloid-specific c-fes tyrosine kinase gene. J. Biol. Chem. 266:15850. Schaufele, F., B. L. West, and T. L. Reudelhuber. 1990. Overlapping Pit-1 and Sp1 binding sites are both essential to full rat growth hormone gene promoter activity despite mutually exclusive Pit-1 and Sp1 binding. J. Biol. Chem. 265: 17189. Jackson, S. P., and R. Tijian. 1988. O-glycosylation of eukaryotic transcription factors: implication for mechanisms of transcriptional regulation. Cell 55:125. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475. Simpson, J. E., J. Newcombe, M. L. Cuzner, and M. N. Woodroofe. 1998. Expression of monocyte chemoattractant protein-1 and other b-chemokines by resident glia and inflammatory cells in multiple sclerosis lesions. J. Neuroimmunol. 84:238.