HopX1 in Erwinia amylovora Functions as an Avirulence Protein in ...

HopX1 in Erwinia amylovora Functions as an Avirulence Protein in Apple and Is Regulated by HrpL A. M. Bocsanczy,a D. J. Schneider,a,b G. A. DeClerck,c S. Cartinhour,a,b and S. V. Beera Department of Plant Pathology and Plant-Microbe Biology, Cornell University, Ithaca, New York, USAa; United States Department of Agriculture, Agricultural Research Service, Ithaca, New York, USAb; and Department of Plant Breeding and Genetics, Cornell University, Ithaca, New York, USAc

Fire blight is a devastating disease of rosaceous plants caused by the Gram-negative bacterium Erwinia amylovora. This pathogen delivers virulence proteins into host cells utilizing the type III secretion system (T3SS). Expression of the T3SS and of translocated and secreted substrates is activated by the alternative sigma factor HrpL, which recognizes hrp box promoters upstream of regulated genes. A collection of hidden Markov model (HMM) profiles was used to identify putative hrp boxes in the genome sequence of Ea273, a highly virulent strain of E. amylovora. Among potential virulence factors preceded by putative hrp boxes, two genes previously known as Eop3 and Eop2 were characterized. The presence of functionally active hrp boxes upstream of these two genes was confirmed by ␤-glucuronidase (GUS) assays. Deletion mutants of the latter candidate genes, renamed hopX1Ea and hopAK1Ea, respectively, did not differ in virulence from the wild-type strain when assayed in pear fruit and apple shoots. The hopX1Ea deletion mutant of Ea273, complemented with a plasmid overexpressing hopX1Ea, suppressed the development of the hypersensitivity response (HR) when inoculated into Nicotiana benthamiana; however, it contributed to HR in Nicotiana tabacum and significantly reduced the progress of disease in apple shoots, suggesting that HopX1Ea may act as an avirulence protein in apple shoots.

F

ire blight, a devastating disease of rosaceous plants, impacts agricultural productivity worldwide. The disease is particularly severe on apple, pear, quince, hawthorn, and cotoneaster. The first recorded observation of fire blight occurred in the United States in 1780. Since 1900, the pathogen has spread to many countries around the world (11). The causal agent of fire blight is the Gram-negative bacterium Erwinia amylovora, which is the type species of its genus. Virulence factors previously identified in E. amylovora are quite diverse in their function. Secretion systems are critical to pathogenicity and virulence because they facilitate delivery of toxic compounds or effector proteins from the pathogen to host cells. In particular, the type III secretion system (T3SS) of E. amylovora and its associated secreted proteins constitute one of the two most important pathogenicity factors described (31). If any gene comprising the secretion apparatus or its regulation is disrupted, the diseasecausing ability of the bacterium is reduced or eliminated. The other important pathogenicity factor, the exopolysaccharides (EPS) amylovoran and levan, relates to the ability of the pathogen to colonize and grow competitively in the host environment, where the EPS presumably protect bacteria from oxidizing agents (19). The T3SS, widespread in Gram-negative bacteria, initially was implicated in the delivery of virulence factors, but now it is known also to be important in symbiotic relationships (14). The T3SS is a complex system comprised of approximately 20 proteins (12). Most of these proteins are conserved and are homologous to proteins of the flagellum biosynthesis system (20). The T3SS translocates effector proteins to the host cell cytoplasm where, presumably, they function to block host defense pathways by several mechanisms (27). Harpins also are transported by the T3SS; these are acidic, glycine-rich, hydrophilic proteins, and some have pectate-lyase domains associated with their C termini (13). Interestingly, harpins are thought to be part of the translocation complex (25), along with other “Hrp” proteins (18), termed helpers.

0021-9193/12/$12.00

Journal of Bacteriology

p. 553–560

During coevolution of pathogen and host, the latter may develop proteins that can recognize specific effectors. In such cases, the host deploys a localized rapid and strong response called the hypersensitivity response (HR); the effectors that trigger HR are termed avirulence proteins (1). HR consists of an organized programmed death process of the host cells surrounding the area of contact with the elicitor; it is visualized as a localized necrotic area surrounding the point of infiltration. The HR usually can be detected within 8 h after infiltration. The expression of the T3SS and associated proteins is directly regulated by HrpL, a member of the extracytoplasmic function (ECF) subfamily of alternative sigma factors (38), which activates promoters with a conserved canonical short sequence of about 35 bp, termed an hrp box. The T3SS and HrpL of E. amylovora are similar to the T3SS and HrpL of Pseudomonas syringae, but no functional cross-complementation of HrpL has been observed (38). Previously, 10 functional hrp boxes identified in E. amylovora were shown to be activated by HrpL (31). In this work, 28 hrp boxes were predicted using a collection of hidden Markov model (HMM) profiles to scan the genome of Ea273. Functional dependency of HrpL was confirmed for two predicted hrp boxes upstream of two putative effectors, identified previously as Eop3 and Eop2 and renamed hopX1Ea and hopAK1Ea, respectively. These candidate T3SS genes were characterized and assessed for virulence and HRs to host and nonhost plants. We found that the presence of HopX1Ea protein delayed

Received 24 April 2011 Accepted 14 November 2011 Published ahead of print 28 November 2011 Address correspondence to S. V. Beer, [email protected]. Supplemental material for this article may be found at http://jb.asm.org/. Copyright © 2012, American Society for Microbiology. All Rights Reserved. doi:10.1128/JB.05065-11

jb.asm.org

553

Bocsanczy et al.

TABLE 1 List of bacterial strains and plasmids used for this work Strain or plasmid

Characteristic(s)

Reference

Strains Ea273 Ea273-K49 Ea273⌬hopX1Ea Ea273⌬hopAK1Ea EcoMC4100(pCPP430) EcoMC4100(pCPP431) EcoMC4100(pCPP432) Ea273⌬hopX1Ea(pCPP1737) Ea273⌬hopX1Ea(pCPP1738) EcoMC4100(pCPP430, pCPP1737) EcoMC4100(pCPP431, pCPP1737) EcoMC4100(pCPP432, pCPP1737)

Wild-type E. amylovora, highly virulent on apple and pear hrpL transposon mutant; Kmr hopX1Ea deletion mutant from bp 3 to the stop codon; Rpr hopAK1Ea deletion mutant from bp 140 to bp 133 of the sequence (before the stop codon); Rpr E. coli harboring cosmid pCPP430; Smr E. coli harboring cosmid pCPP431; Kmr Smr E. coli harboring cosmid pCPP432; Kmr Smr hopX1 deletion mutant harboring the plasmid pCPP1737, which expresses HopX1Ea; Cmr Rpr hopX1 deletion mutant harboring the plasmid pCPP1738 for complementation; Smr Rpr E. coli harboring cosmids pCPP430 and pCPP1737; Cmr Smr E. coli harboring cosmids pCPP431 and pCPP1737; Cmr Kmr Smr E. coli harboring cosmids pCPP432 and pCPP1737; Cmr Kmr Smr

29 39 This work This work 5 5 5 This work This work This work This work This work

Medium-copy-number reporter vector for expression of LacZ␣ when promoter sequence is cloned in BamHI site; Kmr Tcr Suicide plasmid for recombination in enteric bacteria; Smr Derivative of pBS29 replacing the lacZ␣ marker with GUS as expression marker at the HindIII site; Kmr Tcr DNA fragments of ca. 500 bp containing predicted hrp boxes for AMY2189, AMY2780, and DspA/E cloned in pCPP1739 in the right orientation for expression at the BamHI site, respectively; Kmr Tcr hopX1Ea complete ORF amplified by PCR from Ea273 genomic DNA and cloned in BamHIEcoRI site of the expression vector pSU23 under the control of the sp6 promoter; Cmr DNA sequence containing the hrp box, chhopX1Ea, and ORF of hopX1Ea amplified by PCR and cloned in BamHI-EcoRI site of pCPP08; Smr Flanking regions of hopX1Ea fused and cloned in pKNG101; Smr Flanking regions of hopAK1Ea fused and cloned in pKNG101; Smr

36

Plasmids pBS29 pKNG101 pCPP1739 pCPP1744 to pCPP1746

pCPP1737 pCPP1738 pCPP1732 pCPP1734

and reduced the development of the HR when inoculated into Nicotiana benthamiana but not into Nicotiana tabacum. Furthermore, overexpression of hopX1Ea in Ea273 significantly reduced the development of disease in apple shoots. MATERIALS AND METHODS In silico identification of putative HrpL-regulated genes. The genome of Ea273 (ATCC 49946) (33) was scanned using a collection of HMM profiles generated by using training sets based on promoter sequences of genes identified by mini-Tn5gus mutagenesis (17) and by microarray differential expression analysis (16) in P. syringae pv. tomato DC3000. hrp boxes in P. syringae pv. phaseolicola 1448A had been confirmed by reverse transcription-PCR (RT-PCR) (37) and on de novo alignment of hrp boxes previously confirmed in the E. amylovora genome (31). The HMMER software package (15) was used to construct and calibrate several HMMs for hrp box motifs and to scan the genome to identify putative promoters. Matches were selected for further analysis if they exhibited scores greater than 8 and were less than 500 bp upstream of annotated genes. Bioinformatics. Routine sequence analysis was performed with Lasergene 7.1 (DNAStar, Madison, WI). The sequence was visualized with the ARTEMIS visualization tool available at http://www.sanger.ac.uk /resources/software/artemis/. The ASAP database (http://asap.ahabs.wisc .edu/asap/home.php) was used to find gene orthologs in other closely related genomes. BLASTP and PSI-BLAST were used to search the NCBI genome database for annotated homolog sequences. Bacterial strains, growth conditions, and plasmids. Bacterial strains were grown in Luria-Bertani (LB) broth or LB agar (6) with appropriate antibiotics for selection. Antibiotics were used at the following concentrations: kanamycin (Km), chloramphenicol (Cm), streptomycin (Sm), and rifampin (Rp) at 50 ␮g/ml and tetracycline (Tc) at 10 ␮g/ml. Escherichia coli and E. amylovora strains were incubated at 37°C and 26°C, respec-

554

jb.asm.org

24 This work This work

This work This work This work This work

tively. The strains and plasmids used are listed in Table 1. The expression reporter vector pCPP1739 was produced by substituting the ␤-galactosidase (lacZ) reporter gene from pBS29 (36) for the ␤-glucuronidase (gus) gene between the two HindIII sites of pBS29. The gus gene was amplified by PCR from the binary vector pBI121 as template (Table 2). To test the activity of the putative hrp boxes, plasmids pCPP1744, pCPP1745, and pCPP1746 were assembled by cloning fragments ranging from 465 to 552 bp that contain the predicted promoter sequence upstream of open reading frames (ORFs) EAM_2780, EAM_2189/2190, and EAM_2872 (DspA/E), respectively, amplified from Ea273 genomic DNA, into the BamHI site of pCPP1739 (Table 1). Plasmid pCPP1738 was produced by cloning the PCR-amplified genomic fragment (Table 2) containing the sequences of EAM_2190, which encodes a putative effector here renamed HopX1Ea (formerly Eop3), its putative chaperone named chHopX1Ea, and the putative hrp box which precedes the operon, into the BamHI-EcoRI site of pCPP8, a low-copynumber promoterless broad-host-range vector (4). Plasmid pCPP1737 was produced by cloning the PCR-amplified genomic fragment containing only the ORF corresponding to hopX1Ea without its chaperone or putative hrp box (Table 2) into the BamHI-EcoRI site of the expression vector pSU23 (3), under the control of the sp6 promoter. Primer design. All primers used in this work are listed in Table 2. The primers were designed using the Primerselect tool of Lasergene 7.0 (DNAStar, Inc., Madison, WI). GUS assays. To test ␤-glucuronidase (GUS) expression, pCPP1744, pCPP1745, and pCPP1746 were transformed into either wild-type Ea273 or the hrpL mutant, Ea273-K49, as a negative control. Strains were grown in Huynh’s minimal medium (21) to induce the expression of hrpL, and GUS activity was measured. pCPP1746 containing the hrp box sequence upstream of dspA/E, a known pathogenicity factor in E. amylovora, was used as a positive control because it is a confirmed HrpL-regulated gene


HopX1 in E. amylovora Functions as an Avirulence Gene

TABLE 2 List of primers used for this work Fragment amplified

Primer pair sequence

Expected size (kbp)

hopX1Ea

Up, 5= CAACCCGGGTAACTGACTGCCAACAATAA Down, 5= GAAGCCCGGGTTACTCCTGTTTGTTACAC

1.13

hopAK1Ea

Up, 5= CATAAGCTGCCTTCGCTTACGGCAAAATAT Down, 5= GTGCATAAAAAGGCTTAACTGAAAGGCAGATG

1.23

GUS fragment

Up, 5= CTACGCAAGCTTCGGGTGGTCAGTCCCTTATGTTACG Down, 5= CTACGCAAGCTTTGCGCCAGGAGAGTTGTTGATTC

1.874

PCR insert for pCPP1738

Up, 5= CACGCGGATCCGTGCCTGACCGAACCTCCCTTTAC Down, 5= CACGCGAATTCGCCGCTTAAGGGATTTTTCACC

1.623

PCR insert for pCPP1737

Up, 5= CACGCGGATCCGGGTAACTGACTGCCAACAATAATC Down, 5= CACGCGAATTCGCCGCTTAAGGGATTTTTCACC

1.083

Insert with hrp box DspA/E

Up, 5= CACGCGGATCCCGTCCCCAAACAGCCCCTGAGA Down, 5= CACGCGGATCCGGCGAGGACGAGGTATTGTTGTTAAGC

0.515

Insert with EAM_2780 hrp box

Up, 5= CACGCGGATCCAGTGAGCGCAGATCGAGGCGATA Down, 5= CACGCGGATCCGCGCCCTGCCTTTCTCACGTAC

0.487

Insert with EAM_2189 hrp box

Up, 5= CACGCGGATCCCTTCTGGTAACGGCCGTCTGATATG Down, 5= CACGCGGATCCGGGGATGTAGCCGGCTGATATACC

0.552

hopX1Ea left flanking region

Up, 5= GACTAGTCATTTGTATGATGACTACCGGGTGGTAAC Down, 5= CCCAAGCTTTATGCCTTGAAGGCATTTTACTCATCTC

1.989

hopX1Ea right flanking region

Up, 5= CCCAAGCTTGAAAAACAGGCGGTGAAAAATCCCTTAAG Down, 5= GCGTCGACTGACGTGCGTATTGACACCATCAAGATC

1.819

hopAK1Ea left flanking region

Up, 5= CAGCCTCTAGAGGTTACGGCTTGATCAATACCACTAAGA Down, 5= CTACGGACTAGTGGTGGCGCATAACTGATAAAGGAATTG

2.384

hopAK1Ea right flanking region

Up, 5= CTACGGACTAGTATGTTGGCAGTAACGTGAGCTTCTTAC Down, 5= CACGCGGATCCAGCAGGTACTGGAGCCGTAAAACAGAC

1.886

(8). Ea273 strains were transformed by electroporation (2), and then they were grown to log phase in LB, washed once with Huynh’s minimal medium (21), resuspended in the same medium to an optical density at 600 nm (OD600) of 0.4, and finally grown at 20°C for 6 h before the assay. For the test, 45 ␮l of the bacterial suspension was mixed with an equal volume of 2⫻ assay buffer (100 mM NaH2PO4, 20 mM ␤-mercaptoethanol, 20 mM EDTA, pH 8.0, 0.2% Triton X-100, 0.2% lauryl sarcosine, and 0.2 mM 4-methylumbelliferone glucuronide [MUG]). The suspensions were incubated at 37°C for 4 h, and the reaction was stopped by adding 10 ␮l of 2 M Na2CO3. The samples were diluted in 0.2 M Na2CO3 to facilitate measurement. The fluorescence of 4-methylumbelliferone (MU), the product of GUS activity, was measured in pU/CFU, where a unit (U) is defined as 1 nmol of product released per minute at 37°C as measured with a VersaFluor fluorometer (Bio-Rad Labs, Richmond, CA) using an emission filter of 455 nm and an excitation filter of 365 nm (23). Four replicates were evaluated per experiment, and mean values are reported. Experiments were repeated three times with similar results. Deletion mutants. Mutant strains of Ea273 were produced by markereviction mutagenesis as described previously (9, 24). Briefly, approximately 2 kbp of DNA flanking the left and right sides of the candidate genes to be deleted (hopX1Ea and hopAK1Ea) was amplified by PCR from Ea273 genomic DNA (Table 2), cloned together into the SpeI-SalI and XbaI-BamHI sites, respectively, of an intermediate pBCSK (Stratagene, La Jolla, CA) vector, and then excised and cloned into the SpeI-SalI and SacI-BamHI sites of the suicide plasmid pKNG101, producing pCPP1732 and pCPP1734, respectively (24). Then, E. coli SM10␭ pir containing the

February 2012 Volume 194 Number 3

pKNG101 construct was conjugated with rifampin-resistant (Rpr) mutants of either Ea273 or Ea321 to produce the first recombination (single crossover). The E. amylovora recombinant strains were grown in Huynh’s minimal medium (21) to select for the final recombination and excision of the vector markers, based on sensitivity to sucrose and resistance to kanamycin (Km). Finally, the colonies that grew only in Rp and 5% sucrose were selected. Mutant strains were confirmed by PCR. Pathogenicity tests in immature pears. Immature Bartlett pear fruits (Pyrus communis L.), 2 to 3 cm in diameter, were used to assay for pathogenicity of Ea273 and its mutants. The strains were grown overnight (O/N) at 26°C on LB agar with appropriate antibiotics. Colonies of bacteria were suspended to an OD600 of 0.2 in 5 mM potassium phosphate buffer, pH 6.5; pear halves were inoculated as previously described (4, 34). Infection of pear halves was assessed daily for up to 5 days after inoculation. Twelve to 16 pears were used per treatment, per experiment. Tests were repeated three times with similar results. To confirm the stability of the plasmids, ooze samples from the pears were plated on medium with appropriate antibiotics at the end of each experiment. Virulence tests in apple shoots. Actively growing apple (Malus ⫻ domestica cv. Red Delicious) shoots (30 to 40 cm long) growing in containers in a greenhouse were inoculated with strains of Ea273 and its mutants as previously described (30). The strains were grown O/N at 26°C on LB agar with appropriate antibiotics. Bacteria were resuspended in 5 mM potassium phosphate buffer, pH 6.5, to an OD600 of 0.2. Inoculation was performed by dipping a florist frog into the suspension and pressing against the unfolded and smallest folded leaves in the shoots (10). Symp-

jb.asm.org 555

Bocsanczy et al.

FIG 1 Expression assays of selected putative hrp boxes. The reporter plasmids pCPP1744 to pCPP1746, corresponding to EAM_2780, EAM_2189, and DspA/E hrp boxes, respectively, were transformed either into wild-type Ea273 or into Ea273-K49 (an hrpL mutant) as a negative control. pCPP1746 (DspA/E hrp box) was used as a positive control. The strains of E. amylovora were grown for 6 h at 20°C in Huynh’s medium to induce HrpL production followed by 4 h of incubation at 37°C in reaction buffer. GUS activity was measured in pU/CFU. The bars represent the standard errors of four replicates. The graph shows the results for one of three replicate experiments.

toms of 9 plants per treatment were monitored daily for up to 15 days after inoculation. At 8 and 15 days, the lengths of the lesions and of the corresponding shoots were measured and the results were reported as the mean percentages of shoots infected. Potassium phosphate buffer was used as the negative-control treatment, and Ea273 wild type was used as the positive control. Virulence tests were performed three times with similar results. HR tests in tobacco plants. Strains of E. amylovora and E. coli MC4100 were infiltrated at OD600s of 0.08, 0.1, 0.2, and 0.8 into N. tabacum cv. ‘Xanthi’ and N. benthamiana as previously described (39) in order to optimize concentration for each inoculation system. The best concentration for observation of HR for the E. amylovora strains was at an OD600 of 0.2, and that for the E. coli MC4100 strains was at an OD600 of 0.8. The development of HR in infiltrated areas was assessed at 8, 24, and 48 h postinoculation. Eight replicates per treatment in 2 to 4 plants per experiment were used. Experiments were repeated three times with similar results. Nucleotide sequence accession numbers. The genomic DNA sequence of Ea273 is available at NCBI under accession no. FN666575, FN666576, and FN666577.

RESULTS

The regulatory sequences of hopX1Ea and hopAK1Ea genes are active and dependent on the presence of HrpL. The combined results of the genome scanning produced a list of 28 putative hrp boxes. Table S1 in the supplemental material lists the putative hrp boxes and the genes located downstream in the genomic sequence of Ea273 (ATCC 49946). Among the results, we identified two putative hrp boxes that precede genes with homology to Eop2 (EAM_2780) and Eop3 (EAM_2190), which were analyzed further in this work. To determine the activity of the two predicted hrp boxes, we used an expression plasmid with the GUS reporter gene transformed into Ea273 wild type and into a derivative strain, Ea273K49, lacking HrpL, as a negative control for HrpL-regulated expression. As a positive control, we used pCPP1746, which contains the previously demonstrated active hrp box for DspA/E transformed into Ea273 wild type. Strong HrpL-dependent activity was demonstrated for those two promoter sequences (Fig. 1). We also tested a heterologous system in E. coli as follows: plasmid pCPP1746 was cotransformed with a plasmid that produces

556

jb.asm.org

FIG 2 Pathogenicity test in immature pears. Pears were inoculated with mutants of Ea273 as indicated, and symptoms were assessed 5 days after inoculation. Wild-type Ea273 was used as a positive control, and pears treated with potassium phosphate buffer served as negative controls. (A) Deletion of hopAK1Ea did not have an effect on virulence of Ea273. (B) Deletion of hopX1Ea did not have an effect on virulence of Ea273, but complementation of hopX1Ea, including the chaperone and promoter region, in a low-copy-number plasmid (pCPP1738) or only hopX1Ea in a high-copy-number plasmid (pCPP1737) had reduced virulence compared with the wild type or the hopX1Ea mutant. The figure shows one of three replicates of one of three experiments with similar results.

HrpL constitutively or transformed alone into E. coli DH5␣ in the absence of HrpL. We observed that the E. coli system was less responsive to GUS accumulation than the E. amylovora system (data not shown). Although there was activity for the DspA/E hrp box with the HrpL-producing plasmid, compared with the strain harboring only the DspA/E reporter plasmid, the difference was only 2-fold, in contrast with the approximately 8-fold difference observed in the E. amylovora system. Therefore, only the E. amylovora system was used to test the novel predicted hrp boxes. Deletion of hopX1Ea or hopAK1Ea does not affect pathogenicity in immature pear fruits. Deletion mutants of hopX1Ea and hopAK1Ea were created in Ea273 to determine their role in pathogenicity and virulence of E. amylovora. The pathogenicity of both mutants was tested in immature pear fruits. The symptoms caused by Ea273⌬hopX1Ea and Ea273⌬hopAK1Ea were indistinguishable from those of the wild-type strain Ea273 (Fig. 2A). Overall, we did not observe any effect of the lack of either protein in pathogenicity in immature pear fruits. HopX1Ea contributes to HR in N. tabacum and acts as an HR suppressor in N. benthamiana. We tested the HR-eliciting ability of hopX1Ea and hopAK1Ea mutants in N. tabacum and N. benthamiana. No differences were observed in HR elicitation by Ea273⌬hopAK1Ea compared with wild-type Ea273 in either N. tabacum or N. benthamiana (Fig. 3). Similarly, no difference was observed in HR elicitation between Ea273⌬hopX1Ea and Ea273 (wild type) in N. benthamiana (Fig. 3B). However, when N. tabacum was inoculated with Ea273⌬hopX1Ea, symptoms of HR were delayed and reduced compared with those induced by Ea273. At 24 h postinfiltration, HR was not apparent in the leaf panels in which suspensions of the hopX1Ea mutant had been infiltrated, in contrast to the panels in which Ea273 had been infiltrated (Fig. 3A); at 48 h, we observed a reduced HR for the hopX1Ea mutant and no change for Ea273 (results not shown). These results suggest an avirulence phenotype for HopX1Ea in N. tabacum.



FIG 3 HR test in tobacco plants. Nicotiana plants were inoculated with mutants of Ea273 at an OD600 of 0.2. Wild-type Ea273 was used as positive control, and inoculations with potassium phosphate buffer served as negative control. HR elicitation was assessed 24 h postinoculation. (A) In N. tabacum, Ea273⌬hopX1Ea does not elicit HR at 24 h. (B) None of the mutants introduced into N. benthamiana differed from the wild type; however, overexpression of HopX1Ea by Ea273⌬hopX1Ea(pCPP1737) suppressed HR.

In order to restore the wild-type HR phenotype in N. tabacum elicited by Ea273, plasmid pCPP1738, a low-copy-number plasmid containing chhopX1Ea, hopX1Ea, and the native hrp box, was constructed. Alternatively, to test for a possible gain of function in N. benthamiana, plasmid pCPP1737, a pSU23 derivative for overexpression of HopX1Ea (Table 1), was constructed. Both pCPP1737 and pCPP1738 were transformed separately into Ea273⌬hopX1Ea, and the resulting strains were tested for pathogenicity in immature pear fruits (Fig. 2B). The deletion of hopX1Ea did not result in a visible effect on the virulence of Ea273; however, when the deletion was complemented with either pCPP1738 or pCPP1737, reductions in extension and severity of the wilt symptoms were observed compared with the disease symptoms induced by the wild type or the hopX1Ea mutant. HR in both N. tabacum and N. benthamiana was tested. In N. tabacum, both Ea273⌬hopX1Ea(pCPP1738) and Ea273⌬hopX1Ea (pCPP1737) restored the wild-type phenotype (results not shown). However, in N. benthamiana, there was no effect with Ea273⌬hopX1Ea(pCPP1738), while Ea273⌬hopX1Ea(pCPP1737), which overexpresses HopX1Ea, suppressed HR elicitation by the mutant (Fig. 3B). This observation suggests that HopX1Ea acts as an HR suppressor in N. benthamiana. HR suppression by HopX1Ea in N. benthamiana was studied further. We tried to eliminate possible interference of unknown in trans effects of other putative effectors in Ea273 by transforming pCPP1737 into E. coli MC4100(pCPP430), E. coli MC4100(pCPP431), and E. coli MC4100(pCPP432) (5). pCPP430 is a cosmid containing the entire T3SS apparatus of the Ea321 pathogenicity island (31). An E. coli strain containing pCPP430 elicits HR in N. tabacum (39). pCPP431 is a fragment of pCPP430 that lacks the effectors DspA/E and HopZ3Ea as well as the putative chaperones DspB/F, OrfA, OrfC, and HrpW, and yet E. coli harboring pCPP431 elicits weak HR (5). pCPP432 is a fragment of pCPP431 in which the HrpN-coding region has been eliminated. Although it does not elicit HR, we have observed mild yellowing in the infiltrated area at 24 h after infiltration. We did not transform pCPP1738 into MC4100(pCPP430) or its derivatives due to incompatibility of the


FIG 4 HopX1Ea functions as an HR suppressor in N. benthamiana; however, it contributes to HR in N. tabacum. Nicotiana plants were inoculated with EcoMC4100 strains harboring pCPP430, pCPP431, or pCPP432 alone or together with pCPP1737 (overexpressing HopX1Ea) at an OD600 of 0.8. Inoculations with potassium phosphate buffer served as negative control. HR elicitation was assessed 24 h postinoculation. (A) In N. tabacum, the expression of HopX1Ea enhanced HR of EcoMC4100(pCPP431). (B) In N. benthamiana, the expression of HopX1Ea reduced drastically the HR of EcoMC4100(pCPP430).

cosmid pCPP430 and the plasmid pCPP1738. When inoculated in N. tabacum, E. coli MC4100(pCPP431, pCPP1737) produced a strong HR with full necrosis compared with the characteristic much-weaker HR of pCPP431 (Fig. 4A). Similarly, overexpression of HopX1Ea in E. coli MC4100(pCPP432) produced yellowing of increased intensity compared to slight yellowing in response to E. coli MC4100 (pCPP432) alone (results not shown). These results support the hypothesis that HopX1Ea acts as an avirulence factor in N. tabacum. When inoculated into N. benthamiana, E. coli MC4100(pCPP430, pCPP1737) did not elicit HR by 24 h, in contrast with the complete collapse observed for E. coli MC4100(pCPP430) (Fig. 4B). This supports the hypothesis that HopX1Ea acts as an HR suppressor in N. benthamiana. No difference in HR symptoms was observed when E. coli MC4100(pCPP431, pCPP1737) and E. coli MC4100(pCPP431) were infiltrated in N. benthamiana, which suggests that HopX1Ea might suppress HR possibly elicited by either DspA/E, HopZ3Ea, and/or HrpW, all of which are present in pCPP430 but not in pCPP431. HopX1Ea contributes to resistance of apple to fire blight and might function as an avirulence gene in apple. The virulence of both hopX1Ea and hopAK1Ea mutants of Ea273 was tested on apple shoots by determining the extent of lesion development in this host tissue (Fig. 5A). Virulence of the mutants and wild-type strain Ea273 did not differ significantly (Fig. 5B). When apple shoots were inoculated with either Ea273⌬hopX1Ea(pCPP1738), expressing HopX1 by the native promoter HrpL, or Ea273⌬hopX1Ea(pCPP1737), in which HopX1 is overexpressed, virulence was reduced compared with the virulence of Ea273.

jb.asm.org 557

Bocsanczy et al.

FIG 5 Virulence assay in apple shoots. Apple shoots of 20 to 40 cm were inoculated with Ea273 mutants and complemented strains as indicated. Wildtype Ea273 was used as a positive control, and inoculations with potassium phosphate buffer served as negative controls. Deletions of hopX1Ea and hopAK1Ea do not affect virulence of Ea273 on apple shoots; however, overexpression of hopX1Ea in Ea273⌬hopX1Ea(pCPP1737) reduced the severity of symptoms significantly. (A) Pictures of symptomatic apple shoots at 5 days after inoculation. (B) Disease progress at 8 days after inoculation measured as the percentage of the length of symptomatic shoots versus the total length of the shoot. The values for each strain are the means of nine samples per treatment from one experiment. The bars represent standard errors. Values with the same capital letters do not differ significantly at the P ⫽ 0.05 level. The experiment was repeated three times.

However, only the reduction in virulence of Ea273⌬hopX1Ea (pCPP1737) differed significantly from the virulence of wild-type strain Ea273. These results suggest that HopX1Ea might be recognized by apple, in which it triggers a heightened defense response. Although the amounts of protein produced during interaction with host tissues were not quantified, the difference in intensity of disease between the mutant and its complemented strain suggested that HopX1Ea produced in larger-than-natural amounts may partially override the effects of DspA/E on the host. DISCUSSION

In this study, we used bioinformatics to identify putative HrpLregulated genes in the genome of E. amylovora Ea273 (ATCC 49946) (33). We identified 28 genes potentially dependent on HrpL and confirmed the HrpL dependency of HopX1Ea and HopAK1Ea. We characterized pathogenicity and HR of these T3SS proteins, and we found that HopX1Ea functions as an avirulence gene in apple shoots and in the nonhost plant N. tabacum and that it acts as a suppressor of the HR in the nonhost plant N. benthamiana. The HMM profiles developed in this study to predict putative hrp boxes were based on promoter sequences previously identified for P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A (16, 17) and hrp boxes characterized in E. amylovora (31). The recent work of Yang et al. (40) identified 73 genes preceded by putative hrp boxes in Dickeya dadantii using HMM profiles based on a training set of 69 hrp boxes from E. amylovora, D. dadantii, Pectobacterium atrosepticum, and P. syringae. Only one orthologous gene was common to our findings. Interestingly, hopX1Ea

558

jb.asm.org

and hopAK1Ea were not present in the D. dadantii genome, as orthologs of the latter sequences were sought in the ASAP database, indicating that the two pathogens have diverged in their pathogenic strategies. Recent independent analyses of the HrpL regulon of Ea1189 using the published genome of ATCC 49946 for the bioinformatics analysis identified 16 genes directly regulated by HrpL (26). Our work predicted nine common genes with the latter, including four encoding the T3SS-associated proteins: avrRpt2Ea, hopPtoCEa, hopX1Ea (eop3), and hopAK1Ea (eop2) (see Table S1 in the supplemental material). Forty-four percent of the set of genes predicted in our work probably differ because the profiles used differ in the set of hrp boxes and the alignment of the training set. As in previous work (16, 17, 26, 37, 40), our profiles are conserved in the ⫺35 region of the promoter sequences; however, they differ in the spacer region length and the ⫺10 region (GGAAC-19-20-ACNNA). These differences are enough to identify different promoter sequences on the same genome or produce different scores. For example, in our work, the hrp box of hopX1Ea was predicted only by a profile based on only a P. syringae training set, while the hrp box for avrRpt2Ea was predicted only by a profile based solely on E. amylovora promoter sequences. The hrp box sequences of hopX1Ea and hopAK1Ea were tested with a GUS expression system in E. amylovora using the promoter sequence of DspA/E as a positive control, confirming the functionality of the former two sequences. We also tested the positive control with an E. coli system that proved to be less responsive. This may be due to the presence of endogenous GUS in E. coli, which might obscure the quantitative difference between negative control and a responsive promoter. The putative effector HopX1Ea is a homolog of the HopX1 family (previously AvrPphE) of avirulence proteins in P. syringae, which has been related to host specificity of diverse pathovars of P. syringae (35) and HR suppression (22). Although a conserved domain was not identified by PSI-BLAST, when HopX1Ea was aligned with other proteins of the same family by using the global alignment Clustal W method, we observed the putative catalytic triad of a cysteine protease domain. The cluster containing the hrp box, the putative chaperone, and the candidate effector coding sequences is not located in any T3SS island. The 5= region of this cluster carries a pseudogene with similarity to a protease gene while the downstream region carries a gene with no similarity in the nr database of NCBI. The presence of the pseudogene suggests that the cluster might be an insertion in the enteric core genome. HopAK1Ea is a member of the HopAK1 (previously HopPmaH) family of helpers in P. syringae. HopAK1Ea contains a conserved pectate-lyase (Pel) domain at its C terminus, which is associated with helper proteins or harpins in plant-pathogenic bacteria. hopAK1Ea is not included in any cluster of T3SS-associated genes. It seems to be an isolated insertion in an enterobacterial core sequence, suggested by the presence of an integrase coding sequence in the 5= region and the altered G⫹C content. For this reason, it is difficult to predict a potential target effector in order to test for a function as a translocator. In our virulence and HR elicitation evaluations, HopAK1Ea did not affect virulence or HR; however, we observed a delayed HR when a hopX1Ea mutant was inoculated into N. tabacum. The lack of phenotype for HopAK1Ea does not preclude a potential role in aiding translocation of effectors whose functions in virulence are redundant (32). Tests involving translocation assays are proposed



to reveal a potential function of HopAK1Ea as a translocator of a yet-unspecified effector protein. Interestingly, we observed that the lack of HopX1Ea in an Ea273 strain caused a delay in the appearance of HR following infiltration into N. tabacum, while its lack did not affect HR elicitation in N. benthamiana. The difference in phenotype between the two closely related, nonhost species suggests that HopX1Ea may function as an HR suppressor, as do other members of the HopX1 family. The suppressor might be superseded by an avirulence phenotype in a plant that would have an “R” gene that recognizes HopX1Ea, as, for example, N. tabacum (Fig. 3A). We determined that HopX1Ea acts as an HR suppressor in N. benthamiana using a gain-of-function approach with the native system. Thus, the Ea273 hopX1Ea mutant complemented with a plasmid (pCPP1737) overexpressing HopX1Ea suppressed HR elicitation in N. benthamiana. Its sequence has the conserved catalytic triad associated with the suppression phenotype of this family of effectors (28). To observe gain of function in N. tabacum, we used a heterologous system with E. coli. When an E. coli strain, capable of HR elicitation, complemented with a plasmid expressing HopX1Ea [EcoMC4100(pCPP430, pCPP1737)] was inoculated into N. benthamiana, HR was suppressed (Fig. 4B). In contrast, when an E. coli strain incapable of producing strong HR expressing HopX1Ea [EcoMC4100(pCPP431, pCPP1737)] was inoculated into N. tabacum, it caused an intense HR (Fig. 4A). Members of the HopX family of effector proteins are known as avirulence factors that contribute to host specificity in cultivars of bean (Phaseolus vulgaris) (35) or HR suppression (22) when the corresponding R gene is not present in the host. The presence of other pathogenicity factors might undermine or abolish plant defense responses, obscuring the observable effects on virulence in host plants. Alternatively, HopX1Ea could act as an HR suppressor also in host plants, and based on redundant functions of other effectors, its phenotype would not be detected. To investigate this possibility, we tested virulence in immature pear fruit of Ea273⌬hopX1Ea(pCPP1738), the low-copy-number plasmidcomplemented mutant, and Ea273⌬hopX1Ea(pCPP1737), the HopX1Ea-overexpressing strain. Although not conclusive, it seems that the presence of HopX1Ea in trans reduced disease symptoms (Fig. 2B), suggesting an avirulence phenotype rather than an HR suppressor phenotype. The fact that a mutant of DspA/E is nonpathogenic (7) favors the avirulence phenotype hypothesis, because if HopX1Ea were suppressing HR in a background lacking DspA/E, the phenotype would be somewhat virulent. To confirm this phenotype, we inoculated both complemented mutants into apple shoots and measured the resulting lesions. Strikingly, there was a visible reduction in symptoms induced by the strain overexpressing HopX1Ea during the first 5 days of disease progress (Fig. 5A). Overall, there was a significant reduction in virulence after 8 days of disease progress (Fig. 5B). These results confirmed that HopX1Ea is recognized by apple, triggering a heightened defense response. As we suspected, the avirulence phenotype is not observed in an infection with a wild-type pathogenic strain, possibly because the strong effect of DspA/E overcomes the increase in defense response triggered by HopX1Ea. This suggests that the effect might be quantitative, because increasing the expression of HopX1Ea produces a visible reduction in virulence in apple. In summary, HopX1Ea is a T3SS effector protein, which con-


tributes to resistance in its apple host and is regulated directly by HrpL. ACKNOWLEDGMENTS We thank Bryan Swingle for providing the plasmids and technical advice used for work with the GUS expression reporter system, Julian Parkhill for helpful suggestions on the manuscript, Nicole Perna for access to the ASAP database, Kent Loeffler for photography, Herb Aldwinckle for providing immature pear fruits, and Jacqueline Nock and Christopher Watkins for storing them in controlled atmospheres for use throughout the year. This work was supported by NSF/USDA CSREES Microbial Genome Sequencing grant 2004-35600-14258.

REFERENCES 1. Alfano JR, Collmer A. 2004. Type III secretion system effector proteins: double agents in bacterial disease and plant defense. Annu. Rev. Phytopathol. 42:385– 414. 2. Ausubel FM, et al (ed). 1998. Current protocols on CD-ROM user’s guide. Current protocols in molecular biology. John Wiley & Sons, Inc, Hoboken, NJ. 3. Bartolome B, Jubete Y, Martinez E, de la Cruz F. 1991. Construction and properties of a family of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives. Gene 102:75–78. 4. Bauer DW. 1990. Molecular genetics of pathogenicity of Erwinia amylovora: techniques, tools and their applications. Ph.D. dissertation. Cornell University, Ithaca, NY. 5. Bauer DW, Beer SV. 1991. Further characterization of an hrp gene-cluster of Erwinia amylovora. Mol. Plant Microbe Interact. 4:493– 499. 6. Bertani G. 1951. Studies on lysogenesis. I. The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol. 62:293–300. 7. Bogdanove AJ, Bauer DW, Beer SV. 1998. Erwinia amylovora secretes DspE, a pathogenicity factor and functional AvrE homolog, through the hrp (type III secretion) pathway. J. Bacteriol. 180:2244 –2247. 8. Bogdanove AJ, et al. 1998. Homology and functional similarity of an hrp-linked pathogenicity locus, dspEF, of Erwinia amylovora and the avirulence locus avrE of Pseudomonas syringae pathovar tomato. Proc. Natl. Acad. Sci. U. S. A. 95:1325–1330. 9. Bogdanove AJ, Wei ZM, Zhao LP, Beer SV. 1996. Erwinia amylovora secretes harpin via a type III pathway and contains a homolog of YopN of Yersinia spp. J. Bacteriol. 178:1720 –1730. 10. Bonasera JM, Kim JF, Beer SV. 2006. PR genes of apple: identification and expression in response to elicitors and inoculation with Erwinia amylovora. BMC Plant Biol. 6:23-. 11. Bonn WG, van der Zwet T. 2000. Distribution and economic importance of fire blight, p 37–54. In Vanneste JL (ed), Fire blight: the disease and its causative agent, Erwinia amylovora. CABI Publishing, Wallingford, Oxon, United Kingdom. 12. Buttner D, Bonas U. 2006. Who comes first? How plant pathogenic bacteria orchestrate type III secretion. Curr. Opin. Microbiol. 9:193–200. 13. Charkowski AO, et al. 1998. The Pseudomonas syringae pv. tomato HrpW protein has domains similar to harpins and pectate lyases and can elicit the plant hypersensitive response and bind to pectate. J. Bacteriol. 180: 5211–5217. 14. Dale C, Young SA, Haydon DT, Welburn SC. 2001. The insect endosymbiont Sodalis glossinidius utilizes a type III secretion system for cell invasion. Proc. Natl. Acad. Sci. U. S. A. 98:1883–1888. 15. Eddy SR. 1998. Profile hidden Markov models. Bioinformatics 14: 755–763. 16. Ferreira AO, et al. 2006. Whole-genome expression profiling defines the HrpL regulon of Pseudomonas syringae pv. tomato DC3000, allows de novo reconstruction of the Hrp cis clement, and identifies novel coregulated genes. Mol. Plant Microbe Interact. 19:1167–1179. 17. Fouts DE, et al. 2002. Genomewide identification of Pseudomonas syringae pv. tomato DC3000 promoters controlled by the HrpL alternative sigma factor. Proc. Natl. Acad. Sci. U. S. A. 99:2275–2280. 18. Fu ZQ, Guo M, Alfano JR. 2006. Pseudomonas syringae HrpJ is a type III secreted protein that is required for plant pathogenesis, injection of effectors, and secretion of the HrpZ1 harpin. J. Bacteriol. 188:6060 – 6069. 19. Geider K. 2000. Exopolysaccharides of Erwinia amylovora: structure, biosynthesis, regulation, role in pathogenicity of amylovoran and levan, p

jb.asm.org 559

Bocsanczy et al.

20. 21. 22. 23. 24. 25. 26.

27. 28.

29.

560

117–140. In Vanneste JL (ed), Fire blight: the disease and its causative agent, Erwinia amylovora. CABI Publishing, Wallingford, Oxon, United Kingdom. Hueck CJ. 1998. Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol. Mol. Biol. Rev. 62:379 – 432. Huynh TV, Dahlbeck D, Staskawicz BJ. 1989. Bacterial blight of soybean. Regulation of a pathogen gene determining host cultivar specificity. Science 245:1374 –1377. Jamir Y, et al. 2004. Identification of Pseudomonas syringae type III effectors that can suppress programmed cell death in plants and yeast. Plant J. 37:554 –565. Jefferson RA, Kavanagh TA, Bevan MW. 1987. Beta-glucuronidase (Gus) as a sensitive and versatile gene fusion marker in plants. J. Cell. Biochem. 11B:57. Kaniga K, Delor I, Cornelis G. 1991. A wide-host-range suicide vector for improving reverse genetics in Gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene 109:137–141. Lee J, et al. 2001. HrpZ (Psph) from the plant pathogen Pseudomonas syringae pv. phaseolicola binds to lipid bilayers and forms an ionconducting pore in vitro. Proc. Natl. Acad. Sci. U. S. A. 98:289 –294. McNally RR, et al. 10 August 2011. Genetic characterization of the HrpL regulon of the fire blight pathogen Erwinia amylovora reveals novel virulence factors. Mol. Plant Pathol. [Epub ahead of print.] doi:10.1111/ j.1364-3703.2011.00738.x. Mudgett MB. 2005. New insights to the function of phytopathogenic bacterial type III effectors in plants. Annu. Rev. Plant Biol. 56:509 –531. Nimchuk ZL, Fisher EJ, Desveaux D, Chang JH, Dangl JL. 2007. The HopX (AvrPphE) family of Pseudomonas syringae type III effectors require a catalytic triad and a novel N-terminal domain for function. Mol. Plant Microbe Interact. 20:346 –357. Norelli JL, Aldwinckle HS, Beer SV. 1984. Differential host X pathogen interactions among cultivars of apple and strains of Erwinia-Amylovora. Phytopathology 74:136 –139.

jb.asm.org

30. Oh CS, Beer SV. 2005. Molecular genetics of Erwinia amylovora involved in the development of fire blight. FEMS Microbiol. Lett. 253:185–192. 31. Oh CS, Kim JF, Beer SV. 2005. The Hrp pathogenicity island of Erwinia amylovora and identification of three novel genes required for systemic infection. Mol. Plant Pathol. 6:125–138. 32. Schneider DJ, Collmer A. 2010. Studying plant-pathogen interactions in the genomics era: beyond molecular Koch’s postulates to systems biology. Annu. Rev. Phytopathol. 48:457– 479. 33. Sebaihia M, et al. 2010. Complete genome sequence of the plant pathogen Erwinia amylovora strain ATCC 49946. J. Bacteriol. 192:2020 –2021. 34. Steinberger EM, Beer SV. 1988. Creation and complementation of pathogenicity mutants of Erwinia amylovora. Mol. Plant Microbe Interact. 1:135–144. 35. Stevens C, et al. 1998. Sequence variations in alleles of the avirulence gene avrPphE.R2 from Pseudomonas syringae pv. phaseolicola lead to loss of recognition of the AvrPphE protein within bean cells and a gain in cultivar-specific virulence. Mol. Microbiol. 29:165–177. 36. Swingle B, et al. 2008. Characterization of the PvdS-regulated promoter motif in Pseudomonas syringae pv. tomato DC3000 reveals regulon members and insights regarding PvdS function in other pseudomonads. Mol. Microbiol. 68:871– 889. 37. Vencato M, et al. 2006. Bioinformatics-enabled identification of the HrpL regulon and type III secretion system effector proteins of Pseudomonas syringae pv. phaseolicola 1448A. Mol. Plant Microbe Interact. 19: 1193–1206. 38. Wei ZM, Beer SV. 1995. hrpL activates Erwinia amylovora hrp gene transcription and is a member of the ECF subfamily of sigma factors. J. Bacteriol. 177:6201– 6210. 39. Wei ZM, et al. 1992. Harpin, elicitor of the hypersensitive response produced by the plant pathogen Erwinia amylovora. Science 257:85– 88. 40. Yang S, et al. 2010. Genome-wide identification of HrpL-regulated genes in the necrotrophic phytopathogen Dickeya dadantii 3937. PLoS One 5:e13472.
