Horticulture Research

The Fifth International Horticulture Research Conference July 20-24, 2018 Beijing, China

Program and Abstracts

Organized by China Agricultural University Horticulture Research Beijing Collaborative Innovation Center for Ecoenvironmental Improvement with Forestry and Fruit Trees Nanjing Agricultural University

Conference Convener

Zhenhai Han, China Agricultural University

Conference Co-convener

Zong-Ming Cheng, Nanjing Agricultural University/ University of Tennessee

Local Organizing Committee

Yuncong Yao, Beijing University of Agriculture, Chair Xiaolan Zhang, China Agricultural University Ling Qin, Beijing University of Agriculture Ji Tian, Beijing University of Agriculture Changpeng Qiu, China Agricultural University

International Scientific Committee

Xiuxin Deng, Huazhong Agricultural University Yongchen Du, Chinese Academy of Agricultural Sciences Yi Li, University of Connecticut

Sponsored by 王宽诚教育基金会

Conference Program

th

Jul. 20 , 2018 (Friday) 12:00-20:00

Conference Registration The First Floor Hall of Kuntai Novel Hotel Beijing

18:30-21:00

Dinner: The First Floor Cafe and Chinese Restraunt of Kuntai Novel Hotel Beijing th

Jul. 21 , 2018 (Saturday) 7:30-8:30

8:30-8:50 8:50-9:20 9:20-10:00 10:00-10:40 10:40-11:00 11:00-11:40 11:40-13:30 14:00-14:40

14:40-15:20 15:20-16:00 16:00-16:20 16:20-17:00 17:00-17:40 17:40-18:30 18:30-20:30

Breakfast: The First Floor Cafe and Chinese Restraunt of Kuntai Novel Hotel Beijing Conference Report Place: The Second Floor Banquet Hall of Kuntai Novel Hotel Beijing

Moderator

Opening Ceremony Welcome Remark by President of Beijing University of Agriculture Welcome Remark by Convener Group Photo, the front of Kuntai Novel Hotel Speaker: William J. Lucas, University of California, Davis, USA. Cucumber as a Model System to Study Agricultural Traits Controlled by the Plant Vascular System Speaker: Jiayang Li, Academician of Chinese Academy of Sciences, China.

Zongming Cheng

Rice shoot architecture: its molecular basis and breeding Tea Break Speaker: Ton Bisseling, Wageningen University, Netherlands. Evolution of legume nitrogen fixing root nodule symbiosis Lunch: The Second Floor Multifunctional Hall, the First Floor Cafe and Chinese Restranut of Kuntai Novel Hotel Beijing Speaker: Zhenbiao Yang, University of California, Riverside, USA; Fujian Agriculture and Forestry University, China. Mechanical Responses in Plants: Feeling and Coping with Mechanical Stress Speaker: Fred Gmitter, University of Florida, USA. Comparative Genome Sequence Analysis Sheds Light on the Origins and Evolution of Modern Citrus Species and Cultivar Groups Speaker: Rebecca Grumet, Michigan State University, USA. The CucCAP project: Leveraging applied genomics to increase disease resistance in cucurbit crops Tea Break Speaker: Andrew Thompson, Cranfield University, UK. Genetics and phenotyping of rootstock traits in tomato Speaker: Silin Zhong, The Chinese University of Hong Kong, China. The fruit ENCODE project: use functional genomics to probe the evolutionary origins of fleshy fruit Poster Evaluation Dinner: The Second Floor Banquet Hall, the First Floor Cafe and Chinese Restranut of Kuntai Novel Hotel Beijing

Jihua Yu

Xiaolan Zhang Jun Wu Yuncong Yao

th

Jul. 22 , 2018 (Sunday) 7:30-8:30

8:30-9:00 9:00-9:30 9:30-10:00 10:00-10:20 10:20-10:50 10:50-11:20

Breakfast: The First Floor Cafe and Chinese Restraunt of Kuntai Novel Hotel Beijing Conference Report (Parallel Group one&two -session 3.5.6.7) Place: The First Floor 11 meeting room of Kuntai Novel Hotel Beijing Group 1: Stress Biology and Postharvest Biology Speaker: Xiaohan Yang, Oak Ridge National Laboratory, USA. Implementation of drought avoidance mechanisms for sustainable crop production Speaker: Michitaka Notaguchi, Nagoya University, Japan. Advances on plant grafting Speaker: Jihong Liu, Huazhong Agricultural University, China. Function and transcriptional regulation of abiotic stress-responsive genes in Citrus and its related genera Tea Break Speaker: Tianzhong Li, China Agricultural University, China. A new actin severing protein invovled in apple self-incompatability Speaker: Yongping Duan, USDA, USA. Progress toward understanding citrus huanglongbing complex

Moderator

Fred Gmitter

Silin Zhong

11:20-11:50

Speaker: Tongkun Liu, Nanjing Agricultural University, China. Cold acclimation alters DNA methylation patterns in Brassica rapa and confers tolerance to heat and high growth rate

12:00-13:30

Lunch: The Second Floor Banquet Hall, The First Floor Cafe Restranut of Kuntai Novel Hotel Beijing

13:30-14:00

Group 2: Horticultural Crop Developmental Biology and Genetic Modification Speaker: Jun Wu, Nanjing Agricultural University, China. Diversification,domestication and functional genomics of pear

14:00-14:30

Speaker: Xiaolan Zhang, China Agricultural University, China. Molecular mechanism of fruit shape regulation in cucumber

14:30-15:00

Speaker: Chizuko Yamamuro, Fujian Agriculture and Forestry University, China. Cross-talks among plant hormones coordinate receptacle fruit growth and ripening in diploid strawberry Fragaria vesca

15:00-15:30 15:30-15:50 15:50-16:20 16:20-16:50 16:50-17:20 17:30-19:00 19:00-21:00 19:00-21:00 19:00-19:20 19:20-19:40 19:40-20:00 20:00-20:20 20:20-20:40 20:40-21:00

Silin Zhong

Xiaohan Yang

Speaker: Yuncong Yao, Beijing University of Agriculture, China. Flavonoid biosynthesis in Malus crabapple Tea Break Speaker: Aman Ullah Malik, University of Agriculture, Faisalabad, Pakistan. Value Chain Improvement of Mango Industry in Pakistan: Approaches, Achievements and Challenges Speaker: Yingyan Han, Beijing University of Agriculture, China. Analysis of Hormones and Transcriptome in the Process of Bloting in lettuce

Yongping Duan

Speaker: Baohong Zhang, The East Carolina University, USA. MicroRNA-mediated biotechnology for improving plant tolerance to abiotic stress Dinner: The Second Floor Multifunctional Hall, the First Floor Cafe and Chinese Restranut of Kuntai Novel Hotel Beijing Jun Wu Parallel Activity 1: Poster Communication and Evaluation Parallel Activity 2: Journal Session Horticulture Research Molecular Plant Horticultural Plant Journal Zongming Cheng Genomics, Proteomics and Bioinformat Journal of Integrative Plant Biology Journal Experimental Botany th

Jul. 22 , 2018 (Sunday) 7:30-8:30

8:30-9:10 9:10-9:40 9:40-10:10 10:10-10:30 10:30-11:00 11:00-11:30 11:30-12:00 12:00-13:30 13:30-14:00

Breakfast: The First Floor Cafe and Chinese Restraunt of Kuntai Novel Hotel Beijing Conference Report (Parallel Group three-session 1.2.4.8.9) Place: The Ground Floor 12 Meeting Room of Kuntai Novel Hotel Beijing Group 3: Horticultural Crop Production and Protected Culture Speaker: Christine Raines, University of Essex, UK. Opportunities to improve yield by manipulation of photosynthesis Speaker: Yves Desjardins, Laval University, Canada. Prebiotic-like effects of fruit and vegetables polyphenols Speaker: Wei Guo, The University of Tokyo, Japan. Multi-scale imaging techniques for horticultural phenotyping - case studies from UTokyo International Field Phenomics Research laboratory Tea Break Speaker: Zhirong Zou, Northwest A&F University, China. The use of red and far-red light in protected horticultural production Speaker: Marcin Nowicki, University of Tennessee, USA. Genetic structure of the native Cornus kousa (Asian dogwood) populations from Eastern Asia Speaker: Bo Li, NIAB EMR, UK.

Moderator

Marcin Nowicki

Yves Desjardins

Imaging techniques for fruit phenotyping

Lunch: The Second Floor Banquet Hall, the First Floor Cafe Restranut of Kuntai Novel Hotel Beijing Speaker: Feishi Luan, Northeast Agricultural University, China. Development of SNP Markers and Genes Mining of Important Traits in Watermelon and Melon

Christine Raines

14:00-14:30

Speaker: Aoxue Wang, Northeast Agricultural University, China. Improving tomatos' broad spectrum resistance to diseases by Clonostachys Rosea primed tomato defense to Botrytis Cinerea

14:30-15:00

Speaker: Xuming Huang, South China Agricultural University, China. A Cross-species Study of Fruit Ca Uptake and Distribution Patterns Reveals Common Features in Fruit Ca Uptakes

15:00-15:30 15:30-15:50 15:50-16:20

16:20-16:50 16:50-17:20 17:30-19:00

Christine Raines

Speaker: Biyan Zhou, South China Agricultural University, China. Mature leaves and young leaves, opposite roles in litchi flowering Tea Break Speaker: Bing Cao, Ningxia University, China. Evaluation of a modified open-top chamber simulation system on the study of elevated CO2 concentration effects on Lycium barbarum Speaker: Yangyong Zhang, Chinese Academy of Agricultural Sciences, China. Creation of Chinese kale fertility-restorers and application to recover the fertility of Ogura CMS cabbage with clubroot-resistance

Hongyi Dai

Speaker: Sezai Ercişli, Ataturk University, Turkey. Apricot: Morphological, biochemical and molecular aspect Dinner: The Second Floor Multifunctional Hall, the First Floor Cafe and Chinese Restranut of Kuntai Novel Hotel Beijing th

Jul. 23 , 2018 (Monday) 7:00-8:00

8:00-8:25

Breakfast: The First Floor Cafe and Chinese Restraunt of Kuntai Novel Hotel Beijing Conference Report Place: The Second Floor Banquet Hall of Kuntai Novel Hotel Beijing Speaker: Juyou Wu, Nanjing Agricultural University, China. PbrPLDδ1-derived phosphatidic acid mitigates S-RNase signalling in pear

8:25-8:50

Speaker: Aide Wang, Shenyang Agricultural University, China. The regulation of ethylene biosynthesis in apple fruit ripening

8:50-9:15

Speaker: Xueren Yin, Zhejiang University, China. Transcription factors regulated persimmon fruit postharvest deastringency and softening

9:15-9:40

Speaker: Shuang Wu, Fujian Agriculture and Forestry University, China. Trichome morphogenesis and MYC1 mediated terpene biosynthesis in tomato

9:40-10:05 10:05-10:20 10:20-10:45

Speaker: Hongliang Zhu, China Agricultural University, China. Mutagenesis of long non coding RNA alters tomato fruit ripening

11:05-11:30

Speaker: Cao Xu, University of Chinese Academy of Sciences, China. Evolutionary rewiring of plant stem cell circuitry

12:00-13:30 13:30-13:55 13:55-14:20 14:20-14:45 14:45-15:10 15:10-15:25 15:25-15:50

Hongliang Zhu

Speaker: Pei Xu, Zhejiang Academy of Agricultural Sciences, China. Orphan genes are involved in drought adaptations and ecoclimatic-oriented selections in domesticated cowpea Tea Break Speaker: Feng Li, Huazhong Agricultural University, China. PepperHub, an Informatics Hub for the chili pepper research community

10:45-11:05

11:30-11:55

Moderator

Aide Wang

Speaker: Zhaobo Lang, Chinese Academy of Sciences, China. Epigenetic regulation of Fruit ripening Lunch: The Second Floor Multifunctional Hall, the First Floor Cafe and Chinese Restranut of Kuntai Novel Hotel Beijing Speaker: Nan Ma, China Agricultural University, China. Ethylene promotes flower opening via enhancing asymmetric growth of petal base in roses Speaker: Rui Xia, South China Agricultural University, China. Preliminary study of flower sex differentiation in litchi (Litchi chinensis Sonn.) Feng Li Speaker: Feng Cheng, Chinese Academy of Agricultural Sciences, China. Genome evolution and the formation of heading leaf in Brassica rapa Speaker: Jinghua Yang, Zhejiang University, China. Genetic control of branching and flowering in leafy Brassica juncea Tea Break Speaker: Li Yuan, Northwest A&F University, China. Jinghua Yang Central cell fate determination, Apomixis and watermelon breeding

15:50-16:15

Speaker: Yi Shang, Yunnan Normal University, China. Biosynthesis, regulation, and detoxification of bitterness in cucurbit plants

16:15-16:40

Speaker: Ting Wu, China Agricultural University, China. Natural Variation Underlies Differences in ERFs Activity in Apple Fruit texture and Fruit Peel Degreening

16:40-17:05

Speaker: Xia Cui, Chinese Academy of Agricultural Sciences, China. Identifications of loci and genes contributing the phenotypic variations between wild and cultivated tomatoes

17:10-17:50 18:00-19:30

Closing Remarks Poster Award Announcement by Vice-President of Beijing University of Agriculture Closing remarks by Co-convener Dinner: The First Floor Chinese Restraunt of Kuntai Novel Hotel Beijing

Jinghua Yang

Zhenhai Han

Abstracts

INDEX 1.Cucumber as a Model System to Study Agricultural Traits Controlled by the Plant Vascular System……………………………………………………………………………………………1 2.The evolution of the nitrogen fixing root nodule symbiosis; how to live from air……2 3.Mechanical Responses in Plants: Feeling and Coping with Pressures……………………4 4.Comparative Genome Sequence Analysis Sheds Light on the Origins and Evolution of Modern Citrus Species and Cultivar Groups……………………………………………………………5 5.The CucCAP project: Leveraging applied genomics to increase disease resistance in cucurbit crops……………………………………………………………………………………………6 6.Genetics and phenotyping of rootstock traits in tomato…………………………………………7 7.The fruit ENCODE project: use functional genomics to probe the evolutionary origins of fleshy fruit………………………………………………………………………………………………8 8.Implementation of Drought Avoidance Mechanisms for Sustainable Crop Production…………9 9.Advances on plant grafting……………………………………………………………………10 10.A new actin severing protein invovled in apple self-incompatability…………………11 11.Cold acclimation alters DNA methylation patterns in Brassica rapa and confers tolerance to heat and high growth rate………………………………………………………………………12 12.Diversification, domestication and functional genomics of pear………………………13 13.Molecular mechanism of fruit shape regulation in cucumber……………………………14 14.Plant hormones coordinate receptacle fruit development in Fragaria vesca…………………15 15.Flavonoids biosynthesis in crabapple…………… ………………………… ……… 16 16.Mango Value Chain Improvement in Pakistan: Approaches, Achievements and Challenges…17 17.Analysis of Hormones and Transcriptome in the Process of Bloting in lettuce………………18 18.MicroRNA-mediated biotechnology for improving plant tolerance to abiotic stress…………20 19.Prebiotic-like effects of fruit and vegetables polyphenols……………………………………21 20.Opportunities to improve yield by manipulation of photosynthesis…………………………22

.

21.Imaging techniques for horticultural phenotyping - case studies from UTokyo International Field Phenomics Research laboratory…………………………………………………………23 22.The use of red and far-red light in protected horticultural production…………………………24 23.Genetic structure of the native Cornus kousa (Asian dogwood) populations from Eastern Asia……………………………………………………………………………………………25 24.The application of advanced imaging techniques to fruit phenotyping………………………26 25.An Ultra-genomic Variation Map Reveals Evidence of Selective Sweeps in Melon Domestication…………………………………………………………………………………27 26.Improving tomatos' broad spectrum resistance to diseases by Clonostachys Rosea primed tomato defense to Botrytis Cinerea…………………………………………………………28 27.A Cross-species Study of Fruit Ca Uptake and Distribution Patterns Reveals Common Features in Fruit Ca Uptakes……………………………………………………………………………29 28.Mature leaves and young leaves, opposite roles in litchi flowering…………………………30 29.Evaluation of a modified open-top chamber simulation system on the study of elevated CO2 concentration effects on Lycium barbarum…………………………………………………31 30.Creation of Chinese kale fertility-restorers and application to recover the fertility of Ogura CMS cabbage with clubroot-resistance…………………………………………………………33 31.Apricot: Morphological, biochemical and molecular aspect…………………………34 32.PbrPLDδ1-derived phosphatidic acid mitigates S-RNase signaling in pear…………………35 33.The regulation of ethylene biosynthesis in apple fruit ripening……………………………36 34.Transcription factors regulated persimmon fruit postharvest deastringency and softening……37 35.Trichome morphogenesis and MYC1 mediated terpene biosynthesis in tomato………………38 36.Orphan genes are involved in drought adaptations and ecoclimatic-oriented selections in domesticated cowpea…………………………………………………………………………39 37.PepperHub, an Informatics Hub for the chili pepper research community……………………40 38.Mutagenesis of long non coding RNA alters tomato fruit ripening………………………41 39.Ethylene promotes flower opening via enhancing asymmetric growth of petal base in roses……………………………………………………………………………………………42 40.Genome evolution and the formation of heading leaf in Brassica rapa……………………43 41.Phytochrome A signal transduction 1 and CONSTANS-LIKE 13 coordinately orchestrate

vegetative branching and flowering in leafy Brassica juncea………………………………44 42.Central Cell Fate Determination, Apomixis and Watermelon Breeding………………………45 43.Biosynthesis, regulation, and detoxification of bitterness in cucurbit plants……………46 44.Natural Variation Underlies Differences in ERFs Activity in Apple Fruit texture and Fruit Peel Degreening……………………………………………………………………………………47 45.Identifications of loci and genes contributing the phenotypic variations between wild and cultivated tomatoes …………… ……………………………………………… ……… 48 46.PERFORMANCE OF MUSAMBI SWEET ORANGE ON ROUGH LEMON AND VOLKAMERIANA ROOTSTOCKS…………………………………………………………49 47.A new class of plant virus resistance gene, eukaryotic translation initiation factor 2B-beta (eIF2Bβ), and its natural variation in Brassica………………………………………………50 48.Molecular basis of Coconut fruit development and lipid accumulation………………………51 49.Analysis of genetic diversity of partial phenotypic traits in guava seedling strains…………52 50.Methylation analysis of dormancy breaking in almond flower buds (Prunus dulcis (Mill.) D.A. Webb)…………………………………………………………………………………… 53 51.Induced systemic resistance to grapevine decline and increased Plant growth in the Field condition………………………………………………………………………………………54 52.The improved assembly of the European Pear…………………………………………………55 53.Edible Gardening: A Sustainable Food Security Approach…………………………56 54.IMPENDING DATES FOR FUNCTIONAL FOOD PRODUCTS……………………………57 55.RESPONSE OF GERBERA ON VEGETATIVE AND FLOWERING CHARACTERS UNDER PROTECTED CULTIVATION………………………………………………………58 56.The effect of LED lighting on the growth of cress……………………………………………59 57.Nuclear Phylogenomics and Evolution of Fruit Types in Rosaceae……………………60 58.New Marker-Based Breeding Strategies for Peach and Other PerennialCrops………………61 59.Antioxidants and Flavonoids of Black Truffles………………………………………………62 60.Effect of cotton waste enriched with vegetable peels is an innovative tool for Pleurotus ostreatus mushroom cultivation………………………………………………………………63 61.Effect of cotton waste supplemented with fenugreek straw on vegetative and reproductive growth of Phoenix oyster mushroom…………………………………………………………64

62.Reduced nitrogen level in culture medium, results in the formation of embryogenic calluses with high-frequency regeneration in okra (Abelmoschus esculentus L.)………………………65 63.Runner production and vegetative growth of strawberry as affected by growth hormone and ch i l l i n g te m p e r a t u r e un d e r ag r o - m e t r o l o g i c a l co n d i t i o n s of po t h o w a r re g i o n , Pakistan………………………………………………………………………………………66 64.Classification and development of fruit trichomes and effects of plant hormones on Type II fruit trichome in cucumber……………………………………………………………………67 65.Amelioration of Salinity Stress in Pepper (Capsicum annuum, L.) by Acetylsalicylic Acid Foliar Application…………………………………………………………………………68 66.Plant isomiR Atlas: Large scale detection, profiling and target repertoire of isomiRs in plants……………………………………………………………………………………………69 67.Organic and Inorganic fertilizers Affects on Growth, Yield, and Fruit quality of Cucumber grown in Soilless Culture……………………………………………………………… 70 68.Genome-wide identification of the Aux/IAA gene family in apple（Malus×domestica Borkh.） and functional analysis of MdIAA18…………………………………………………………71 69.PATHOGENIC COMPARISON AND HISTOPATHOLOGY OF CE RATOCYSTIS MANGINECANS AND C. FIMBRIATA–CAUSE OF MANGO QUICK WILT DISEASE 70. The pathway and mechanism of phloem unloading for photoassimilate in several fruit species…………………………………………………………………………………………73 71. Re g u l a t o r y ne t w o r k an a l y s i s re v e a l s re g u l a t o r s of ro o t ar c h i t e c t u r e in ap p l e rootstock………………………………………………………………………………………75 72.Plant Therapy: a Nonpharmacological and Noninvasive Treatment Approach Medically Beneficial to theWellbeing of Hospital Patients………………………………………………76 73.Genetic diversity and rapid detection of pear viruses………………………………………77 74.Enhanced in vitro regeneration of rose (Rosa indica L.) cv. American Beauty………………78 75.IPT5b promoter variation alters cytokinin level in apple rootstocks…………………………79 76.Increasing watermelon nutrient efficiency by grafting onto nonselfrootstocks………………80 77.Antagonistic activity of chitinolytic bacteria of various taxonomic groups against Colletotrichum gleosporioides, a pathogen of horticultural significance………………………81 78.Molecular cloning and expression analysis of the FcSEP1 Gene inRongan kumquat………82

79.Insecticidal principles from cassava, Manihot esculenta (Crantz): the promising molecules against major pests of horticultural crops……………………………………………………83 80.The regulatory relationship between lncRNAs and reactive oxygen species during tomato resistance to Phytophthora infestans……………………………………………………………84 81.Transcriptome analysis of sweet cherry (Prunus avium) fruit abscission in low chilling regions…………………………………………………………………………………………85 82.Physical and morphological attributes of Okra against the heat stress………………………86 83.Protein changes in response to photoperiod during dormancy induction in peach leaves and flower buds……………………………………………………………………………………87 84.Strategies to Improve Vanadium Stress Tolerance of Watermelon …………………………88 85.Increasing salt tolerance of cucumber by grafting onto pumpkin rootstock…………………89 86.Comparison of growth, fruit setting characters and yield of different banana varities ………90 87.Asteraceae Inflorescence patterning and development………………………………………91 88.Effects of phosphate fertilization methods on growth and nutrient uptake ofBlueberry………92 89.Morphological and molecular analyses of reciprocal hybrids between Slim Whitman and Pinza, two Narcissus pseudonarcissus cultivars……………………………………………………93 90.Molecular identification and characterization of CONSTANS-like (COL) genes family in mango………………………………………………………………………………………94 91.Physiological species identification of Hami melon powdery mildew in spring and autumn of Turpan, Xinjiang………………………………………………………………………………95 92.Effect of propionazole on the calyx abscics ratio and quality of the fruit of Korla Fragrant Pear……………………………………………………………………………………………96 93.Strategies to Improve Vanadium Stress Tolerance of Watermelon……………………………97 94.Walnut seeding growth characteristics comparison research…………………………………98 95.Based on ITS, RBCL sequence and leaf shape of xinjiang almond Study on genetic relationship of germplasm resources…………………………………………………………………………99 96.Incidence of clubroot in Shanghai and Effect of Exogenous Salicylic Acid on Seedling Growth, Physiological Characteristics and Resistance-Clubroot ( Plasmodiphora brassicae ) in Pakchoi （Brassic campestris ssp. chinensis Makino）………………………………………………100 97.Treatment of H2O2 promoting the berry early ripening of ‘Kyoho’…………………………101

98.Melatonin delays leaf senescence of Chinese flowering cabbage through suppressing ABF transcription factors-mediated ABA biosynthesis and chlorophyll degradation……………102 99.Compatibility Interaction of Stenting on Hybrid Tea Rose with Different Rootstock………103 100.The multi-level regulatory network mediated by citrus AGL6 in quality forming…………104 101.Effect of Selenium on Redox State, Antioxidant Enzymes Activity and Related Gene Expression in leaves of Salt-Stressed Tomato seedlings……………………………………105 102.Influence of Seven Dwarfing Interstocks on the ‘Fuji’ Apple under DroughtStress………106 103.Tetraploid Carrizo citrange rootstock (Citrus sinensis Osb. X Poncirus trifoliate L. Raf.) enhances natural chilling stress tolerance of common clementine (Citrus clementina Hort. ex Tan)…………………………………………………………………………………………107 104.Two 7-O-di-glucosyltransferases directly compete with 1,2-rhamnosyltransferase during the biosynthesis of bitter flavonoid neohesperidoside in citrus………………………………108 105.Study on the Metabolic Enzyme Activity of Different Jujube Cultivars……………………109 106.Characterization of a Novel Litchi R2R3-MYB Transcription Factor that Involves in Anthocyanin Biosynthesis and Tissue Acidification…………………………………110 107.Study on the Metabolic Enzyme Activity of Different Jujube Cultivars……………………111 108.Better Mind; Better Work Effects of Plants on Adolescent as Mental Stress Measured by EEGs………………………………………………………………………………………112 109.Acquisition of virus eliminated apple plants by thermotherapy and the factors influenced the eliminating efficiency………………………………………………………………………113 110.Comparative analysis of ATP citrate-lyase enzyme activity and gene expression among citrus cultivars……………………………………………………………………………………114 111.Three LcABFs transcription factors are involved in the regulation of chlorophyll degradation and anthocyanin biosynthesis during fruit ripening in Litchi chinensis…………………115 112.CsPH8, a p-type proton pump gene plays a key role in different accumulation of citric acid in citrus………………………………………………………………………………………116 113.Application of Gray Correlation Method in Comprehensive Evaluation of Salt Tolerance of Turnip(Brassica rapa L.) in Seedling Stage………………………………………………117 114.Transcriptional Regulation of Key Genes of Citrulline Biosynthetic Pathway Mediated By Various Rootstock…………………………………………………………………………118

115.The Partly Seed Abortion Characteristics and Differences in Seed Development as Influences by Different Pollen Sources and temperature in Litchi cv.‘Guiwei’………………………119 116.Studies on the Anther Culture Technology in Processing Tomato…………………120 117.Inheritance of Major Gene Plus Polygene Underlying Bolting and Flowering Traits in Non-heading Chinese Cabbage……………………………………………………………121 118.Early Screening of Processing Tomato Seedlings Treatment with Ethylmethanesulfonate…122 119.Cloning and Functional Analysis of the Candidate Gene PCP021016.1 for PcDw in Pear…………………………………………………………………………………………123 120.Red LED light irradiation affects chlorophyll and carotenoid metabolism to improve coloration of postharvest citrus fruit……………………………………………………124 121.Saline-alkaline stress gene development………………………………………………125 122.Construction of columnar apple yeast two-hybrid library and screening and functional identification of MdCoL interaction proteins………………………………………………126 123.Investigation of kernel rate of different jujube varieties………………………………127 124.First report on the association of Colletotrichum gloeosporioides species complex with citrus wither tip disease in Pakistan……………………………………………………………128 125.Post-harvest application of ethephon improves fruit coloration and preserves better antioxidant capacity in Eureka lemon (Citrus limon (L.) Burm. f.)……………………129 126.The maturity degree, phenolic profiles and antioxidant activity of Eureka lemon [Citrus limon (L.) Burm. f.]: A negative correlation between total phenolic, antioxidant capacity and soluble solid content………………………………………………………………………………130 127.Transcriptome profiling of glutathione improving tolerance of tomato in response to salt stress………………………………………………………………………………………131 128.Apple bZIP transcription factor MdbZIP44 regulates ABA-promoted anthocyanin accumulation………………………………………………………………………………132 129.Molecular Regulation Mechanism of AG Genes on Double flowered Cymbidium goeringii……………………………………………………………………………………133 130.Effects of Salt and Alkaline Stresses on the Growth and Root Ion Micro-distribution in Chili Pepper………………………………………………………………………………………134 131.Microbe-metal interaction induced physiological and metabolic changes in spinach grown in

heavy metals polluted soil………………………………………………………………135 132.Test of Variety Purity and Genetic Diversity with SSR Markers for Watermelon New Hybrid Cultivars ‘Kangbing948’ and ‘Shenkang988’………………………………………………136 133.Comparative and parallel transcriptional and metabolic studies for fruit quality and exocarp in sand pears…………………………………………………………………………………137 134.Genome-Wide Identification and Characterization of SBP-like Transcriptional Factor Family in Pineapple and Expression Profiling during Flowering Induction by Ethephon…………138 135.Study on the Feasibility of Populus euphratica leaves retting substrate for cucumber Seedling……………………………………………………………………………………139 136.Rhizosphere arbuscular mycorrhizal fungal communities of tomato and potato-onion in monocropping and intercropping systems show a different response to P fertilizer inputs………………………………………………………………………………………140 137.A single complex locus is responsible for the production of multiple flavour-related monoterpenes in ripe kiwifruit…………………………………………………………141 138.Genetic Diversity and Relationships Among Chinese Loquat（Eriobotrya japonica）Accessions Assessed by SSR Markers Developed from Transcriptome Sequencing…………………142 139.Effect of Elevated CO2 Concentration on Physicochemical Properties of Soil Planted Lycium barbarum……………………………………………………………………………………143 140.Storability and Shipping Potential of Modified Atmosphere Packed ‘Samar Bahisht Chaunsa’ Mangoes at two different Storage Temperatures……………………………………………144 141.Genome Duplication Improves the Resistance of Watermelon Root to Salt Stress…………145 142.Identification of Ploidy of Hybrid Progeny and Meiosis Observation in Natural Tetraploid Loquat………………………………………………………………………………………146 143.The identification of anthracnose-resistant loquat cultivars and development of Real-time PCR for rapid detection of Colletotrichum gloeosporioides……………………………147 144.A comparative proteomic study on the differentiation of amyloplast into chromoplast in yellow flesh kiwifruit………………………………………………………………………148 145.Synthetic Strigolactone Analog GR24 affects seedling growth and modifies abiotic stresses in cucumber…………………………………………………………………………………149 146.A soluble inorganic pyrophosphatase interact with the bZIP transcription factor repressing the

pectin methylesterification in growing pollen tubes in vitro……………………150 147.Effect of bio-fertilizer and mineral fertilizers on grapevine (Vitis Viniferal. cv, Muscat Hamburg) in sunlight green house conditon………………………………………………151 148.Effects of organic nutrient solution on Fruit Development and Quality of litchi…………152 149.Growth and respiratory metabolism adaptation mechanism of Distylium chinense during and after complete submergence………………………………………………………………153 150.Effects of Different Fertilization Treatments on Fruit Yield and Quality of Citrus grandis var: Longanyou…………………………………………………………………………………154 151.Transcriptome analysis and physiological response of radish under high temperature stress………………………………………………………………………………………155 152.Regeneration capability study of Lilium brownii var. Giganteum…………………………156 153.PGSD, the Plant Genome Sequencing Database for comparative and functional genomic analyses……………………………………………………………………………………157 154.Growth characteristics for 18 Rhododendron imported cultivars in Central Yunnan………158 15 5.BSA mapping for candidate genes associated with root growth angl e in apple rootstocks…………………………………………………………………………………159 156.BSA mapping for candidate genes associated with salt/alkali tolerance in apple rootstocks…………………………………………………………………………………160 157.cDNA-AFLP analysis of transcrips induced in tomato (Solanum lycopersicum L.) by exogenous salicylic acid and calcium chloride during drought stress…………161 158.Mapping and candidate gene screening of Tomato yellow leaf curl virus resistant gene ty-5…………………………………………………………………………………………162 159.CmsCRC is involved in fingers stretch of fingered citron and activated under lower temperature ………………………………………………………………………………163 160.Hyper-recombinant Plants: an emerging field for Innovative OrnamentalsBreeding………164 161.Is plastid-nucleus retrograde signaling involved in vegetative phase change?……………165 162.Melatonin deficiency aggravates high temperature-induced damage to photosystem II in tomato plants………………………………………………………………………………166 163.Changes of phytochemicals, antioxidant properties and gene expressions during development of sanhua-plum (Prunus Salicina Lindl.)…………………………………………………167

164.Elevated carbon dioxide-induced changes in tea physiology: a climate change perspective…………………………………………………………………………………168 165.Oleocellosis Induce Primary Metabolites Disorder and Enhance the Phenylpropanoid Metabolism in Citrus Fruits………………………………………………………………169 166.Three Paralogous R2R3-MYB Genes Contribute to Anthocyanin Synthesis in Petunia hybrid ……………………………………………………………………………………170 167.Isolation and characterization of Fusarium oxysporum f.sp. passiflorae from passion fruit in China………………………………………………………………………………………171 168.Biosyntheses of Floral Aroma Compounds in Tea (Camellia sinensis) Leaves and Their Formations in Response to Multiple Stresses……………………………………………172 169.A comprehensive proteomic analysis of elaioplasts from citrus fruits reveals insights into elaioplast biogenesis and function…………………………………………………………173 170.Genes Mining and Function Identification of Rosa multiflora under Cold Stress…………174 171.Mapping of QTLs Controlling Seed Size by Whole-genome sequencing and Bulk Segregation Analysis in Watermelon……………………………………………………………………175 172.Structural and compositional remodeling of Camellia sinensis leaf cuticle in response to draught stress ………………………………………………………………………………176 173.Functional analysis of PalCLas, a pathogenicity-related genes from destructive pathogen Candidatus Liberibacter asiaticus…………………………………………………………177 174.Investigation of Alpha-Glucosidase Inhibitory Activity in Different Pepper Cultivars (Capsicum annuum L.)………………………………………………………………178 175.Investigation of the in vitro effects of total extracts from pepper on amyloid production and aggregation…………… …… ……………………………………………… ……… 17 9 176.Genome editing-assisted glucoraphanin-rich broccoli…………………………………180 177.Rooting recalcitrance is caused by active responses of adult leafy cutting to IBA treatment in Malus xiaojinnesis…………………………………………………………………………181 178.Study on growth characteristics and fruit quality difference between tillering and grafting plants of Zizyphus jujuba Mill cv. Lingwuchangzao……………………………………182 179.Phylogenetic Relationship and Genetic Background of Blueberry (Vaccinium spp.) based on Retrotransposon-based SSAP Molecular Markers…………………………………………183

180.Mixed pollen pollination promotes the secretion of stigma exudate and improves the fruit quality of southern highbush blueberry……………………………………………………184 181.Genetic trend and InDel markers exploration of dwarfing genes from the cross of M.baccata×M9.……………………………………………………………………………185 182.Melatonin delays leaf senescence of Chinese flowering cabbage through suppressing ABF transcription factors-mediated ABA biosynthesis and chlorophyll degradation…………186

Cucumber as a Model System to Study Agricultural Traits Controlled by the Plant Vascular System William J. Lucas Department of Plant Biology, College of Biological Sciences, University of California, Davis, California, USA Abstract: The plant vascular system, comprised of xylem and phloem, serves as the major conduit for long-distance delivery of water, nutrients and signaling molecules, all of which are essential for the growth and development of the plant. Currently, it is well established that the vascular system controls many agronomic traits, such as the vegetative-to-floral transition, plant architecture, mineral nutrient signaling, carbon allocation, systemic acquired resistance to pathogens, and systemic gene silencing. To establish agronomic systems that can support global food security, it will be critical to develop a comprehensive understanding of the mechanisms used by plants to control these important traits. The basic challenge will be to elucidate the molecular basis by which these traits are controlled by root-to-shoot and shoot-to-root signals traveling through the xylem and phloem, respectively. To this end, it was important to develop a model plant system having the capacity to allow efficient access to the vascular system. We developed cucurbits as one such model system, and will illustrate its application in advancing our understanding of the role played by phloem-based signaling to translate environmental inputs to adjust: (a) resource allocation, between roots and shoots, to control root architecture; and (b) nutrient stress signaling to allow the plant to adapt to fluctuating soil nutrient conditions.

1

NOTE

The evolution of the nitrogen fixing root nodule symbiosis; how to live from air Ton Bisseling Wageningen University, Holland. Abstract: Long before the current era, early farmers used species from the Legume family (- such as lentil, soybean and bean- in crop rotation. Consumers valued the nutritious protein rich seeds, while farmers understood that legumes would improve yield of the following year's non-legume crop, such as wheat, barley and maize. The importance of this agricultural practice is already documented in ancient Roman literature (Marcus Cato, De Agri Cultura). After the discovery that the beneficial property of legumes is their ability to reduce atmospheric nitrogen into ammonia it became a dream to transfer this property to non-legumes. Legumes establish a symbiosis with rhizobium bacteria and this is one of the most intimate endosymbiotic interactions on earth. Rhizobium reprogrammes fully differentiated root cells and these can differentiate into different cell types that form a new organ, the root nodule. The rhizobia are hosted in specialized cell as transient organelles

and there they are able to reduce atmospheric

N2 into ammonia. In this

This is a source of nitrogen that can be used by the plant. This is the most important biological process by which nitrogen becomes available for plants,

but in fact for all

living organisms. In this seminar I will discuss recent insights in the evolution of nodule symbiosis and its impact for engineering this trait in non-legume crops. In addition to legumes several other plant species

can establish a nodule

symbiosis with N fixing Frankia bacteria. These are named actinorhizal plants. Strikingly all these nodule forming plant are relatively closely related, as they all belong to a single (N-fixation) clade. Within this clade most legumes have the ability to establish a nodule symbiosis. However, the actinorhizal plants are scattered between numerous plant that are unable to form this nodule symbiosis. A gain of nodulation in several nodulating genera was considered more likely than numerous loss. Therefore it is generally assumed that within this N fixation clade nodulation evolved several times independently. To explain that all nodulating plants belong to a single clade, it is postulated that the youngest common ancestor of this clade obtained a predisposition to evolve nodulation. Within this seminar I will discuss the evolutionary relationship between the nodule symbioses and a different endosymbiosis; the interaction of plants with arbuscular mycorrhizal (AM) fungi. This symbiosis evolved once in basal plants (relatives of

2

NOTE

liverworts ~450 M years ago) and has been maintained in most higher plants. In this symbiosis the fungi form a large fungal network outside the plant and in the root they form highly branched hyphae inside cortical cells. There the exchange of nutrients and carbohydrates between plant and fungi takes place. During evolution rhizobia have learned to produce similar signal molecules as the AM fungi and they activate the same signaling pathway. This common signaling pathway is also used in the formation of nodules of actinorhizal plants. The mechanism to host AM fugi intracellular is controlled by a specific (symbiotic) exocytosis pathway and this pathway is also recruited within the nodule symbiosis. The implication of the recruitment of AM fungal symbiosis pathways during nodule evolution is that the fast majority of plants have these pathways. So why did they not evolve a nodule symbiosis? To obtain further insight in the evolution of nodule symbiosis we studied Parasponia. This is the only genus outside the legume family that also can establish a nodule symbiosis with rhizobium. We assumed that it evolved the nodulation trait rather recent as its very close sister genus Trema can not establish this symbiosis. Comparative genomics of several Trema and Parasponia species did not reveal any gene that could contribute to the gain of the nodulation trait. In contrast it showed the loss of several genes in Trema that are essential for nodulation. This study and another phylogenomics analysis on several species within the N-fixation clade will be used to discuss the evolution of the nodule symbiosis within the N-fixation clade.

3

NOTE

Mechanical Responses in Plants: Feeling and Coping with Pressures Zhenbiao Yang Center for Plant Cell Biology, Institute of Integrative Genome Biology, and Department of Botany and Plant Sciences, University of California, Riverside, CA 92508 FAFU-UCR Joint Center for Horticultural Biology and Metabolomics, Haixia Institute of Science and Technology, Fujian Agriculture and Forestry University, Fuzhou, China Email: [email protected] Abstract: Mechanical signals are known to regulate growth and developmental behaviors of plants and to impact yields of crops including horticultural crops, e.g., shaking improves tomato fruit set. How plants sense and transduce mechanical signals remains poorly understood. To address this fundamental question, my group uses two cell systems in the model plant Arabidopsis thaliana: Pollen tubes and leaf epidermal pavement cells.

Pollen tubes experience dramatic changes in mechanical pressures

from female tissues during their penetration into the pistil to deliver sperms to the ovaries for double fertilization. During the formation of the puzzle-piece shape in Arabidopsis leaf pavement cells, multifocal localized cell protrusion produces local mechanical stress that must be sensed and accommodated by the complementary sites of the neighboring cells. Our results suggest that in both cell systems mechanical stresses may be sensed by cell surface receptor kinases (receptor-like kinases, RLKs), which then further transduce the mechanical signals to Rho-like GTPases (ROPs) to regulate cell wall stiffness. These findings support a common mechanical sensing and signaling mechanism that regulate different mechanical responses in plants.

4

NOTE

Comparative Genome Sequence Analysis Sheds Light on the Origins and Evolution of Modern Citrus Species and Cultivar Groups

NOTE

Fred G. Gmitter Jr1, Guohong Albert Wu2, Daniel S. Rokhsar2, Manuel Talon3 1University

of Florida-Citrus Research and Education Center

US Department of Energy Joint Genome Institute, Walnut Creek, California, USA

2

Centro de Genómica, Instituto Valenciano de Investigaciones Agrarias (IVIA),

3

Moncada, Valencia, Spain Abstract: The genus Citrus contains some of the most widely grown fruit types in the world, including sweet oranges (Citrus x sinensis), mandarins (C.reticulata), pummelos (C.maxima), grapefruit (C. x paradisi), lemons (C. x limon), and limes (C. x aurantifolia). Additionally, there are some other related fruit types, such as kumquats (Fortunella sp.) and finger limes (Microcitrus sp.), that also are of commercial significance. Taxonomic relationships have long been considered and various systems have been developed, in at attempt to properly classify species according to their relationships and phylogeny. However, these exercises have led to vastly different and contentious conclusions, not only on the nature of interspecific and intergeneric relationships, but also on what are the true species, and what is the center of origin. Historically, morphological phenotypes and some types of biochemical descriptions were the basis of these classifications, but such information is prone to environmental influence; also, and perhaps more significantly, human opinions and biases many times drove the analyses toward subjective conclusions. By contrast, genome sequence information is objective and unaffected by environmental influence on phenotypic characteristics or human opinions. Herein, we describe ten natural citrus species based on genome sequence information of 60 unique and diverse accessions of citrus, following genomic, phylogenetic, and biogeographical analyses. We propose a region where citrus originated and describe two radiations during the late Miocene and early Pliocene epochs, that gave rise to modern citrus species and the admixtures that are the cultivar groups of modern citrus production. The timing of the diversifications and the relationships of the species found as natives throughout Asia and into Australia are clearly seen through the lens of genomic analysis. The lineages of many of the more common types of citrus fruit trees also have been described. Further, we find widespread pummelo introgression in mandarin germplasm accessions and extensive networks of relatedness among mandarins, oranges, and other admixtures. Correlations between the degree of pummelo introgression and fruit size and juice acidity, as well as understanding the genetic basis of nucellar polyembryony, are indicative of the forces that led to domestication of citrus fruit in more recent times. Keywords: phylogeny, biogeography, diversification, admixture, domestication

5

.

The CucCAP project: Leveraging applied genomics to increase disease resistance in cucurbit crops Rebecca Grumet Michigan State University Abstract: The USDA-SCRI ‘CucCAP’ project is an effort by the U.S. cucurbit community to develop genomic and bioinformatic tools for the Cucurbitaceae and facilitate introgression and stacking of disease resistance loci. Tool development includes upgrading of the Cucurbit Genomics Database (http://cucurbitgenomics.org/) which provides sequence data, search capacity, and bioinformatics tools, and genetic characterization of the National Plant Germplasm System (NPGS) plant introduction (PI) collections of watermelon (Citrullus lanatus), melon (Cucumis melo), cucumber (Cucumis sativus), and squash (Cucurbita pepo and C. moschata). Genotyping-by-sequencing (GBS) was performed on the full collections (1000-2000 accessions/crop) providing 0.9-1.7 billion GBS reads and 20,000-30,000 SNPs per species that are well distributed across the genomes (average density: one SNP per 10.6, 14.6, and 15.7 kb for cucumber, melon and watermelon, respectively). The SNPs were used to characterize genetic diversity, population structure, phylogenetic relationships, linkage disequilibrium, and population differentiation of the collections and perform GWAS of horticulturally important traits. This information is being used to establish publically available, re-sequenced functional panels of 300-400 accessions per crop representing >95% of the diversity present in the collections along with key disease resistance, fruit quality, horticultural and agronomic traits. The CucCAP disease priorities, which were identified by the cucurbit industries and vary among crops, include downy mildew, Fusarium, gummy stem blight, Phytophthora capsici, powdery mildew and several viruses. Different labs are identifying QTL, developing markers, and introgressing resistances. Our work with P. capsici infection of cucumber fruit, uses genomic and transcriptomic approaches to characterize two distinct kinds of resistance, age-related, and young fruit resistance. Key Words: Cucurbitaceae, genotyping-by-sequencing, germplasm collections, cucumber, melon, watermelon, squash

6

NOTE

Genetics and phenotyping of rootstock traits in tomato Andrew John Thompson Cranfield University Abstract: The majority of tomatoes for the fresh market are produced from a graft between different scion and rootstock genotypes. Separating the breeding of scion and rootstock traits gives much greater power to deliver beneficial root traits to commercial practice by dividing the breeding task into two largely independent and more manageable tasks. We have used transgenic lines, monogenic mutants and mapping populations to define specific loci and genes that can influence tomato root system architecture, root vigour and the ability of the rootstock to control scion performance under abiotic stresses. We have developed a novel phenotyping platform for crop-soil systems in which soil parameters can be controlled at pilot scale (up to 36 cubic meters of soil), and where canopy development and physiological status can be monitored with a LemnaTec sensor platform–we have used this to investigate rootstock vigour and its interaction with soil compaction. Data will be presented from a number of studies including the BBSRC RootLINK project. Key words: rootstock, vigour, tomato, genetics, phenotyping

7

NOTE

The fruit ENCODE project: use functional genomics to probe the evolutionary origins of fleshy fruit Silin Zhong

School of Life Sciences, The Chinese University of Hong Kong. Hong Kong. China Abstract: Fleshy fruit ripening has evolved many times throughout the angiosperm history, and many require the plant hormone ethylene. Much of what we know about this process came form the study of tomato, where ethylene, MADS-box transcription factors and whole-genome demethylation are critically involved. But the precise molecular mechanism and whether it is conserved in other species remain largely unknown. The fruitENCODE project has systematically profiled gene expression, accessible chromatin, histone modifications and DNA methylation changes in 11 fleshy fruit species to investigate the molecular circuits controlling ripening. We found most climacteric fruits utilize a common angiosperm senescence-related NAC transcription factor to create a positive feedback loop to synthesize the autocatalytic ethylene. For plants undergone recent whole-genome duplication like tomato, apple and pear, their loop depends on neofunctionalization of the duplicated MADS-box transcription factors. Banana, a monocot climacteric species that diverged from eudicot over 100 myr and undergone three recent WGD, uses leaf senescence-related NAC transcription factor to generate a positive feedback loop and an additional loop with three MADS-box transcription factors that makes its ripening ethylene independent once initiated. It turns out that DNA methylation changes associate with ripening genes could be unique for tomato, while other species utilize H3K27me3 to regulate their genes involved in ripening and autocatalytic ethylene production. The fruitENCODE study has raised important questions regarding how we should interpret complex developmental processes while the data is often derived from a single model species like tomato. Key words: fruit ripening, DNA methylation, histone modification, accessible chromatin

8

NOTE

Implementation of Drought Avoidance Mechanisms for Sustainable Crop Production Xiaohan Yang Biosciences Division, Oak Ridge National Laboratory, Oak Ridge, TN, USA Abstract: Urbanization, increasing human population and climate change reduce the availability of water for sustainable production of agricultural and horticultural crops. Drought stress is one of the major causes of crop loss. Plants adapt to water limitation using three main strategies: drought tolerance (e.g., maintaining cell turgor through osmotic adjustment), drought escape (e.g., shortening the growing season) and drought avoidance (e.g., changing stomatal movement). Drought avoidance is the best strategy for coping with water scarcity and crassulacean acid metabolism (CAM) is a unique mechanism of drought avoidance. With an inverted day/night pattern of stomatal closure/opening (i.e., stomata close during the daytime and open during the nighttime), CAM plants have much higher water-use efficiency than C3 or C4 photosynthesis plants. Also, CAM is an important carbon concentrating mechanism (i.e., elevating intracellular CO2 concentration in the vicinity of ribulose-1,5-bisphosphate carboxylase/oxygenase), which can reduce photorespiration and consequently increase net photosynthesis in CAM photosynthesis plants in comparison with C3 photosynthesis plants. Therefore, the transfer of CAM machinery into existing C3 crops has great potential for genetic improvement of drought avoidance and photosynthetic efficiency. Comparative genomics analysis of independent CAM lineages has provided new insight into the molecular basis and evolution of CAM systems. Based on the new knowledge gained from CAM genomics research, a great effort is being taken to move CAM-related genes into C3 plants

9

NOTE

Advances on plant grafting

NOTE

MICHITAKA NOTAGUCHI. (Nagoya University) Abstract: Plant grafting has been an important technique in horticulture as well as in agriculture to perpetuate clones, to obtain the benefits of certain rootstocks such as disease resistance and tolerance of unfavorable soil conditions and to control fruit production. However, we face to challenges such as graft-incompatibility and massive human costs. To overcome these challenges, we have developed grafting skills, interfamily grafting and grafting microdevice. Like as immunological resistance found in animals, plant grafting also has a limitation in combinations to graft. In general, it has been thought that grafting can be done successfully between the same species, genus, and family, but not between different families because of graft incompatibility. Recently, we found that a Solanaceae species, Nicotiana, can be grafted onto a Brassicaceae, Arabidopsis, where a population of mRNA was transported from Arabidopsis stocks to Nicotiana scions (Notaguchi et al., 2015). We further showed that Nicotiana has a capability to reduce or overcome the graft incompatibility. Nicotiana was successfully grafted with a wide range of plants, including magnoliids, monocots and dicots. In our anatomical analyses, vasculature reconstruction at the graft junction, which is normally observed in grafting of compatible combinations, was not observed. But, alternatively, parenchyma tissues were proliferated at their junction where xylem and phloem tissues were newly developed in unorganized manners, resulting in incidental connection for xylem, but seemingly not for phloem. In these grafts, both apoplastic and symplasmic transports were achieved. Also the transports of proteins and mRNAs were detected. TEM analysis evidenced the de novo secondary plasmodesmata formation at the graft boundaries. Thus, we consider that Nicotiana interfamily grafting, which belongs to incompatible combinations, is functional and possible to be used for plant research. On the other hand, to reduce the cost for production of grafted plants, we combine skills of the micrografting technique used for scientific studies and an engineering technology, Micro Electro Mechanical Systems. We constructed a device for seedling-grafts and applied in a tiny model plant, Arabidopsis. This concept could be broaden for the other plant species. In my talk, I would like to overview recent advances on grafting techniques including our studies and discuss future directions. Key words: grafting, interfamily grafting, interstock, grafting microdevice

10

A new actin severing protein invovled in apple self-incompatability Tianzhong Li China Agricultural University, China Abstract: In S-RNase-mediated self-incompatibility (SI), S-RNase secreted from the style destroys the actin cytoskeleton of the self-pollen tubes, eventually halting its growth, but the mechanism remains unclear. In vitro biochemical assays revealed that S-RNase does not bind or sever filamentous actin (F-actin). In apple (Malus×domestica), we identified an actin-binding protein containing myosin, villin and GRAM, MdMVG, that physically interacts with S-RNase and directly binds and severs F-actin. Immunofluorescence assays and total internal reflection fluorescence microscopy (TIRFM) indicated that S-RNase inhibits the F-actin-severing activity of MdMVG in vitro. In vivo, adding S-RNase to self-pollen tubes increased the fluorescence intensity of actin microfilaments (AFs) and reduced the severing frequency of microfilaments and pollen tube growth rate in self-pollination-induction (SPI) in the presence of MdMVG overexpression. By generating 25 single-, double- and triple-point mutations in the amino acid motif E-E-K-E-K of MdMVG via mutagenesis and testing the resulting mutants with immunofluorescence, we identified a triple-point mutant, MdMVG(E167A/E171A/K185A), that no longer has F-actin-severing activity or interacts with any of the four S-haplotype S-RNases, indicating all three amino acids (E167, E171 and K185) are essential for the severing activity of MdMVG and its interaction with S-RNases. We conclude that apple S-RNase interacts with MdMVG to reduce self-pollen tube growth by inhibiting its F-actin-severing activity.

11

NOTE

Cold acclimation alters DNA methylation patterns in Brassica rapa and confers tolerance to heat and high growth rate Tongkun Liu, Ying Li, Xilin Hou (Nanjing Agricultural University) Abstract: Epigenetic modifications are implicated in plant adaptations to abiotic stresses. Exposure of plants to one stress induces resistance to other stresses, which is called cross-adaptation, is not well understood. In this study, we aimed to unravel the epigenetic basis of elevated heat-tolerance in cold-acclimated Brassica rapa by genome-wide DNA methylation analysis of leaves from control (CK) and cold-acclimated (CA) plants. We found both methylation and demethylation occurred during cold acclimation. Moreover, two significantly altered pathways, malate dehydrogenase activity and carbon fixation, and 1,562 differentially methylated genes, including BramMDH1, BraKAT2, BraSHM4, and Bra4CL2, were identified in CA. Genetic validation and treatment of B. rapa with 5-aza-2-deoxycytidine (Aza) suggested promoter demethylation of four candidate genes increased their transcriptional activities. Physiological analysis suggested elevated heat-tolerance and high growth rate were closely related to increases in organic acids and photosynthesis, respectively. Functional analyses demonstrated that the candidate gene BramMDH1 (mMDH: mitochondrial malate dehydrogenase) directly enhances organic acids and photosynthesis to increase heat-tolerance and growth rate in Arabidopsis. However, Aza-treated B. rapa, which also has elevated BramMDH1 levels, did not exhibit enhanced heat-tolerance. We therefore suggest DNA demethylation alone is not sufficient to increase heat-tolerance. This study demonstrates that altered DNA methylation contributes to cross-adaptation. Key words: Brassica rapa, cold acclimation, DNA methylation, heat tolerance, organic acids, photosynthesis

12

NOTE

Diversification, domestication and functional genomics of pear Wu Jun*, Tao Shu-tian, Yao Gai-fang, Cheng Xue, Zhang Ming-yue, Li Xiao-long, Yin Hao, Qi Kai-jie, Wu Ju-you, Xie Zhi-hua, Huang Xiao-san, Wang Run-ze, Li Jia-ming and Zhang Shao-ling* (Centre of Pear Engineering Technology Research, State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing, 210095, China) *Correspondence: [email protected], [email protected] Abstract: In order to reveal the genetic variation pattern of different germplasm, we report the genome resequencing of 113 pear accessions from worldwide collections, representing both cultivated and wild pear species. Based on 18,302,883 identified SNPs, we conduct phylogenetics, population structure, gene flow, and selective sweep analyses. Furthermore, we propose a model for the divergence, dissemination, and independent domestication of Asian and European pears in which pear, after originating in southwest China and then being disseminated throughout central Asia, has eventually spread to western Asia, and then on to Europe. We find evidence for rapid evolution and balancing selection for S-RNase genes that have contributed to the maintenance of self-incompatibility, thus promoting outcrossing and accounting for pear genome diversity across the Eurasian continent. In addition, separate selective sweep signatures between Asian pears and European pears, combined with co-localized QTLs and differentially expressed genes, underline distinct phenotypic fruit traits, including flesh texture, sugar, acidity, aroma, and stone cells. It provides substantive and valuable genomic resources that will significantly advance pear improvement and molecular breeding efforts. Combining with the high-density genetic map, QTL localization and corresponding chromosomal physical map, a candidate R2R3 MYB TF, PyMYB114, was identified regulating the red skin color of pear. Furthermore, the interaction network bHLHS-PyMYB114-ERF3 provides insight into the coloration of fruits and the interaction of different TFs to regulate anthocyanin biosynthesis. Additionally, we found that microRNA (miR) miR397a regulates fruit cell lignification by inhibiting laccase (LAC) genes that encode key lignin biosynthesis enzymes. A single nucleotide polymorphism (SNP) identified in the promoter of the PbrmiR397a gene was found to associate with TCA element that responded to salicylic acid to induce gene expression as confirmed using a cell-based assay system. Key words: Pear, population structure, domestication, genetic map, physical map, gene function

13

NOTE

Molecular mechanism of fruit shape regulation in cucumber Xiaolan Zhang, China Agricultural University, China Abstract: Fruit shape is an important agricultural trait that directly affects product appearance and commercial value. The fruit shape trait composition in cucumber consists of fruit length, width, curvedness, stalk length, spines, warts, super ovary and colors. The underlying mechanism of fruit shape regulation is largely unknown in cucumber. Here, two important aspects of fruit shape will be presented: the super ovary formation and fruit length reulation in cucumber. Our data showed that cytokinins play a decisive role of in controlling super ovary formation (delayed corolla opening leading to flower remaining on the fruit tip), and that nutritional conditions such as nitrate and phosphorus participate in the delayed corolla openingr. We also found that a MADS-box gene CsFLR is an important repressor of fruit elongation. CsFLR knockdown leads to increased fruit elongation, whereas elevated expression of CsFLR results in significantly shorter fruit length in cucumber. CsFLR regulates fruit elongation through two pathways: one that inhibits PIN-FORMED (PIN1/7)-mediated auxin transport and thus reduces auxin accumulation in the fruit, and the other by repressing CsSUP-mediated cell division and cell expansion.

14

NOTE

Plant hormones coordinate receptacle fruit development in Fragaria vesca Xiong Liao1, 2, Mengsi Li2, Miaoling Yan2 and Chizuko Yamamuro2* (1College of Horticulture, Fujian Agriculture and Forestry University, Fuzhou, China FAFU-UCR Joint Center for Horticultural Biology and Metabolomics, Haixia Institute

2

of Science and Technology, Fijian Agriculture and Forestry University, Fuzhou, Fujian, China) Abstract: Fruit growth and ripening are coordinated to determine the final fruit size and are modulated by multiple phytohormones. How these hormones coordinate and interact with each other to control these processes at the molecular level is not clear. In the early stages of Fragaria vesca fruit development, auxin increases both widths and lengths of receptacle fruits, while gibberellin (GA) mainly promotes their longitudinal elongation. We showed that auxin promoted GA biosynthesis and signaling by activating GA biosynthetic and signaling genes, suggesting auxin function is partially dependent of GA function. At the onset of fruit ripening, both auxin and GA levels decreased, leading to a steep increase in the endogenous level of ABA that drives receptacle fruit ripening. ABA repressed the expression of FDR1 gene that inhibit fruits ripening but promoted the expression of FveNCED, a rate limiting step in ABA biosynthesis. I will discuss how we use strawberry receptacle fruits as a model to understand cross-talk among plant hormones. Key words: Fragara vesca; plant hormone interaction; fruits development

15

NOTE

Flavonoids biosynthesis in crabapple Yuncong Yao Department of Plant Science and Technology, Beijing Key Laboratory for Agricultural Application and New Technique, Beijing University of Agriculture, Beijing 102206, China. Beijing Collaborative Innovation Center for Eco-environmental Improvement with Forestry and Fruit Trees, Beijing, China. Abstract: Anthocyanins are water-soluble flavonoid pigments found in higher plants and are responsible for orange/red and violet/blue color of many fruit, vegetables, flowers and seeds, and also perform several physiological and biochemical processes in plants. An example of an important ornamental woody plant is Malus crabapple, which belongs to the Rosaceae, Malus Mill family. Crabapple have colorful leaves, flowers and fruits and provide an excellent source of research material for studying the mechanism of color formation. We focus on the anthocyanin biosynthesis in crabapple leaves, petals, and fruits. Firstly, we cloned the anthocyanins biosynthesis genes and examined the expression of these genes, and functional analysis several MYB transcription factors by overexpression or silence experiments. We also conduct transcriptome and miRNA sequencing to identify several important transcritption factor and miRNA, which involoved in anthocaynins biosynthesis pathway. Meanwhile, we found several environmental factors regulate anthocyanin biosynthesis in crabapple, such as temperature, pH value, and different light periods. We also focused on the effect of DNA methylation and demethylation on the biosynthesis of anthocyanin in crabapple, we speculate that COP1 maybe candidate target gene in RdDM pathway in crabapple. Our team leader is Prof. Yuncong Yao, and our team includes Dr. Jie Zhang, Dr. Ji Tian and Dr Tingting Song.

16

NOTE

Mango Value Chain Improvement in Pakistan: Approaches, Achievements and Challenges Aman Ullah Malik. Institute of Horticultural Sciences, University of Agriculture, Faislabad, Pakistan Abstract: Mango is the second major fruit crop (1.7 MMT) of Pakistan. Export season starts from 3rd week of May to September. Major export cultivars are Sindhri, Sammar Bahist Chaunsa and Sufaid Chaunsa, very sweet and juicy. Over the last 10 years (2006-2015), industry has been transformed, from traditional-low tech, local focused; to internationally competitive through value chain based developmental approach. Development of on-farm processing facilities, R&D based production and processing protocols, adoption of best management practices, cluster development, farm registration and certification for export and market linkages program, led to farm direct export to high-end markets of Europe, USA, Australia and Japan etc. Commercial sea-shipment of Sindhri mangoes to Europe achieved overall postharvest life of 40 days. These developments have been made possible through some internationally (Australia, USA EU/UNIDO) and locally funded projects, demonstrating increased market returns and job/business opportunities. More R&D and capacity building work is required for developing new markets, addressing quarantine issues, enhancing value addition etc. Key words: mango, postharvest supply chain, export, sea freight, market linkages

17

NOTE

Analysis of Hormones and Transcriptome in the Process of Bloting in lettuce Yingyan Han Beijing University of Agriculture, China.

Abstract: Bolting is a key point when plant growth was changed from vegetative to reproductive growth. Lettuce owned the largest planting area of green leafy vegetables in Beijing. It originated in the Mediterranean coast and grows well in cold climate. Bolting was caused by high temperatures and it seriously affects the edible quality and commercial value of lettuce. Thus, if the impacts of mechanism in bolting at high temperature were explored by means of molecular biology, bolting at high temperatures in summer may be reduced and this will be able to avoid the summer lettuce breeding and commercial production losses. Therefore, researches on bolting of lettuce under high-temperature conditions have important theoretical values

and practical

significances. In this study, we selected PS11 as plant materials. 37℃ high temperature and 25℃ room temperature were applied as different experimental groups respectively to determine the bolting date according to morphological changes and paraffin sections. Then, as transcriptomic analyses of the bolting-sensitive line PS11 at the five-leaf stage grown at 37°C were performed in the present study, effects of gibberellin and transcription factors in bolting process at high temperature was detected. By spraying gibberellin and chlormequat chloride, the roles of gibberellin were verified further. After treatments at different temperatures, lettuce in the treatment group began bolting on the seventh day and their morphological changes in the stem were obvious on the ninth day. Bolting did not occur in the control group during the treatment period. The results of paraffin sections also showed that on the seventh day, the growing cone had increased in size and was significantly longer in the high-temperature group than in the control group. The growing cone increased in size until the ninth day. Conversely, the growing point of the control group did not change in size during the treatment period. Therefore, we determined that PS11 began to bolt after seven days. On the other hand, we found that the GA3 and GA4 contents in leaves reached a maximum on the sixth day after high temperature treatment, which was significantly higher than the control group, and these high levels were maintained. In contrast, there were no obvious changes in GA3 and GA4 levels in stems. IAA levels showed a decreasing trend in leaves on the sixth day, while the stem IAA contents reached a

18

NOTE

maximum on the sixth day and were significantly higher than the control group. No notable changes in ABA contents in stems and leaves were observed. There are 6 genes associated with GA and a large number of up-regulated and down regulated transcription factors that may play a key role during bolting. At the same time, an interesting phenomenon has been found that a same transcriptional factor may have the opposite trends in the stem and leaf. Therefore, the transcription factor during bolting deserves further explorations. The data in this study showed that bolting began in the fifth day after GA3 treatment in PS11 plants as the stem length increased significantly. GA3 and GA4 in the leaves exhibited a similar trend, which was consistent with the results after high-temperature treatment. The findings further confirmed that high GA3 and GA4 levels in leaves played a key role in bolting. The trend of IAA contents in leaves showed that high level of IAA in the stem can promote bolting. No notable changes in ABA contents in stems and leaves were observed. After CCC treatment, bolting did not occur during this period. GA3, GA4 and IAA contents were reduced in stems and leaves. This further confirmed that GA3, GA4, IAA can promote the bolting process of lettuce. There were no significant changes in the ABA content in stems or leaves after GA or CCC treatments, which confirmed that ABA may not significantly affect bolting in lettuce.

19

NOTE

MicroRNA-mediated biotechnology for improving plant tolerance to abiotic stress Baohong Zhang East Carolina University Abstract: MicroRNAs (miRNAs) are an extensive class of endogenous, small RNA molecules that sit at the center of regulating gene expression in multiple developmental and signalling pathways. Recent studies have shown that abiotic stresses induce aberrant expression of many miRNAs, thus suggesting that miRNAs may be a new target for genetically improving plant tolerance to certain stresses. These studies have also shown that miRNAs respond to environmental stresses in a miRNA-, stress-, tissue-, and genotype-dependent manner. During abiotic stress, miRNAs function by regulating target genes within the miRNA-target gene network and by controlling signalling pathways and root development. Generally speaking, stress-induced miRNAs lead to down-regulation of negative regulators of stress tolerance whereas stress-inhibited miRNAs allow the accumulation and function of positive regulators. Currently, the majority of miRNA-based studies have focused on the identification of miRNAs that are responsive to different stress conditions and analyzing their expression profile changes during these treatments. This has predominately been accomplished using deep sequencing technologies and other expression analyses, such as quantitative real-time PCR. In the future, more function and expression studies will be necessary in order to elucidate the common miRNA-mediated regulatory mechanisms that underlie tolerance to different abiotic stresses. The use of artificial miRNAs, as well as overexpression and knockout/down of both miRNAs and their targets, will be the best techniques for determining the specific roles of individual miRNAs in response to environmental stresses. Key words: microRNA, biotechnology, abiotic stress, crop improvement

20

NOTE

Prebiotic-like effects of fruit and vegetables polyphenols Yves Desjardins. Institute of Nutrition and Functional Foods, Laval University, Québec City, Québec, Canada, GIV 0A6. Abstract: It is now widely accepted that fruit and vegetables (FAV) are providing many health benefits. Indeed, preclinical and human clinical studies have shown that regular consumption of FAV prevent or reduce the incidence of many disorders and illnesses like cardiovascular diseases, obesity, metabolic syndrome, diabetes, cancer, and neurodegenerative diseases. FAV are rich sources of minerals, vitamins, fibres and phytonutrients and they are especially rich in polyphenols. These molecules display strong antioxidant activity in vitro, but less so in vivo. There is thus much debate on the exact mode of action of these bioactive molecules on health. Polyphenols have a very low bioavailability and are subject to extensive phase I and II metabolisms once in circulation. However, more than 95% of these molecules reach the colon intact where they can modulate the gut microbiota and prevent dysbiosis. We have recently shown that berry polyphenols can strongly alter the gut microbiota and favour the development of a beneficial gut microbial community. In particular, they can stimulate the growth of a mucus inhabiting bacteria called Akkermansia municiphila, coined the “anti-obesity” bacteria. This bacterium has been associated with reduction of gut leakiness and attenuation of low-grade inflammation. We will thus present in this conference results to support new modes of action of FAV on the gut microbiota and in turn, show how microbiota homoeostasis may prevent many chronic diseases.

21

NOTE

Opportunities to improve yield by manipulation of photosynthesis Christine Raines University of Essex, UK The increasing world population is placing increasing demands on the need to develop higher yielding crop varieties. The primary determinant of crop yield is the cumulative rate of photosynthesis over the season and there is now clear evidence from transgenic studies that the manipulation of the photosynthetic carbon assimilation pathway (Calvin-Benson cycle) could increase yield in a range of species. We have taken a multigene approach to improve carbon assimilation and have shown that overexpression of SBPase in combination with FBPaldolase, ictB (from cyanobacteria), the H subunit of glycine decarboxylase or a component of the algal electron transport chain can lead to a further increase in photosynthesis and biomass. We have tested these manipulations in both controlled conditions and in the field and the results of these studies will be presented.

22

NOTE

Imaging techniques for horticultural phenotyping - case studies from UTokyo International Field Phenomics Research laboratory Wei Guo*, Yue Mu, Masayuki Hirafuji, Seishi Ninomiya International Field Phenomics Research laboratory Institute of Sustainable Agro-ecosystem Servicies, the University of Tokyo, Nishitokyo, Tokyo 188-0002, Japan Abstract: A simple goal of phenotyping is, of course, to measure crop performance. Crop performance is determined by three factors; genotypes, environmental conditions and human managements under fairly complicated interactions between them. However, comparing with the rapidly developed genotyping techniques, conventional labor-intensive and costly phenotyping has become the bottleneck. To reduce such genotype-phenotype gap, developments of breaking high-throughput phenotyping technologies such as multi-scale sensing and image data analyzing have been dramatically accelerated. In this talk, along with the case studies of popular horticulture crops such as grapes, tomatoes, and peaches in Japan, we introduce several image sensing techniques that aim to quantitatively evaluate the crop performance, fruits yield and quality from pre-harvest to post-harvest stage. Key words: multi-scale sensing, image analyzing, machine learning

23

NOTE

The use of red and far-red light in protected horticultural production Zhirong Zou Northwest A&F University, China. Abstract: Red (R) and far-red (FR) light distinctly influence phytochrome-mediated initial tomato growth and development, and more recent evidence indicates that these spectra also modulate responses to tomato abiotic stresses and flowering. Tomato seedlings were exposed to different R: FR conditions (7.4, 1.2 and 0.8) under salinity stress (100 mM NaCl), and evaluated for their growth, biochemical changes, active reactive oxygen species (ROS) and ROS scavenging enzymes, pigments, rate of photosynthesis, and chlorophyll fluorescence. The results showed that under conditions of salinity, tomato seedlings subjected to a lower R: FR value (0.8) significantly increased both their growth, proline content, chlorophyll content and net photosynthesis rate (Pn), while they decreased malondialdehyde (MDA) compared to the higher R: FR value (7.4). Under conditions of salinity, the lower R: FR value caused a decrease in both the superoxide anion (O2•−) and in hydrogen peroxide (H2O2) generation, an increase in the activities of superoxidase dismutase (SOD, EC 1.15.1.1), peroxidase (POD, EC 1.11.1.7) and catalase (CAT, EC 1.11.1.7). Tomato seedlings grown under the lower R: FR value and conditions of salinity showed a higher actual quantum yield of photosynthesis (ΦPSII), electron transport rate (ETR), and photochemical quenching (qP) than those exposed to a higher R: FR, indicating overall healthier growth. However, the salinity tolerance induced at the lower R: FR condition disappeared in the tomato phyB1 mutant. Analysis of the tomato genome uncovered 13 PEBP (phosphatidylethanolamine binding protein) genes, and found six of them were FT-like genes which named as SlSP3D, SlSP6A, SlSP5G, SlSP5G1, SlSP5G2 and SlSP5G3. 6 FT-like genes were analyzed to clarify their functional roles in flowering using transgenic and expression analyses. We found that SlSP5G, SlSP5G2 and SlSP5G3 proteins were floral inhibitors whereas only SlSP3D/SFT (SINGLE FLOWER TRUSS) was a floral inducer. SlSP5G was expressed at higher levels in long day (LD) conditions compared to short day (SD) conditions while SlSP5G2 and SlSP5G3 showed the opposite expression patterns. We also found NB every 2 hours by R light at intensities of 10 µmol m-2 s-1 or lower R:FR (e.g., 0.6) caused a clear delay in tomato flowering and promoted SlSP5G mRNA expression. The promoted SlSP5G mRNA expression induced by red light NB and low R:FR treatments was reversed by a subsequent FR light stimulus or a higher R:FR treatment. The tomato phyB1 mutation abolished the effects of NB, lower R:FR and photoperiod treatments on flowering and SP5G mRNA expression, indicating that the effects were mediated by phytochrome B1 in tomato. Our results strongly suggest that R and FR light involved in tomato abiotic stresses and flowering. SlSP5G mRNA suppression is the principal cause of different light qualities effects on flowering in tomato.

24

NOTE

Genetic structure of the native Cornus kousa (Asian dogwood) NOTE populations from Eastern Asia Logan C Houston 1, Sarah L Boggess 1, Denita Hadziabdic 1, Anthony S Aiello2, Masahiro Yamanaka3, Mitsuhiro Hayasida4, Robert N Trigiano1, Marcin Nowicki 1 (1 University of Tennessee - Knoxville; 2 University of Pennsylvania - Morris Arboretum; 3

International University of Health and Welfare ; 4 Yamagata University)

Abstract: Asian dogwood (Cornus kousa F. Buerger ex Hance) is a medium-sized understory tree, desirable for its ornamental year-round appeal. Many commercial cultivars of C. kousa and hybrids with other dogwood species (notably, North America-native C. florida L.) have been released, owing to the relatively higher (a)biotic stress resistance presented by C. kousa. In the USA alone, around 3M dogwood trees are sold annually, generating roughly $30M revenue. While C. florida species genetic diversity has been extensively studied, only limited research has been completed on C. kousa. To investigate the genetic diversity, we genotyped 131 gDNA samples of wild, non-cultivated C. kousa from the species native range (China, Korea, Japan). We sampled both fresh leaves and herbarium specimens as old as 1887 and subjected the gDNA collection to the genotyping pipeline using 18 genomic SSRs, 22 EST-SSRs, and chloroplast DNA haplotyping systems. Data analysis using a suite of population genetics programs implied three distinct diversity hot-spots of C. kousa, congruent with the country of origin, and provided the first evidence of the species population structure with minor genetic differentiation. This is, to our knowledge, the first detailed report on C. kousa population structure. Our results bear important implications for future breeding efforts, indicating that multiple sources of diversity may be used for cultivar development. Key words: flowering dogwoods; ornamental trees; species diversity; genotyping; population structure

25

The application of advanced imaging techniques to fruit phenotyping Bo Li1, Helen Cockerton1, Eleftheria Stavridou1, Joe He2, Richard Harrison1 (1 NIAB EMR; 2 University of Reading) Abstract: NIAB EMR is a major UK organisation for innovation and research on horticultural crops and their interactions with the environment. Our science informed fruit breeding programme combines traditional, well established plant breeding strategies with latest genomic approaches. Traditional fruit crop phenotyping relies on the human eye to assess most external fruit quality attributes, which is time-consuming and subjective, and for internal quality attributes, chemical analysis must be used, which is both destructive and low-throughput. The incredible advances in genomics over the past decade are now restricted by the low throughout capacity of traditional phenotyping methods. The application of advanced imaging and data mining techniques have been investigated, which will be developed to establish standards for objective and high-throughput fruit phenotyping. Several imaging techniques including 2D, 3D and hyperspectral imaging have been developed, and machine or deep learning were applied for abiotic or biotic stress quantification, fruit quality measurement and yield forecast. Key words: Fruit phenotyping, image analysis, remote sensing, machine learning, fruit breeding

26

NOTE

An Ultra-genomic Variation Map Reveals Evidence of Selective Sweeps in Melon Domestication Shi Liu1,2, Peng Gao1,2, Qianglong Zhu1,2, Xuezheng Wang1,2, Hongyu Liu1,2, Zicheng Zhu1,2 and Feishi Luan*1,2 College of Horticulture and Landscape Architecture, Northeast Agricultural University,

1

Harbin, Heilongjiang Provence, China,

Key Laboratory of Biology and Genetic

2

Improvement of Horticulture Crops (Northeast Region) Ministry of Agriculture, Harbin, China

Abstract: As an important member of cucurbitaceae family, the genomic evidence during melon domestication and improvement remained poorly understood. The goal of this study is to investigate the genomic signatures from the wild to the improved cultivated. Totally 294 melon germplasm resources included wild, landrace and and improved melon accession were re-sequenced with each accessions >5 × depth to get an ultra-genomic variation map contained 2,045,412 single-nucleotide polymorphisms (SNPs). The results implied domestication and improvement were the two important stages from wild melon to modern cultivated. The wild type were domesticated into to the landrace of C. melo ssp. melo and C. melo ssp. agrestis with 61 and 53 selective sweeps contained 203 and 179 annotated genes with aroma, sugar accumulation, disease resistant, stress tolerance and plant development, respectively. Five aroma related genes were both domesticated in the two subspecies. And then the C. melo ssp. melo landrace improved into of varieties with 62 sweeps contained 212 annotated genes while the C. melo ssp. agrestis landrace have undergone an extremely whole-genome variation performed a high degree improved events. This study advance the understanding of melon domestication and also give the genome signals to enhance the melon breeding.

27

NOTE

Improving tomatos' broad spectrum resistance to diseases by Clonostachys Rosea primed tomato defense to Botrytis Cinerea Aoxue Wang Northeast Agricultural University, China. Abstract: C.Rosea is a kind of antagonistic fungus to Botrytis cinerea, Cladosporium fulvum, Fusarium wilt, etc. in tomato. One of the biocontrol mechanisms of C. Rosea is defense priming is inducing resistance to disease in tomato. Moreover, the mechanism can be used to improve the broad-spectrum disease resistance of tomato. In this study, two key genes, aATP and Lexyl2 genes, which inducing tomato defense priming by C.Rosea were isolated. The expression, function and defense priming mechanism of aATP gene were investigated by ectopic overexpression in tobacco. The transcriptional profiling, change of physiological and biochemical parameters in tomato and tomato mutants were measured so as to analyze the signal transduction pathway of aATP involved in B. Cinerea resistance. This study will provide the theoretical basis and gene materials for further elucidating the plant defense priming mechanism and improving broad-spectrum disease resistance of tomato.

28

NOTE

A Cross-species Study of Fruit Ca Uptake and Distribution Patterns Reveals Common Features in Fruit Ca Uptakes Wen-Pei Song, Jun-Wen Yi, Hui-Cong Wang, Xu-Ming Huang. (South China Agricultural University) Abstract: Calcium (Ca) deficiency in fruit causes various physiological disorders leading to crop loss. There is dispute over pathways of fruit Ca gain. Most researchers support Ca transport exclusively via the xylem/apoplast pathway; some studies also showed that phloem may serve as an important route for Ca delivery. Previous studies on fruit Ca focused on one species. This study attempted to understand some universal relations to fruit Ca uptake across species. Ca contents in fruit tissues were analyzed in different fruits, including three cultivars of litchi, two cultivars each of grape and citrus, and one cultivar each of loquat, apple, pear, Indian jujube and longan. Fruit Ca uptake rate and activity were calculated and correlated with fruit growth, xylem functionality and pedicel anatomy. The influence Ca channel inhibitor La3+ on fruit Ca uptake was examined, and Ca2+ analogy Sr2+ was used to trace Ca2+ distribution in litchi and citrus. The results showed that fruit Ca uptake rate was highest in pomes (loquat, apple and pear), followed by Indian jujube drupe, arillate fruits (litchis and longan) and citrus, while grape berries were the lowest. Fruit Ca uptake rate showed a strong positive correlation to growth rate. However, Ca uptake activity, reflecting Ca uptake rate relative to growth, was highest in arillate fruits and loquat and lowest in grape berries, and had a poor correlation with fruit growth rate. In all fruits, Ca concentration in the pedicel was higher than in the fruit, and they displayed a good positive correlation. In the pedicel, Ca was most abundant in the phloem. Dye tracing showed that xylem function loss occurred with maturation in all species. Apple had the poorest xylem functionality with least development of secondary xylem, but its Ca uptake rate was among the highest. Vessel density and size in the pedicel showed no correlation with fruit Ca uptake rate. In litchi, Ca level in the phloem was always significantly higher than in the xylem and increased with stem age, suggesting constant influx of Ca into the phloem from the xylem. La3+ increased Ca in the xylem in the pedicel and significantly reduced Ca accumulation in fruit, suggesting influx of Ca into the symplast was involved in fruit Ca uptake. In citrus, however the treatment had no significant effect. In both species, Sr2+ introduced from fruit stalk was found to be transported to fruit through the phloem as Sr was largely distributed in the phloem. It is concluded that: (1) fruit growth may be a key determinant of Ca uptake; (2) xylem functionality loss with fruit maturation is also a universal event; (3) in the pedicel, Ca is universally more distributed in the phloem; (7) vessel morphology in the pedicel is not rate-limiting for fruit Ca uptake; (6) extensive influx of Ca from xylem into the phloem/symplast pathway in the pedicel, enabling it to contribute a considerable part to Ca uptake in fruit. Key words: calcium transport, pedicel, pericarp, Ca oxalate, phloem pathway

29

NOTE

Mature leaves and young leaves, opposite roles in litchi flowering Biyan Zhou South China Agricultural University. Abstract: At a developmental stage, flowering can be regarded as a transition from vegetative to the reproductive phase. Litchi (Litchi chinensis Sonn.) is Sapindaceae making significant contributions to the lives of millions of people in tropical and subtropical regions. This tree crop has to experience chilling to induce flowering. Normally litchi trees flower at the apex of the terminal shoots. It was shown that the developmental stages of the terminal shoots are related to flowering. Terminal shoots with dark green leaves had higher flowering rates than those with yellowish green or yellowish red leaves. Moreover, expression level of the litchi homolog CONSTANTS (LcCO) and FLOWERING LOCUS T 2 (LcFT2) was higher than that of yellowish red leaves. The accumulation of carbohydrates in these shoots is dependent on mature leaves, which have photosynthetic capacity. It is suggested that mature leaves play important roles in litchi floral induction, whereas young leaves inhibit flowering. Further, after floral initiation, young leaves in the panicles may inhibit floral bud differentiation. Under normal climate conditions, the growth of panicle primordia prevail and the rudimentary leaves in the panicles abscise. However, in the context of global warming and climate change, the panicles may be exposed to excessively high temperature in spring, and the rudimentary leaves expand to be young leaves, inhibiting panicle primordia from development. Hence, it is important to encourage panicle development by suppressing the growth of rudimentary leaves. It was found that methyl viologen dichloride hydrate (MV) and sodium nitroprusside (SNP) promoted flowering in litchi partially by inhibiting the growth of rudimentary leaves via reactive oxygen species (ROS) and nitric oxide (NO). ROS- and NO-induced PCD may be involved in the regulation of the rudimentary leaf growth in litchi. LcMCII-1, LcNAC5 were found to be the main regulators in the ROS-induced senescence of the young leaves. Silencing LcMCII-1 by virus-induced gene silencing delayed ROS-dependent senescence. The ectopic over-expression of LcMCII-1 and LcNAC5 in transgenic Arabidopsis promoted ROS-dependent and natural senescence. Consistently, the transient expression of LcMCII-1 and LcNAC5 in tobacco leaf by agroinfiltration resulted in leaf yellowing. Keywords: Mature leaf, young leaf, flowering, litchi

30

NOTE

Evaluation of a modified open-top chamber simulation system on the study of elevated CO2 concentration effects on Lycium barbarum MA Yaping1, WAHG Naigong2, CAO Bing1*, JIA Hao1, SONG Li-hua1 1.School of Agriculture, Ningxia University, Yinchuan 750021, China 2. Hebei qi shi electronics technology Limited Company, Handan 056004, China Abstract: Elevated carbon dioxide (CO2) concentration in the atmosphere has received great attention due to its potential repercussion on global warming and direct effects on the vegetation, especially with a potential increase in atmospheric CO2 level from 400 μmol∙mol-1 to 1000 μmol∙mol-1 by the end of 21st century according with currents environmental studies. Therefore, development of new technologies on controlled environment conditions to investigate plant response to CO2 enhancements are needed, and its possible repercussion on world food security. Among the controlled environment facilities such as the Free Air CO2 Enrichment (FACE), Soil-Plant-Atmosphere research chambers (SPAR), and CO2-Temperature Gradient Chambers (CTGC), the open-top chambers (OTC) are commonly used to control elevated CO2 concentration for plant science research in plant responses to climate change, but different plant species and growth stage will have different responses according to the previous study. Lycium barbarum (Goji berry), a homology of medicine and food plant, is one of the unique characteristic economic woody plants in Ningxia province. How does the Lycium barbarum response to elevated CO2 concentration has been studying. In the present study, we evaluate a modified OTC, designed and constructed based on previous OTC experiences, which provides a precise control of CO2 under different concentrations, with excellent control of air temperature and humidity, and the response the of Lycium barbarum . Three parts of OTC chamber structure, control system and monitoring system are improved and upgraded. (1) The modified OTC has a regular octagonal prism structure made of plastic steel 4 mm thick high transmittance glass material, an improvement over the previous system. The structure dimensions are 1.08 m length (diagonal), of 2.78 m diameter, and the inner and outer height (top) of 2.55 m and 2.10 m, respectively. (2) The monitoring system consisted of CO2 analyzers, temperature and humidity sensors, and a data acquisition system. (3) The control system is also composed by other features like programmable logic controller, GPRS communication module, a touch screen, a micro-relay, CO2 pressure reducing valves, solenoid valves, perforated

31

NOTE

windpipes, and CO2 cylinders. The OTC control system automatically collects and uploads data every six minutes using a system control coupled to the PI regulation mode（Proportional integral controller）. A linear controller generates deviation monitoring according to a given and an actual output value. The system is also equipped with a GSM communication module connected with the PLC through the Protocol PPI(Point to point interface) to upload all the data to a web server. The OTC control, monitoring system and the data can be accessed in real time through web browser or mobile App, reducing operation costs and allowing environmental variables monitoring. (4) To test the functionality of the modified OTC, Goji berry plants were grown from May to October on 2017 inside the chambers. Real-time data of CO2 concentration, temperature, and air relative humidity of the chambers were collected. As a result, the average CO2 levels obtained in the chamber during the study period was 369.33 μmol∙mol-1 for ambient conditions, while elevated group 1 and group 2 showed concentrations of 558.35 μmol∙mol-1 and 772.71 μmol∙mol-1 respectively. The fluctuation for elevated group 1 ranged from 551.82 to 572.40 μmol∙mol-1 with a variation amplitude of 20.58 μmol∙mol-1. In the elevated group 2, the range of CO2 concentration was from 756.71 to 779.79 μmol∙mol-1 with variation amplitude of 23.08 μmol∙mol-1. In addition, no significant differences were found in temperature and air relative humidity among the chambers treatments (P > 0.05). All these results demonstrated precise control of CO2 concentration, temperature, and humidity inside the modified OTC chambers, showing an excellent development of CO2 effect improvement on Goji berry study, and it can be used to test climate change response in other plant species. The improved OTC control system can automatic unsupervised operation 24 hours a day. All data systems are automatically uploaded to the Web server. The system operation status can be monitored in real time through a Web browser/mobile phone APP, and the system can be controlled and the solenoid valve can be opened and closed. The system can be used to study the simulation test of plants responding to climate change, and it can also provide reference for other studies related to the simulation of climate change.

Key words: Open-top chamber; CO2 concentration; Temperature; Air relative humidity; Lycium barbarum

32

NOTE

Creation of Chinese kale fertility-restorers and application to recover the fertility of Ogura CMS cabbage with clubroot-resistance Hailong Yu, Zhiyuan Li, Zhiyuan Fang, Limei Yang, Mu Zhuang, Honghao lv, Yangyong Zhang Institute of Vegetables and Flowers Abstract: Ogura cytoplasmic male sterility (Ogu-CMS) has been extensively used for Brassica oleracea hybrid production. However, because of maternal inheritance, all the hybrids produced by CMS lines are male sterile and cannot be self-pollinated, which prohibits germplasm maintenance and innovation. This problem can be overcome by using the Ogu-CMS restorer line, but restorer material is absent in B. oleracea crops. Here, Rfo, a fertility-restored gene of Ogu-CMS, was transferred from rapeseed restorer lines into a Chinese kale Ogu-CMS line using interspecific hybridization combined with embryo rescue, because the generation time of Chinese kale is much shorter than other subspecies of B. oleracea. A novel allele-specific Rfo marker was developed based on the BLAST analysis of highly homologous Rfo sequences in B. oleracea. Then the novel marker was used to select the interspecific hybrids and their successive backcross progenies. Finally, the fertility-restorers 16Q1-4 and 16Q2-11 were created with high seed setting, genetic background highly similar with the Chinese kale, which was identified at morphological, molecular and ploidy levels. 16Q2-11 was then used to restore the fertility of Ogura CMS cabbage with clubroot resistance, which cannot be self-pollinated and utilized to select inbred lines for CMS hybrids. And the clubroot resistance gene CRb was successfully transferred from the CMS hybrid to the normal inbred lines, with fertility-recovered and field resistance to clubroot. It is the first time to create the Ogura CMS fertility-restorers and transfer the clubroot resistance gene CRb, which could solve the problem of lack of clubroot resistant breeding materials in B. oleracea crops. Keywords: Ogura CMS cabbage, fertility-restorer, distant hybridization, clubroot resistance

33

NOTE

Apricot: Morphological, biochemical and molecular aspect Sezai Ercisli Ataturk University Agricultural Faculty Department of Horticulture 25240 Erzurum-Turkey e-mail: [email protected] Abstract: Turkey is accepted second homeland of Apricot after China in the world. Turkish the superior, sweet seeded apricot clones are called ‘Kayisi’ and old, local seedlings with smaller fruit and bitter seeds are called ‘Zerdali’. Some Zerdali types have sweet seed. In Turkey over 70% of trees are budded onto seedlings. The seed propagated apricots are called in Turkey as ‘wild apricots’ as well. This terminology is still ‘black box’ in apricot producing countries. Extensive variability exists among wild apricots and cultivars within and between districts in quality and time of harvest. Although most cultivars mature between the end of May and the beginning of August and wild apricot populations mature from mid-July until the 20-25th August, some wild apricot forms mature in late September. These forms may be important to extend the harvest period. Late blooming and growth dwarf types have also been reported among the native apricot seedling populations in the Erzincan plain. The Sakit valley located in Mediterranean coastal region has also important early maturated apricot genetic resources. There were numerous local types coming from seeds in this valley and a selection study conducted on these materials and some promising Sakit types has been released as cultivar candidate. In this study apricot genetic resources in Turkey were characterised by morphological, biochemical and molecular data. Keywords: Apricots, genetic resources, wild apricots. Keywords: diversity, phytochemicals

34

NOTE

PbrPLDδ1-derived phosphatidic acid mitigates S-RNase signaling in pear Jianqing Chena,c, Peng Wanga, Barend H.J. de Graafb, Hao Zhanga, Huijun Jiaoa, Chao Tanga, Shaoling Zhanga,1, and Juyou Wua,1 Center of Pear Engineering Technology Research, State Key Laboratory of Crop

a

Genetics and Germplasm Enhancement, College of Horticulture, Nanjing Agricultural University, Nanjing 210095, China Cardiff School of Biosciences, Cardiff University, Museum Avenue, Cardiff CF10 3AX,

b

United Kingdom College of Horticulture, Fujian Agriculture and Forestry University, Fuzhou 350002,

c

China Abstract: S-RNase has been discovered more than 30 years ago and has been shown to act as the pistil determinant in the S-RNase-based self-incompatibility (SI), which prevents inbreeding in multiple species. After entering the SI pollen, S-RNase become cytotoxic to induce pollen tube death. The mechanism underlying S-RNase sensing and responsible pattern of SI pollen tube are largely unknown. Here, we show that S-RNase interacted with an actin protein, PbrAct1, and mediated the actin cytoskeleton depolymerization in the SI pollen tube of Pyrus bretschneideri. Meanwhile, the incompatible S-RNase enhanced the expression of a membrane phospholipase D enzyme, PbrPLDδ1, increasing the concentration of phosphatidic acid (PA). PA in turn prevented the actin cytoskeleton depolymerization elicited by S-RNase and delayed the SI pollen tube death. Pharmacologically and genetically analysis establishes the essential role of PbrPLDδ1 to prevent SI pollen tube death. The postponed death of pollen tube potentially ensures which continues growing for a longer distance in the pistils for fertilization. Our results provide a new protection mechanism of pollen tubes which is initially triggered up to the point of no return and describes the protective role of PbrPLDδ1 on cytotoxic action of S-RNase.

35

NOTE

The regulation of ethylene biosynthesis in apple fruit ripening Aide Wang Shenyang Agricultural University Abstract: Fruit ripening is very important for fruit storage. For climacteric fruit such as apple, the ripening process determines the fruit storage potential. Plant hormone ethylene is the main regulator of fruit ripening in climacteric fruit. In the biosynthesis of ethylene, ACS and ACO are two key enzymes and they are responsible for the formation of ethylene. In the ethylene signal transduction, ERF transcription factors control the ethylene responsive genes. In addition, ERFs have feedback regulation on ethylene biosynthesis. In our study, we focused on the regulation of ethylene biosynthesis during apple fruit ripening, in which the regulation of ERF transcription factors on ethylene biosynthetic genes was elucidated. Moreover, the mechanism by which JA promotes ethylene biosynthesis during apple fruit ripening was highlighted. We also investigated the influence of other plant hormones including IAA, GA, and BR on ethylene biosynthesis in apple fruit ripening. Our findings will be helpful for further study on the regulation of ethylene production during apple fruit ripening.

36

NOTE

Transcription factors regulated persimmon fruit postharvest deastringency and softening Xueren Yin, Qinggang Zhu, Miaomiao Wang, Kunsong Chen (Zhejiang University) Abstract: The persimmon (Diospyros kaki) fruit is a particular horticultural product for studying fruit response to hypoxia, as the anaerobic environment (>90% CO2 treatment) were widely used reduces fruit astringency by converting soluble condensed tannins (SCTs) into an insoluble form. It also worth to emphasize that most of persimmon cultivars, with about 95% productions, belong to astringent type. However, deastringent treatments usually bring the deleterious effect of promoting excessive softening, reducing shelf-life and marketability. Thus, understanding the molecular basis for deastringency and softening is critical for persimmon industry. Using RNA-seq and Y1H library screening, more than 20 high CO2 responsive ethylene responsive factors (ERFs) were isolated. Among them, at least DkERF9/10/19/22 could directly target on deastringency related genes (DkPDC2 and DkADH1). Moreover, some of DkERF genes were also the mediators for TF-TF cascaded transcriptional regulations (eg. ERF-ERF and MYB-ERF) or TF-TF complex (eg. WRKY-ERF). Apart from deastringency related researches, the parallel studies also indicated that ERF genes were also the main regulators for fruit post-deastringency softening, such as DkERF8/16/19. Based on these findings, application of 1-MCP was introduced to persimmon postharvest handling, combined with high CO2, which could selectively influence deastringency and softening related ERFs. Industrial using of this treatment could accelerate deastringency and maintain fruit firmness. Thus, these studies not only advanced the understanding of the regulations of transcription factors in persimmon fruit, but also lead the improvement of persimmon fruit postharvest treatments. Key words: Persimmon, postharvest deastringency, softening, transcriptional regulation, ERF

37

NOTE

Trichome morphogenesis and MYC1 mediated terpene biosynthesis in tomato Shuang Wu, Jiang Chang, Bin Hua, Zhijing Xu Horticulture College, Fujian Agriculture and Forestry University Abstract:Trichomes, developing on the surface of most shoot-derived organs in plants, function against biotic and abiotic stresses. They exhibit diverse forms in different species. In Arabidopsis, trichomes exist as the unicellular structure. But tomato trichomes include seven multicellular types, with glandular structure on the top of some types. Thus tomato trichomes provide an attractive model system to dissect molecular regulation of cell division, cell morphogenesis and cell fate determination. In this study, we used cellular imaging technique combined with genetic screens to dissect the mechanism behind the morphogenesis and pattern formation of tomato trichomes. Focusing on type II trichome, the largest non-glandular trichome population on the stem of Micro-Tom, we find that proximal cells within a trichome cell file exhibit diffuse expansion pattern while distal cells show more tip-growth features. In addition, distinct organization of actin filaments in proximal and distal cells suggests the differential roles of actin in different expansion pattern of trichome cells. Furthermore, our genetic screens for trichome mutants highlight the essential roles of ARP2/3 and SCAR/WAVE complex in the morphogenesis of multicellular trichomes in tomato. To examine the function of glandular structure, we identified a SlMYC1 gene which exhibits the specific expression in the glandular head of type VI trichome. SlMYC1 seems to interact with previously reported Woolly gene, and together they induce the expression level of terpene synthase gene family (TPS). Overexpression of SlMYC1 confers higher resistance to insects in tomato. These results indicate the crucial role of SlMYC1 in terpenoid synthesis and insect resistance in tomato.

38

NOTE

Orphan genes are involved in drought adaptations and ecoclimatic-oriented selections in domesticated cowpea Guojing Li1, Xinyi Wu1，Maria Muñoz-Amatriaín2，Ying Wang1，Jie Luo1，Pei Xu1 (1Zhejiang Academy of Agricultural Sciences. 2University of California Riverside.) Abstract: Orphan genes (OGs) are genes that are restricted to a single species or a particular taxonomic group. So far, little is known about functions of OGs in domesticated crops. Here, we report our findings on OG-environmental adaptation relationships in cowpea (Vigna unguiculata). We identified 578 expressed cowpea OGs, of which 73.2% were predicted to be non-coding. Transcriptomic analyses revealed a strikingly high rate of OGs that were drought-inducible in roots only, as compared to conserved genes. Co-expression analysis further revealed the possible involvement of OGs in known stress response pathways. Over-expression of UP12_8740, a drought-inducible OG, conferred enhanced tolerance to osmotic stresses and soil drought. By combining Capture-Seq and fluorescence-based Kompetitive allele specific PCR (KASP), we efficiently genotyped SNPs on OGs across a 223-line cowpea germplasm collection. Population genomic parameters including PIC, He, , and Tajima’s D statistics, calculated based on these SNPs, showed distinct signatures between the grain- and vegetable-type subpopulations of cowpea. This work reinforces that OGs are a valuable resource for identifying new genes related to species-characteristic environmental adaptations, and fosters a new insight that artificial selections on OGs might have contributed to balancing the adaptive and agronomical traits in domesticated crops in various eco-climatic conditions. Keywords: Co-expression, Cowpea, Drought, Hairy-root transformation, Orphan genes, Population genomics

39

NOTE

PepperHub, an Informatics Hub for the chili pepper research community Feng Li Hua Zhong Agricultural University, China. Abstract: Pepper is a vegetable of important agricultural and economical value and it is also an important model plants for fruit development due to its rich variation in fruit morphology. In the past, basic research on pepper was lagged hind because of the complexity and lack of genome sequences. With the advancement of sequencing technology, pepper genome projects were completed and published, which laid foundation for comprehensive study on the biology of this important crop plant. To promote pepper basic research and its application in pepper breeding, we generated large sets of transcriptome databases with 3TB data containing 188 pepper samples in triplicates over a time course of development, stress and hormon treatment. We also constructed a webserver, PepperHub, to host these expression data from these sample which allow users to retrieve and visualize the expression profile of their interested genes. The functionality of PepperHub transcriptome module was demonstrated by analyses of pepper MYB gene family expression profile and discovery of potential MYB regulators of color-break, an important physiological process during pepper fruit ripening. PepperHub also hosts other public omics data from pepper research and useful tools, such as BLAST and CRISPR-design etc. We believe PepperHub will provide valuable resources for the pepper research community. PepperHub is available at http://www.hnivr.org/pepperhub.

40

NOTE

Mutagenesis of long non coding RNA alters tomato fruit ripening Ran Li, Yongfang Yang, Guoning Zhu, Benzhong Zhu, Daqi Fu, Yunbo Luo and Hongliang Zhu College of Food Science & Nutritional Engineering, China Agricultural University, Beijing 100083, China Abstract ： Recently, long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in model plants, such as Arabidopsis, rice, and maize. However, the presence of lncRNAs and how they function in fleshy fruit ripening are still largely unknown because fleshy fruit ripening is not present in the above model plants. To investigate further the role of lncRNAs in fruit ripening, it is necessary and urgent to discover and identify novel lncRNAs and understand the function of lncRNAs in tomato fruit ripening. Here it is reported that 3679 lncRNAs were discovered from wild-type tomato and ripening inhibitor mutant fruits. The lncRNAs are transcribed from all tomato chromosomes, 85.1% of which came from intergenic regions. It was observed that 490 lncRNAs were significantly up-regulated in ripening mutant fruits, and 187 lncRNAs were down-regulated, indicating that lncRNAs could be involved in the regulation of fruit ripening. In line with this, VIGS of novel tomato intergenic lncRNA, lncRNA1459, resulted in an obvious delay of ripening of wild-type fruit. Next, we cloned the full-length lncRNA1459, giving two transcript isoforms. In addition, lncRNA1459 exhibited a specific location in the nucleus. Furthermore, in order to fully identify the function of lncRNA1459 in tomato ripening, loss-of-function mutants of lncRNA1459 were developed using CRISPR/Cas9-induced genome editing technology. Compared with wild-type fruits, the tomato ripening process was significantly repressed in lncRNA1459 mutants. Ethylene production and lycopene accumulation were largely repressed in lncRNA1459 mutants. Additionally, genes related to ethylene and carotenoid biosynthesis were distinctly downregulated in lncRNA1459 mutants compared with wild-type fruits. Moreover, expression of numerous ripening-related genes was changed significantly when lncRNA1459 was knocked out. Expression of potential tomato ripening-related lncRNAs was also specifically changed after knocking out lncRNA1459. Taken together, these results provide insight into the role of lncRNA1459 in tomato fruit ripening. Keywords: tomato, fruit ripening, lncRNA, CRISPR/Cas9, RNA-seq, VIGS

41

NOTE

Ethylene promotes flower opening via enhancing asymmetric growth of petal base in roses Chenxia Cheng, Hong Wang, Yuqi Ji, Xiaofeng Zhou, Junping Gao, Nan Ma Beijing Key Laboratory of Development and Quality Control of Ornamental Crops, Department of Ornamental Horticulture, China Agricultural University, Beijing 100193, PR China Abstract ： Flower opening is a fascinating process accompanied by coordinated and rather impressive movement of multiple floral organs, especially perianth/petals. For cross-pollinated plants, flower opening leads to exposure of stamen and gynoecia and thus is critical for pollination success. Although flowering opening is biologically important for many plants, little is known about the mechanism responsible for this process. Regional differences in growth rate has been proven to drive petal unfolding and popping open in some flowers, such as tulip, crocus, and lilium. In roses (Rosa spp.), petal growth was once thought to be the major power of flower opening as well. Interestingly, our previous works showed that phytohormone ethylene could significantly accelerated flower opening but inhibited petal expansion simultaneously in roses, indicating that petal growth and petal movement are independent events. Here, based on morphological and anatomical observation, we argued that petal movement of rose

was

driven

by

asymmetric

growth

of

petal

base,

which

was

cell-expansion-depended and significantly promoted by ethylene. Combined RNA-seq and VIGS-based functional analysis, we identified a homeodomain TF gene which was involved in ethylene-accelerated petal movement and named it as RhPMP1 (Petal movement-related protein 1). RhPMP1 promoter contained two typical EBS (EIN3-binding site) elements and was proven to be a direct target gene of EIN3, the primary transcription factor of ethylene signaling pathway. Silencing of RhPMP1 would result in obvious defect in development of petal base, leading to postponed opening and less response to ethylene. RNA-seq demonstrated that a lot of genes related to cell growth were down-regulated in RhPMP1-silenced rose plants. Moreover, we found that RhPMP1 targeted RhAPC3b, an essential component of APC/C (anaphase-promoting complex/cyclosome) complex. Similar to RhPMP1-silenced lines, RhAPC3b-silenced ones also exhibited defect in flower opening and less sensitive to ethylene. We proposed that EIN3-RhPMP1-RhAPC3b formed a regulatory module to control of ethylene-induced petal movement in roses.

42

NOTE

Genome evolution and the formation of heading leaf in Brassica rapa Feng Cheng, Jian Wu, Jianli Liang, Xiaowu Wang Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China Abstract: Brassica rapa and other Brassica species are derived from a common hexaploid ancestor, and this hexaploid ancestor has been further deduced to origin from a diploid species through a whole genome triplication event. The diploid ancestor has seven chromosomes and resembles the karyotype of tPCK (translocation Proto-Calepineae Karyotype), which was supported by below three aspects: 1) The arrangement of genomic segments in the three subgenomes of Brassica species; 2) The locations of extant centromeres and the traces of paleocentromeres on subgenomes of Brassicas; 3) The evidences from evolution analysis on whole genome sequences of Brassicaceae species with a tPCK genome. With the reconstructed three tPCK subgenomes, we further found significant subgenome dominance in Brassica crops. Subgenome dominance represents a series of biased pehnomenons as that one subgenome retains more genes, more dominantly expressed genes, less functional mutations etc., over the other subgenomes. In B. rapa, its LF (the least fractinated) subgenome retains ~1.5 times more genes in average than the other two subgenomes MF1 and MF2 (more fractionated 1 and 2). Furthermore, paralogous genes in LF are always expressed to higher levels and accumulated less functional mutations than that from MF1 and MF2. More importantly, we found that small RNA mediated methylation of transposons that distributed at genes’ flanking regions plays an important role in the formation of subgenome dominance. Based on these findings, we proposed a bucket hypothesis or pathway efficiency balance model to illustrate the phenomenon of subgenome dominance in polyploids and its similarities to hybrid vigor.

43

NOTE

Phytochrome A signal transduction 1 and CONSTANS-LIKE 13 coordinately orchestrate vegetative branching and flowering in leafy Brassica juncea Sidra Tul Muntha, Yufeng Zhoue, Jinghua Yang, Mingfang Zhang (Zhejiang University, Hangzhou, China) Abstract: Branching is a major determinant of crop yield enabling vigorous vegetative growth and dense canopy. Phytochrome A signal transduction 1 (PAT1) is a positive regulator of phytochrome A signal transduction in response to light, but the involvement of PAT1 underlying vegetative branching remains unknown. In this study, we mapped a phytochrome A signal transduction 1, PAT1, and discovered its new role of counteracting vegetative branching and flowering in the featured leafy Brassica juncea crop. Earlier branching time and intensive branching numbers were significantly displayed when PAT1 was down-regulated in expression indicating a negative regulator of vegetative branching. Down-regulated expression of PAT1 removed branching suppression induced by far-red light. Furthermore, the PAT1 gene negatively regulating of branching occurred only after bud initiation suggesting PAT1 functioned in bud out-growth and branching phases rather than bud initiation. Both biochemical and genetic evidences indicated that PAT1 directly interact with COL13, a negative regulator of flowering, in which PAT1-COL13 complex tunes vegetative branching and flowering. Taken together, our findings provide a new crosstalk modality between phytochrome signal and flowering pathways in regulating vegetative branching and flowering. Promisingly, this will greatly help to enhance crop productivity or earlier harvesting via genome editing of the GRAS-family transcription factor PAT1. Key words: Brassica juncea, branching, phytochrome A signal transduction 1, CONSTANS-LIKE 13, flowering

44

NOTE

Central Cell Fate Determination, Apomixis and Watermelon Breeding Li Yuan College of Horticulture, Northwest A&F University Abstract：There are two gametes in Angiosperm female gametophytes, namely egg cell and central cell. After double fertilization, egg cell will fuse with one sperm and develop into embryo, and central cell will fuse with the other sperm cell and give rise to endosperm. We found that Histidine Kinase CKI1 can specify central cell fate in model plant Arabidopsis. First, in cki1 mutant, central cell and antipodal cells lost their cell fates and acquired egg cell fate. Secondly, ectopic expression of CKI1 will confer central cell fate to micropylar cells. And these “transformed” central cells could be fertilized and develop into endosperm. Our results have shown that CKI1 is necessary and sufficient for central cell fate. Meanwhile, another research has showed that BBML gene can induce parthenogenesis in some monocots, including millet, rice, corn and sorghum. Combining the MiMe system, which can produce unreduced egg cells in plants, we will have the ability to fix hybrid-vigor in monocots. With all the implications from these researches we hope they could shed some light into our watermelon breeding research.

45

NOTE

Biosynthesis, regulation, and detoxification of bitterness in cucurbit plants Yi Shang Yunnan Normal University, China Abstract: Cucurbitacins are triterpenoids that confer a bitter taste in cucurbits such as cucumber, melon, watermelon. These compounds discourage most pests on the plant and have antitumor properties as well as innate toxicity to cells. By integrating genomics and biochemistry, we discovered the molecular basis underlying the biosynthesis, regulation, and detoxification of these bitter compounds in the plants. While the conserved bitterness biosynthetic gene clusters and their regulators confer the convergent domestication of fruit bitterness in wild cucurbits, glycosylation of cucurbitacin have been shown to be involved in its detoxification process. Here, we report the identification of specific cucurbitacin transporter from cucumber, melon and watermelon. Observation of the subcellular localizations of these transporters on either membrane of vacuole or plasma membrane strongly indicate these genes should participate in the detoxification of cucurbitacins by pumping the bitter compound to either vacuole or extracellular space. Biochemical studies using yeast vesicle or oocyte cell show these transporters are H+ antiporters in the transport of cucurbitacin, and knock-out mutation of these transporters lead to a negative feedback regulation on the bitterness biosynthesis in the plants. To our knowledge, this is the first reported triterpenoid transporter in plant. Discovery of the biosynthesis, regulation and transport of cucurbitacins also pave the way for the metabolic engineering of these bitter compounds as potential anti-tumor drugs.

46

NOTE

Natural Variation Underlies Differences in ERFs Activity in Apple Fruit texture and Fruit Peel Degreening Zhenyun Han, Zhenhai Han, Ting Wu (College of Horticulture, China Agricultural University, Beijing 100193, China)

Abstract: Genetic variants of cultivated plant species derived from wild progenitors undergo both natural and human selection for a wide variety of traits. Here, we demonstrated that natural variation in the coding region of the genes ETHYLENE RESPONSE FACTORs (ERFs) contributes to apple (Malus domestica) fruit peel degreening and fruit texture. Furthermore, we demonstrated that ERFs has been under selection since the origin of apple tree cultivation. Taken together, these results reveal allelic variation underlying important fruit quality traits and a molecular genetic mechanism associated with apple domestication.

47

NOTE

Identifications of loci and genes contributing the phenotypic variations between wild and cultivated tomatoes Xia Cui Chinese Academy of Agricultural Sciences, China. Abstract: Wild species can be utilized to improve various agronomic traits in cultivars. However, a limited understanding of the genetic basis underlying the morphological differences between wild and cultivated species hinders the integration of beneficial traits from wild species. In our study, we generated and sequenced recombinant inbred lines (RILs, 201 F10 lines) derived from a cross between Solanum pimpinellifolium and S. lycopersicum tomatoes. Based on a high-resolution recombination bin map to uncover major loci determining the phenotypic variance between wild and cultivated tomatoes, 104 significantly associated loci were identified for 18 agronomic traits. These findings allowed us to construct a trait-locus network to help explain the correlations among different traits based on the pleiotropic or linked loci. We found that two loci could improve the flower number and inflorescence architecture in the cultivar following introgression of the wild-species alleles. We identified SELF PRUNING 5G (SP5G) as a major locus influencing day-length adaptation in tomato domestication. A 52-bp sequence within SP5G 3’ UTR is essential for the enhanced expression of SP5G which is highly correlated with the flowering time in tomatoes through a specific promoter-enhancer interaction under LD condition. The absence of 52-bp sequence within SP5G 3’UTR causes weakened promoter-enhancer interaction and thus reduced SP5G expression in cultivated tomatoes. Our results provide insights into the morphological changes between wild and cultivated tomatoes and will help identify key genes governing important agronomic traits for the molecular selection of elite tomato varieties.

48

NOTE

PERFORMANCE OF MUSAMBI SWEET ORANGE ON ROUGH LEMON AND VOLKAMERIANA ROOTSTOCKS Muhammad Nawaz Khan1, Muhammad Asim1, Shabbir Ahmed2, Muhammad Zubair1, Ehsan ul Haque1, Akbar Hayat1, Allah Bakhsh1, Faisal Hayat3 (1 Citrus Research Institute Sargodha- Pakistan；2 Horticultural Research Station, Nowshera( Soon Valley) Khushab Pakistan；3 College of Horticulture) Abstract: Musambi (Citrus sinensis) is the commercial variety of the sweet oranges group well flourishing at Pakistan. Since many years Musambi is on the way of rapid decline with reduced life span besides drastic reduction in yield and fruit quality grafted on Rough Lemon rootstock. To overcome this problem, Volkameriana as an alternative rootstock to rough lemon was tested with the focus to find out more compatible rootstock to prevent mentioned issues. Observations on different plant growth parameters such as plant height, stock and scion circumference, canopy volume, plant fruit yield and important quality characteristics of fruit were made. The rough lemon depicted statistically significant result in plant height spread and canopy volume in responses recorded for 10 years consecutively from 2008 to 2017. Degree of compatibility in both rootstocks in the year 2008 to 2009 were statistically non significant. The yield was measured in terms of average No. of fruits per plant depicted that Rough Lemon and Volkameriana rootstock produced average 362.62 and 228.04 No. of fruits per plant respectively for the years 2012 to 2017. Moreover, result for different important quality characters i.e fruit weight (g), Peel thickness (mm), Juice percentage, TSS and acidity were found better in case of the plants grafted on Rough Lemon with the mean values of 214.86, 3.35, 46.56, 10.51 and 0.30 respectively for the six years consecutive 2012-2017. Results of studied rootstocks with context to given parameters remained at par; so other promising rootstocks should be taken in account for further studies. Key words: Musamabi, Rough Lemon Rootstock, Volkameriana Rootstock ,Vegetative growth characteristics, Fruit yield

49

NOTE

A new class of plant virus resistance gene, eukaryotic translation initiation factor 2B-beta (eIF2Bβ), and its natural variation in Brassica Jannat Shopan, Chang Liu, Yufeng Zhou, Jinghua Yang, Mingfang Zhang (Zhejiang University, Hangzhou, China) Abstract: Turnip mosaic virus (TuMV) is a member of the Potyvirus genus and has a very broad host range of plant species, including not only many species in the Brassicaceae, but also legumes, ornamentals and weed plants. Recessive resistances to plant viruses in the Potyvirus genus have been found to be based on mutations in the plant eukaryotic translation initiation factors. Here we report that natural, monogenic recessive resistance to the potyvirus Turnip mosaic virus (TuMV) has been found in a number of mustard (Brassica juncea) accessions, which indicated the resistance is controlled by a single recessive gene, recessive TuMV resistance 03 (retr03), an allele of the eukaryotic translation initiation factor 2B-beta (eIF2Bβ). Silencing of eIF2Bβ in a TuMV-susceptible mustard plant line and expression of eIF2Bβ from a TuMV-susceptible line in a TuMV-resistant mustard plant line confirmed the new resistance mechanism. Further genotyping indicated that a single non-synonymous substitution (A120G) in the N-terminal region of eIF2Bβ was responsible for the TuMV resistance. Allopolyploid Brassica juncea, an important part of the U’s triangle model of Brassica comprising vegetable, oilseed and condiment crops, was formed by hybridization between the diploid ancestors of B. rapa and B. nigra, followed by spontaneous chromosome doubling. We found that Root-type varieties diversified at an earlier stage before the advent of oilseed and other vegetable mustard crops, implying that China was the primary center of origin and diversity. A functional copy of a specific allele of eIF2Bβ is required for efficient TuMV infection. More TuMV-resistant germplasms are identified from the earlier diversified Root-type varieties of B. juncea. We trace back to the TuMV resistance in Brassicaceae, in which we deduce that allopolyploid B. juncea employs the new TuMV-targeting, eIF2Bβ, to achieve TuMV resistance. Our findings provide a new target for seeking natural resistance to potyviruses and new opportunities for the control of potyviruses using genome editing techniques targeted on eIF2Bβ. Keywords: Turnip mosaic virus, eukaryotic translation initiation factor 2B-beta (eIF2Bβ), natural variation, Brassicaceae

50

NOTE

Molecular basis of Coconut fruit development and lipid accumulation Dongdong LI, Yusheng Zheng, Yijun Yuan (Hainan University, China) Abstract: Cocos nucifera L. (coconut) is one of the world’s most versatile economically important tropical crops and is well known for its commercial and industrial applications in tropical and subtropical areas. The pulp (endosperm) of the coconut is initially suspended in the water phase of the coconut, which is a liquid endosperm. As development continues, the liquid endosperm is gradually deposited in the coconut inner wall, becoming the edible coconut pulp (solid endosperm). However, in the more than half a century after the completion of the cell morphological studies, there is no new substantive progress in the molecular biology of coconut fruit development. In the past decade, to investigate gene expression profiles in endosperm development, cDNA libraries, SSH library and transcriptome sequencing of fruit on different development stages were applied for genes characterization. A number of genes have been cloned and characterized including acyl-sn-glycerol-3-phosphate acyltransferase (LPAAT), β-ketoacyl-acyl-ACP synthases I (KASI), acyl-carrier protein thioesterase (FATB), diacylglycerol acyltransferase (DGAT) gene. Moreover, several important transcriptional factors closely related to the development of coconut pulp, like MADS and WRI1 genes, were identified and the potential regulatory mechanism was elucidated. Keywords: Coconut, fruit, development, lipid accumulation.

51

NOTE

Analysis of genetic diversity of partial phenotypic traits in guava seedling strains Zehua Ma1, Liu shunzhi1, Xu shejin2, Hu weirong1 (1Guangzhou university, China ; 2 Guangzhou Institute of Fruit Research ) Abstract: The guava (Psidium guava L.) is native to tropical America. Because of its good adaptability, it is usually propagated by seeds. Therefore, gene isolation of offspring seedlings usually leads to differences in traits. Guava is widely distributed in South China, but due to the long-term cultivation of large-scale and single-quality varieties, some local germplasms are lost, leading to the genetic vulnerability of guava crops. In order to evaluate genetic variation of the guava seedling progenies indicated by the 15 quantitative trait indicators and 7 quality trait indicators, such as leaf length, leaf width, leaf shape index, petiole length, internode length, fruit weight, fruit vertical diameter, fruit transverse diameter, hardness, longitudinal diameter of the fruit cavity, fruit cavity diameter, pulp thickness, fruit shape Indexes, fruit cavities index, TSS, leaf color, leaf shape, leaf margin shape, petiole color, leaf base, leaf apex, and flesh color, which were conducted consecutive surveys in 2016 and 2017 in the Guangzhou Institute of Fruit Research, and 36 seedlings were analyzed in this experiment. The aim of this study was to provide original data and information to instruct the chance seedling selection. The results indicated: ①The leaves of the guava seedling were mainly of medium narrowly elliptic leaves, followed by medium elliptic leaves, and a few were large oval leaves and large lanceolate leaves. There were 2 types of flesh color with red meat or white meat, and the fruit shape was mainly oblong and oval. ② The morphological diversity was high among taxa, and the average diversity index was 1.493. In general, the morphological diversity index of quantitative trait (1.92) was higher than that of quality traits (0.52), and the average coefficient of variation is 19.84%. Among them, the largest coefficients of variation between leaf shape and fruit weight were 43.03% and 30.50%, respectively. The trend of the change of the diversity index was opposite to that of the variant coefficient of qualitative trait index. ③ The principal component analysis showed that the 22 characters were integrated into 7 principal components (PC) and their accumulative contribution rate of variation amounted to 77.29%. The first and the second principal components represented 21.45% and 16.61% of variance, respectively. ④ Based on the Euclidean distance and squared deviation sum method, the 36 taxa of guava were clustered into 6 groups. The analysis of variance showed that there was no significant difference in leaf shape, petiole color and TSS among the 6 groups of guava, but the other 19 phenotypic traits (P Keywords: Psidium guava L., morphology, diversity, principal component analysis, cluster analysis

52

NOTE

Methylation analysis of dormancy breaking in almond flower buds (Prunus dulcis (Mill.) D.A. Webb) Federico Dicenta1, Rosa M Ros2, Pedro Martinez-Gomez1, Angela S Prudencio1, Werner Olaf2 (1CEBAS-CSIC, 2 Universidad de Murcia) Abstract: Epigenetic modifications can provide information about the connection between genotype and phenotype variation due to environmental conditions by phenotypic analysis of inherited changes not present in the DNA sequence. DNA methylation, together with histone methylation and other modifications have been described as epigenetic regulation mechanisms of dormancy breaking in fruit trees. In such species like almond, prolonged exposition to cold temperatures is required for dormancy release and flowering. Aiming to identify regions with differential methylation in response to chill accumulation and also related to genotype, we performed Illumina reduced representation genome sequencing of bisulfite-treated DNA from floral buds of ‘Desmayo Largueta’ (extra-early flowering almond cultivars from Spain) and 'Penta' (new extra-late almond release from CEBAS-CSIC breeding program) at two phenological stages of dormancy for two consecutive years using a cost reduced epiGBS variant (cre-epiGBS) developed in the Department of Plant Biology of the University of Murcia. A total number of 7,317 fragments were sequenced and compared between samples, from which 783 were identified as differentially methylated between almond genotypes. Mapping of these methylation markers versus a reference genome (Prunus persica v.2) will provide information about early and late flowering epigenomes. Additionally, the methylation state of 12 gene coding sequences were found to be associated to breaking dormancy process. Validation of these genes is in progress, in an attempt to describe epigenetic marks that may be contributing to differential chilling requirement and breaking dormancy dates. Funding: Fundación Séneca from the Region of Murcia, Spain (Grants Nº 19308/PI/14 and Nº 19879/GERM/15). Key words: almond; Prunus dulcis; flowering; dormancy, breeding; DNA-Seq; methylation, epigenome

53

NOTE

Induced systemic resistance to grapevine decline and increased Plant growth in the Field condition Maryam Ghayeb Zamharir1, Mahdi Taheri2, Ali Dehghani3 (1 IRIPP, 2 QAO, 3 LARI ) Abstract: Grapevine can be severely affected by phytoplasmas belonging to

different taxonomic groups and there is no effective control strategy for management of these disease. However, there is a long-known phenomenon in phytoplasma diseases called “recovery” which is a spontaneous symptom remission of infected plants by phytoplasmas. A strategy to reduce the number of symptomatic plants could thus arise from the stimulation of plant defence systems to induce recovery. In this order, tow components (T1: Propamocarb/Fosetyl 530:310 g/l and T2: hymexazol) were sprayed with 4/000 concentration on the canopy of phytoplasma-infected grapevines of cv. Bidaneh Sefid in grapevine vineyards in Takestan, Qazvin provinces (Iran). Treatments consisted of monthly sprays in spring-2016 and 2017 (tow applications) in symptomatic plants. All treatments increased the number of recovered plants with respect to the control. Treated plants in 2016 showed any symptoms in next year and treatment repetition were performed in 2017 in same vineyards with different symptomatic plants. Molecular analysis of leaf vein extracts from recovered plants failed to detect the phytoplasma. An induction of host defence is likely to be responsible for the effectiveness of these resistance promoters in the control of grapevine phytoplasma diseases in Iran Key words: Induced resistance, recovery, Vitis vinifera, phytoplasma

54

NOTE

The improved assembly of the European Pear Maryam Ghayeb zamharir1, Ali Abassi2.

(1IRIPP, 2 Azad university) Abstract: Cytochrome oxidase is one of a superfamily of proteins which act as the terminal enzymes of respiratory chains. The two main classes are cytochrome c oxidases, and quinol oxidases. There are two catalytic subunits, I and II. Subunit I contains two heme centers. In this study we have isolated the cytochrom oxidase (COX) gene from orange by PCR and clone it by ligation of this product to pGEM-T vector transformed E. coli bacteria. Sequencing analysis shows that open reading frame for this gene that encode a protein with 217 amino acids. Results of phylogenetic analysis showed that this gene in orange has related to Chondrostoma cytochrom oxidase gene (COX). COX protein secrete in membrane and it’s extracellular secretion is little. The aim of this study was isolation and cloning of COX genes from citrus genome and determining of it’s characterizations to practical use in the plants. Key words: Cloning, cytochrome oxidase C, Mitochondria genome and orange.

55

NOTE

Edible Gardening: A Sustainable Food Security Approach Adnan Younis * University of Agriculture, Faisalabad Abstract: With increasing population influx in cities, has increased demand for safe and fresh food in urban areas. It is estimated that in 2050, approximately 70-75% of world’s population will shift to cities, and that will necessitate to produce more food. In Pakistan population is growing at 3%, and it is estimated that in 2025, it will be projected from 150 million (2010) to 208 million. In order to sustain this increasing pressure on resources, the idea of edible gardening seems to be a viable plan of supplementary production of horticultural food crops in urban and suburban areas. Edible landscape seems to contemporary component of Urban Horticulture (UH). UH is referred to “Horticulture activities within or around city according to the consumers’ demand for food like, fruits, vegetables, and other uses like herbs, processed products, as well as ornamental plants for aesthetic gratification. The role of urban horticulture (UH) in response to the dietary requirement of urban dwellers, by using local resources and recognizing the importance that economic and resources used will not affect residents’ health, food safety, and environmental conditions. Horticultural plants are best option that can be grown for food consumption (fresh or processed) and for aesthetic gratification in cities and surroundings. Many countries have already felt this peril and working to seek alternative growing areas to feed this increasing population. In developing countries like Pakistan, now the importance of growing food plants in urban and suburban surroundings is getting government attention. In Pakistan the idea of urban horticulture is getting popularize and many growers are involved in cultivation of vegetables in cities and its surroundings due to huge demand. A survey was conducted in Faisalabad and public perception was collected through a validated questionnaire to understand the public perception and opinion about acceptability of edible gardening. Key words: Vertical gardening, Container gardening, Organic production, Health, Urban Horticulture

56

NOTE

IMPENDING DATES FOR FUNCTIONAL FOOD PRODUCTS Dr Shamas Murtaza1, Dr Mian Anjum Murtaza2, Dr Aysha Sameen3, Dr Umar Farooq1, Dr Muhammad Shahbaz1, Dr Nabila Hussain1

(1 Department of Food Science and Technology. 2 Institute of Food and Nutrition. 3 National Institute of Food Science and Technology.) Abstract: Pakistan is among the top ten date producers and having the developments in date consumption as a component of food products. The date palm (Phoenix dactylifera) is a tropical and subtropical tree. It belongs to the family Palmae (Arecaceae). It is the oldest cultivated plant in the Arabian region. It is cultivated mainly in the hot arid regions. Saudi Arabia is the world largest producers of dates. The date fruit are conventionally used in the preparation of some products such as fermented products and date pastes. Its seeds are either used as animal feed or gone waste. Chemical compounds like phenolic and flavonoids are included in polyphenols. Their antioxidant properties play important role in inactivation of chain reactions of lipid free radicals, preventing hydro-peroxide conversion into reactive ox radicals, chelating redox-active metal ions and from their anti-inflammatory properties. Phenolics and flavonoid compounds are directly related to the antioxidant contents, both reducing powers and radical scavenging. Concentration of epicatechin is relatively low in date seeds because catechin is directly related with reducing the radical scavenging powers. Commercially date bars, date-jam, date-vinegar, date powder, date cookies, date wafers and date squares are being produced. Date flesh contains substantial amount of carbohydrates (73.5%), ash (1.5%), protein (2.3%) and lipids (0.2%). Unsaturated fatty acids include palmitic, linoleic, oleic and linolenic acids. It also contains vitamin A, C, B1, B2, Folic acid and nicotinic acid in addition to 15 mineral elements. Date components are known to promote blood formation. Fiber and calcium play a critical role in preventing heart diseases and colon cancer. It contains invert sugar, which is better utilized as source of energy by diabetic patients than glucose and sucrose. Date paste is utilized in bakery and other food items contributing considerably to their nutritive value. It contains substantial quantities of invert sugars (about 80% on a dry weight basis) proving an important addition to the bakery products. Date syrup is derived from paste and can be used as a sweetener and flavoring agent in the preparation of some traditional and industrial foods like ice cream, confectionery, beverages, alcohol and vinegar. Date honey rich in fructose can be utilized for the production of low calorific value bakery products for diabetic and health conscious consumers. Hence, date paste and honey are the potential ingredients for functional food items targeting various metabolic disorders.

Key words: Date (fruit), functional foods, bakery products, metabolic disorders

57

NOTE

RESPONSE OF GERBERA ON VEGETATIVE AND FLOWERING CHARACTERS UNDER PROTECTED CULTIVATION SUNIL KUMAR * (NORTH EASTERN HILL UNIVERSITY) Abstract: The study was conducted on evaluation of different gerbera cultivars under agro-climatic condition of Pasighat, East Siang District to assess the suitable cultivars for this region. Nine varieties namely, Rionegro, Manizales, Galileo, Marinila, Palmira, Figaro, Teresa, Pia and Tecala were selected for their evaluation. Gerbera suckers were planted on raised bed comprised with recommended nutrient mixtures and adequate watering was supplied to the plants as per need during entire investigation. Significant response in vegetative and flowering characters was observed in cv. Marinila followed by Tecala, Palmira and Rionegro. Highest length of leaf (40.10cm), plant spread (57.04cm), flower diameter (11.22cm) and number of ray florets per flower head (81.20) were associated with cv. Marinila. However, maximum number of leaves (32.40), disc diameter (2.10cm) and breadth of ray florets (1.10cm) was observed under cv. Tecala. Cultivar Palmira showed increased leaf breadth (14.78cm) and length of ray florets (4.34cm), whereas, flower stalk length was maximum in cv. Rionegro (65.60). The cultivar Manizales produced more suckers per plant per year (7.20), while maximum number of flowers per sq. m per year was observed in cv. Palmira (190.00) followed by Figaro (143.00) and Manizales (137.20). Enhanced vase-life of cut gerbera flowers under tap water was observed in cv. Figaro (20.40 days) followed by cv. Palmira (18.20 days) and Teresa (17.00 days). While, lowest vase life was obtained in cv. Rionegro (7.80 days). The cultivar marinilla, Palmira and Figaro were most preferred by the consumers. Keywords: gerbera, polyhouse, nutrients, watering, vase-life

58

NOTE

The effect of LED lighting on the growth of cress Margit Olle * (Estonian Crop research Institute ) Abstract: Introduction: Light emitting diodes (LEDs) represent a promising technology for the greenhouse industry. LEDs technology has technical advantages, while are only recently being tested for horticultural applications. The problem for cress growers was that cress grown under natural lighting conditions results elongated stems and elongated, narrow leaves. Therefore the purpose of the experiments was to assess the effect of LEDs to the growth of cress. Materials and Methods: The experiments with cress variety ’Fine Curled’ were carried through in a growth chamber at Estonian company K. Compos under bran name USSIMO in winter 2017 from 04.01.17 to 13.01.17. The experiment had 4 replications. The experiment was repeated simultaneously, i.e. at the same time. Treatments were: 1. LED strip [1 cold light (6250K) + 3 warm light (2700K); total power 36W; total intensity ca. 5000 lm]; 2. Natural light (control), plants were grown on window sill. All plants were grown in a substrate containing vermicompost, which substrate had followed characteristics: pH 6.6; P 2689 mg/kg; K 5029 mg/kg; Ca 2656 mg/kg; Mg 2193 mg/kg; organic matter 29.6%. After sowing and the subsequent emergence of the plants, the plants were thinned out if necessary. Cress plants grown from seed to harvest on similar substrates in 12 x 12 x 6 cm boxes. In a single box, seeded slightly less than 1 g of seeds. Test results were recorded from 20 plants per box. The length of the plants (cm) and the length of the roots (cm) were recorded. The length of the leaves (mm) and width of leaves (mm) were also compared. Lighting period in treatment 1 lasted 17 hours (6.00-23.00). Day and night temperature was ca. 22-23 0C. Statistics was carried through with Agrobase software. The comparison of means was performed by Fisher’s method. Signs used: LSD – least significant difference. LED – under LED lights grown plants, Control – control plants, *** p0,05. Results: By using LEDs cress growth parameters were showing followed results: The height of plants decreases, the length of roots decreases, the length of leaves increases and the width of leaves increases. It can be summarized that LED lighting improved growth of cress. The shorter is the plant the quicke the nutrients flow to the top of plant by water flow of transpiration. Therefore cress plants had larger leaves growing under LEDs compared to control treatment. Acknowledgements: Experiments were financed by Estonian Company K. Compos under brand name USSIMO. Key words: cress, growth, LED, light

59

NOTE

Nuclear Phylogenomics and Evolution of Fruit Types in Rosaceae Sezai Ercisli, Gulce Ilhan (Ataturk University). Abstract: Fruit characteristics of Rose species in Bayburt province Abstract: Fruit characteristics of Rose species in Turkey Gulce Ilhan, Sezai Ercisli Ataturk University Agricultural Faculty Department of Horticulture 25240 Erzurum, Turkey [email protected] Turkey is accepted one of the most important Rose germplasm centers and roses distributed throughout Turkey. It is well known that Turkey has 25% of all rose species are native to Turkey. Fruits (rose hip) of some other species have economic value and are also used for medicinal purposes. In this study native promising rose hips visited and fruits collected. The most promising ten genotypes mostly belongs to Rosa canina, Rosa dumalis, Rosa villosa. The fruit weight, length and diameter were found between 1.97-6.22 g; 15.41-36.22 mm and 13.22-22.10 mm, respectively. Soluble solid contents of genotypes were found between 19.43-25.53% and vitamin C (ascorbic acid) content ranged between 588 to 786 mg per 100 g fruit samples. All fruits had high antioxidant activity, total phenolic and carotenoid content. Seed fatty acid content of the genotypes were also determined. Key words: Rose hip, chemical content, vitamin C

60

NOTE

New Marker-Based Breeding Strategies for Peach and Other Perennial Crops Hafiz Umer Javed1, Faisal Hayat2, Aman Ullah Malik3, Muhammad Amin4 (1College of Food science and nutritional engineering, 2 College of Horticulture, 3 Institute of Horticultural Sciences, 4 Institute of Horticulture ) Abstract: Post-storage peel color development strategies for cultivar "Samar Bahisht Chaunsa" mango under Reefer and Controlled Atmospheric conditions Abstract: Samar Bahisht (S.B) Chaunsa is a famous mango cultivar of Pakistan. The mango fruit color is one of the main criteria of consumer’s preference. Post-storage peel color development is a serious issue in our commercial mango cv. S.B. Chaunsa. This study aims to evaluate the best storage management in order to have optimum quality of fruit when it reached to consumers. The fruit were harvested from a commercial orchard at physiological mature stage. After harvesting, fruit were physically de-sapped and subjected to prochloraz (0.5ml/L) dip followed by air drying, packaging and transport to PRTC in a reefer van at 18°C. At PRTC, the fruit subjected to pre-cooling for 8 hrs. at 12°C or 17°C, subsequently stored at 17°C under reefer and CA condition (4% CO2 & 6% O2) for different storage periods (10 & 20 days under reefer) and (10, 20, 30 and 35 days under CA). At removal, fruit were artificially ripened at two different temperatures (24°C or 35°C). The fruit response was significantly different under different treatment regimes. The experiment was laid down under CRD along with factorial design. Under reefer storage conditions (without CA), the fruit removed after 10 days of storage had 4-5 days of shelf life and in CA storage condition, the fruit removed after 10 & 20 days had 5-6 days of shelf life (including ethylene treatment period) at both ripening temperatures; whereas, the fruit removed from reefer (20 days) and CA (30 & 35 days) were found ripe (eating soft) at the time of removal (with 0 days shelf life), thereby not requiring any ethylene treatment. The peel colour development increased significantly at ripening temperature 35°C than 24°C and after removal to final ripe stage while pre-cooling temperature had non-significant effect. Significant difference was found among pre-cooling and ripening temperature regarding to physiological weight loss and respiration rate of reefer and CA stored fruit. Chilling injury, side rot and stem end rot were increased as the storage duration extends in CA stored conditions. Under reefer, the physico-chemical and organoleptic quality of fruit were found meritorious than the CA condition. This paper provides detail about treatment impact on physico-chemical, physiological and organoleptic quality attributes. Key words: Reefer storage, Controlled Atmosphere (CA) storage, color development, Samar Bahisht Chaunsa

61

NOTE

Antioxidants and Flavonoids of Black Truffles Asif Ali Khan1, Anam Zahid2, Yao Fangjie3, Chu Sai Jun 1 (1 Jilin Agricultural University; 2 School of Landscape Architecture, Beijing Forestry University, Beijing, P.R. China; 3 Engineering Research Centre of Chinese Ministry of Education for Edible and Medicinal Fungi, College of Horticulture Jilin Agricultural University, Changchun 130118, P. R. China) Abstract: Truffles is Edible mushrooms from the genus Tuber, a group of mycorrhizal fungi with fruiting bodies, have the good aroma for their unique taste and great economic value. Because of aroma of truffles is the main aim for their use in delicious dishes with many important cuisines, French, Italian or Spanish due to this so it is expensive. T. aestivum are also known as black truffles. T. aestivum have antioxidant, flavonoids and phenolic compounds, anti-inflammatory, antimicrobial, chemo preventive and anticancer properties. Black truffles have the following properties hepatoprotective, anti-mutagenic, anti-inflammatory, anti-carcinogenic, and anti-tuberculoid. Major phenolics compounds are found in black tuffles p-Hydroxybenzoic acid, sterols, Protocatechuic acid and flavonoids mostly are Amentoflavone, Kaempferol, Baicalein, Catechin, Epicatechin respectively. Black truffles are the rich source of amino acids, proteins, lipids, carbohydrates, vitamins. Abundant amount of minerals are present in the black truffles such as zinc, copper, cobalt, magnesium, iron, calcium, sulphur, potassium and phosphrous. Key words: black truffles, anti-inflammatory, chemo preventive, anti-tuberculoid, tuber

62

NOTE

Effect of cotton waste enriched with vegetable peels is an innovative tool for Pleurotus ostreatus mushroom cultivation Asif Ali Khan1, Yao Fangjie2, Fozia 3, Anam Zahid 4, Chu Sai Jun 1 1

Jilin Agricultural University. 2 Engineering Research Centre of Chinese Ministry of

Education for Edible and Medicinal Fungi, College of Horticulture Jilin Agricultural University, Changchun 130118, P. R. China.3 Institute of horticultural sciences, university of agriculture, Faisalabad, Pakistan; 4 School of Landscape Architecture, Beijing Forestry University, Beijing, P.R. China. Abstract: Throughout the globe Pleurotus ostreatus mushroom cultivated commercially for its high nutritional value. Current research was carried to find out whether enrichment of cotton waste with various combinations of vegetable peels affects growth and yield of white oyster mushroom or not. Experiment consisted of five treatments such as (CW 100%) = (cotton waste 100%) (Control), (VP 100%) = (vegetable peels 100%), (CW 75% + VP 25%) = (cotton waste 75% + vegetable peels 25%), (CW 50% + VP 50%) = (cotton waste 50% + vegetable peels 50%), (CW 25% + VP 75%) = (cotton waste 25% + vegetable peels 75%) and single strain of oyster mushroom Pleurotus ostreatus (P1). Significant results were observed for cotton waste enriched with vegetable peels. Least time duration of mycelium growth completion (28 days), minimum time duration of (37 days) for formation of pinheads, maximum number of pinheads (47), utmost yield (132 g) and maximum biological efficiency of (88%) were noticed in case of (CW 50% + VP 50%). Outcome of this experiment showed that appropriate combination of (CW 50% + VP 50%) cotton waste enriched with vegetable peels substrate perform better results for oyster mushroom cultivation. Keywords: cotton waste, mushroom, vegetable peels, nutrients

63

NOTE

Effect of cotton waste supplemented with fenugreek straw on vegetative and reproductive growth of Phoenix oyster mushroom Asif Ali Khan1, Anam Zahid2, Yao Fangjie1, Chu Sai Jun1 Jilin Agricultural University, 2 School of Landscape Architecture, Beijing Forestry

1

University, Beijing, P.R. China Abstract: Pleurotus sajar caju oyster mushroom is cultivated commercially for high nutritional value. Current research was carried out whether cotton waste supplemented with fenugreek straw affects vegetative and reproductive growth of Phoenix oyster mushroom or not. Experiment consisted of six treatments such as (CW 100%) = (Cotton Waste 100%) (Control), (FS 100%) = (Fenugreek Straw 100%), (CW 80% + FS 20%) = (Cotton Waste 80% + Fenugreek Straw 20%), (CW 60% + FS50%) = (Cotton Waste 60% + Fenugreek Straw 20%), (CW 40% + FS 60%) = (Cotton Waste 40% + Fenugreek Straw 60%), (CW 20% + FS 80%) = (Cotton Waste 20% + Fenugreek Straw 80%) and single phoenix oyster mushroom strain (P3). Significant results were noticed for cotton waste supplemented with fenugreek straw. Minimum time duration mycelium growth completion (32 days), least time duration (40 days) for formation of pinheads, highest number of pinheads (39), maximum yield (201 g) and maximum biological efficiency of (90%) were noticed in case of (CW 60% + FS 50%). This study revealed that cotton waste supplemented with fenugreek straw is an innovative tool for high yield of Phoenix oyster mushroom Keywords: mushroom, substrate, fruiting body, growth, organic food.

64

NOTE

Reduced nitrogen level in culture medium, results in the formation of embryogenic calluses with high-frequency regeneration in okra (Abelmoschus esculentus L.) HAFIZ MUHAMMAD RIZWAN 1, Muhammad Irshad 1, Bizhu He 1, Shuang Liu 1, Xiaocao Lu 1, Yueting Sun 1, Dongliang Qiu 1 (1 College of Horticulture, Fujian Agriculture and Forestry University) Abstract: In this study, we have established an efficient protocol using modified MS medium, favored for embryogenic callus formation, through the promotion of shoot induction from cotyledon and hypocotyl explants in okra. Different levels of inorganic–nitrogen (KNO3 and NH4NO3 with 1:2 ratios, 30-60 mM) in MS medium with different PGRs combination were tested. Hypocotyl produced the highest callus induction (71%) on a medium containing 1.0 mgL-1 BAP and 1.5mgl-1 2, 4-D whereas, cotyledon induced (58%) callus on medium containing 1.5mgl-1 NAA and 0.5mgL-1 BAP. Among the tested modified MS medium with different levels of total nitrogen, 1.5 mgL-1 KIN and 0.5mgL-1 IBA induced (66.5%) shoots in hypocotyl with 3.5 numbers of shoots per calli at 40 mM of total nitrogen level, while medium having 30 mM of total nitrogen and 1.5 mgL-1 BAP and 0.5 mgL-1 NAA regenerate (49.50%) shoots with 2.95 number of shoots per calli in cotyledon. High level of nitrogen (60 mM) induced only (9.5%) shoots in cotyledon explant with 0.92 mean numbers of shoots per calli. Healthy and strong roots (79%) were obtained on media containing 2.0 mgL-1 IBA and 100 mgL-1 AC. Rooted plantlets were successfully acclimatized and grow normally. Results show that hypocotyl has more potential for callus induction than cotyledon explants. In comparison with standard MS medium, results demonstrated that using a modified MS medium with reduced nitrogen reprogram the compact non-friable embryogenic callus to friable embryogenic callus with high shoot induction frequency. The current study provides a contribution towards the development of an efficient regeneration and genetic transformation strategy in okra (Abelmoschus esculentus L.). Key words: Plant growth regulators, Modified MS medium and regeneration.

65

NOTE

Runner production and vegetative growth of strawberry as affected by growth hormone and chilling temperature under agro-metrological conditions of pothowar region, Pakistan Samia Ikram 1, Khalid Mehmood Qureshi 2 (1 HORTICULTURAL RESEARCH INSTITUTE FOR FLORICULTURE AND LANDSCAPING; 2 PMAS-University of Arid Agriculture) Abstract: Frageria ananasa commonly known as Strawberry is a famous soft fruit of family Rosaceae. This famous soft fruit is propagated by means of runners that are sold to all parts of the country from Mangora, Swat, Pakistan. Runner production is not seen in other parts of the country. Addressing this issue; present research -work was designed at department of Horticulture, Pir Mehar Ali Shah Arid Agriculture University Rawalpindi, Pakistan. Gibberellic acid (GA3) with 200 ppm, 400 ppm and chilling 4 0C were applied alone and in combination before flower initiation. it was recorded that GA3 @ 400 ppm treatment showed much better growth response in terms of plant height (25.33 cm), petiole length (22.60 cm), number of trusses (2.9), leaf area (139.86cm2), number of runners (20.55), runner number of leaves (7.44), runner canopy spread (30cm), leaf area of runner (80.33 cm2) and weight of mother runner (22.90 g) while chilling at 4 oC proved better to produce maximum crown diameter (3.63 cm), number of leaves (15.44), fresh weight of leaves (48.17 g) and better canopy size (31.55 cm). It can be concluded from the above study that if strawberry plants are applied with Gibberellic acid @400ppm. They can produce runners in any region of Pakistan which will reduce dependency on Mangora, Swat region of Pakistan. Key words: Strawberry; Gibberellic acid; chilling; vegetative growth; runner production

66

NOTE

Classification and development of fruit trichomes and effects of plant hormones on Type II fruit trichome in cucumber Shudan Xue, Mingming Dong, Xingwang Liu, Shuo Xu, Huazhong Ren (China Agricultural University) Abstract: The fruit trichomes of cucumber, Cucumis sativus L, are highly specialized structures originating from the epidermal cells, which influence the perceived quality of the fruits. This study was undertaken for morphological characterization and classification and the developmental processes of cucumber fruit trichomes. In addition, the effects of plant hormones, gibberellin (GA3) and cytokinin (6-benzylaminopurine, BAP), on trichome number per fruit were also examined. Fruit trichomes were examined among 200 cucumber varieties, which could be classified into eight morphologically distinct types (I to VIII). Investigation of the organogenesis of the eight types revealed two main developmental patterns. One is glandular trichome development which consisted of multiple stages including trichome precursor cell protuberating out of the epidermal surface of epidermis; precursor cell expansion; periclinal bipartition to two cells followed by cell division to form the head region and the stalk. The other non-glandular trichomes’ development started with expansion of the precursor cell perpendicularly to the epidermal plane followed by cell periclinal division to form a stalk comprising of some rectangle cells and a pointed apex cell; then the base cell started anticlinal bipartition to two cells, which then underwent many cell divisions to form a multicellular spherical structure. Moreover, we found that GA and BAP were capable of stimulating fruit trichome number with distinct effects under different concentrations. Key words: Cucumber, Cucumis sativus L, fruit trichomes, organogenesis, plant hormone

67

NOTE

Amelioration of Salinity Stress in Pepper (Capsicum annuum, L.) by Acetylsalicylic Acid Foliar Application Hamdino Mohamed Ibrahim Ahmed1, Mahmoud Zaghloul2, Samir El-Afifi2, Mohamed Mohamed1 (1Horticulture Research Institute; 2Mansoura University ) Abstract: Salinity is one of the major stresses in arid and semi-arid regions causing adverse effects at physiological, biochemical, and molecular levels. Exogenous application of acetylsalicylic acid (ASA) alleviated the harmful effects of salt stress in plants and enhanced the physiological, biochemical and molecular events related to plant growth and development. Thus, this study was planned to investigate the ameliorative role of acetylsalicylic acid in mitigating the salinity stress in pepper. Sweet pepper (Capsicum annuum L.) cv Orlando plants were subjected to 0, 25 and 35 mM NaCl soil salinity treatment. Subsequently these plants were sprayed with 0, 0.1, and 0.3 and 0.5 mM ASA to study the ameliorating effect of acetyl salicylic acid (ASA), Salinity decreased plant growth, yield and quality of pepper in a concentration dependent manner. ASA significantly ameliorated the salt stress effect and improved the yield and quality of pepper under saline and/ or non-saline soil. Generally, for obtaining high fruit yield and its quality of pepper grown under salinity stress conditions up to 35 mM NaCl soil salinity, it could be recommended to spray plants with acetylsalicylic acid at 0.5 mM. Key words: pepper, yield, salinity, acetylsalicylic acid, ASA

68

NOTE

Plant isomiR Atlas: Large scale detection, profiling and target repertoire of isomiRs in plants Kun Yang1, Xiaopeng Wen1 (1Guizhou University)

Abstract: microRNAs (miRNAs) play an important role as key regulators controlling the post-transcriptional events in plants across development, stress such as abiotic and biotic, tissue polarity and also in defining the evolutionary basis of origin of the post-transcriptional machinery. Exploring information of small RNAs with the availability of next generation sequencing approaches has widely revealed the role of miRNAs and their temporal regulation. Although the role and functional diversity of canonical miRNAs have been widely addressed, role and function of miRNA sequence variants (isomiRs) have not yet been addressed. This relative lack might be attributed to the large-scale detection of isomiRs across wide plant species hasn’t been done. In the present research, we addressed this by developing Plant isomiR Atlas, which provides large-scale detection of isomiRs across 23 plant species utilizing 677 smallRNAs datasets and reveals a total of 98,374 templated and non-templated isomiRs from 6,167 precursors. Plant isomiR Atlas provides several visualization features such as species specific isomiRs, isomiRs and canonical miRNAs overlap, terminal modification classifications, target identification using psRNATarget and TargetFinder and also canonical miRNAs:target interactions. Plant isomiR Atlas will play a key role in understanding the regulatory nature of miRNAome and will accelerate to understand the functional role of isomiRs. Plant isomiR Atlas is available at www.mcr.org.in/isomir. Keywords: isomiRs, microRNAs, plants, post-transcriptional machinery, functional targets.

69

NOTE

Organic and Inorganic fertilizers Affects on Growth, Yield, and Fruit quality of Cucumber grown in Soilless Culture Basheer Noman Sallam 1, Jiang Weijie 1, Hongjun Yu 1, Adel Fahmi Ahmed 2 1

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences

(CAAS), 2 Medicinal and Aromatic plants Res., Dept., Horticulture Research Institute Abstract: Cucumber (Cucumis sativus L.)is widely spread throughout the world and has been cultivated in protected homes. In recent years many inorganic fertilizers are used in vegetable production, which has a negative impact on health and the environment.The organic fertilizers have been used for cultivation in agriculture field especially soilless culture to reduce these risks. The experiment was carried out in the greenhouse, Soilless Culture Department, Vegetables and Flowers Institute, Chinese Academy of Agricultural Sciences, Beijing. This study was conducted to evaluate the effects of organic manure to inorganic fertilizer ratios on growth, production, and fruit quality of cucumber. Four fertilizer treatments were used; 60 kg/m3 organic (T1control), 30 kg/m3 organic+3 kg/m3 inorganic(T2),30 kg/m3 organic+5kg/m3 inorganic(T3) and 30 kg/m3 organic+7 kg/m3 inorganic(T4). NPK15:15:15 and poultry manure were used as inorganic and organic fertilizers, respectively. The results of this study showed that the treatments of inorganic fertilizers combined with organic has showed a positive effect on vegetative growth, fruit and physiological parameters. In addition high concentration of nutrients in leaves and stems were observed. According to the results of this study we concluded that using combined of organic and inorganic fertilizers better than organic fertilizer alone for improving all cucumber parameters. Supplying plant with 30 kg/m3 poultry manure/ substrate+3 kg/ m3 (NPK 15:15:15) can be improve cucumber parameters under investigation conditions. Key words: cucumber, combined, manure, inorganic, fertilizers

70

NOTE

Genome-wide identification of the Aux/IAA gene family in apple（Malus×domestica Borkh.）and functional analysis of MdIAA18 Yuandi Zhu1, Limin Wang1, Ke Xu1 1

China Agricultural University

Abstract: The Aux/IAA (auxin/indole-3-acetic acid) gene family is one of early auxin responsive gene families, which play a central role in auxin signal transduction. However, there are limited reports of Aux/IAA genes in fruit trees, especially in apple (Malus×domestica Borkh.). In this study, systematic analysis of the Aux/IAA genes in apple was conducted by bioinformatics-based approaches. A total of 33 apple Aux/IAA members were identified (designated from MdIAA1 to MdIAA33), of which 27 members contained four conserved domains whereas the others lost one or two conserved domains. Several cis-elements in promoters of MdIAAs were predicted responsive to hormones and abiotic stress. Tissue-specific expression patterns of MdIAAs in apple were investigated by quantitative real-time PCR. A large number of MdIAAs (numbers?) were highly expressed in leaf buds, young leaves, bark tissue, floral buds, unopened flowers, flowers, and young fruit. MdIAAs clustered in one group showed similar expression profiles. Overexpression of MdIAA18 in Arabidopsis resulted in a typical IAA-related phenotype and insensitive to exogenous application of IAA. These results indicate that MdAux/IAA genes may be involved in vegetative and reproductive growth of apple.Taken together, our results provide useful clues as to the function of MdIAAs in apple and serve as a reference for studies of Aux/IAA genes in other plants. Key words: Malus × domestica Borkh.; Aux/IAA; quantitative RT-PCR; gene expression

71

NOTE

PATHOGENIC COMPARISON AND HISTOPATHOLOGY OF CERATOCYSTIS MANGINECANS AND C. FIMBRIATA –CAUSE OF MANGO QUICK WILT DISEASE Abdul Rehman Rehman 1, Ammarah Shabbir 2, Tanvir Ahmad 2, Muhammad Waqar Alam 3, Saira Mehboob 4, Rehan Riaz 5 (1 Department of Plant Pathology University of Agriculture Faisalabad; 2 Department of Plant Pathology; 3 Institute of Agricultural Sciences; 4 Plant Pathology Research Institute; 5 CABI) Abstract: Mango quick wilt (MQW) is a very destructive disease causing heavy losses to all the commercial mango cultivars in Pakistan. Two fungal species Ceratocystis manginecans and C. fimbriata were found associated with symptomatic samples showing dark-brown to black streaks in the woody xylem. To determine the level of virulence of both species, 500-indigenous mango germplasm were selected to explore resistance source from mango growing areas of northern (n:200) and southern (n:300) Punjab-Pakistan. The bud wood was grafted in screen house and inoculated with test pathogens at the age of 2.5 years. The results revealed that 15.02% northern and 10.74% southern Punjab plants remained healthy after inoculation with C. manginecans; whereas, 14.30% northern and 10.03% southern Punjab plants remained healthy after inoculation with C. fimbriata. It was concluded that Chaunsa SB showed resistance/tolerant reaction against MQW disease. Histopathology of artificially inoculated plants showed upward/downward movement of pathogen along with gummosis-tylosis-wood discolouration. Key words: Mangeifera indica, Ceratocystis manginecanes, Ceratocystis fimbriata,Chaunsa SB, Histopathology, Quick wilt disease

72

NOTE

The pathway and mechanism of phloem unloading for photoassimilate in several fruit species Lingyun Zhang 1 (1 Beijing Forestry University) Abstract: The pathway and mechanism of phloem unloading for photoassimilate in several fruit species Lingyun Zhang*, Peixian Nie, Xiaoyi Wang, Yanfang Li Key Laboratory of Forest Silviculture and Conservation of the Ministry of Education, Beijing Forestry University, Beijing 100083, P.R.China *Correspondence: [email protected] Phloem unloading plays a pivotal part in photoassimilate transport and partitioning into sink organs. However, it remains unclear whether the unloading pathway alters to adapt to developmental transitions in sinks. In recent years, using a combination of electron microscopy, transport of the phloem-mobile symplasmic tracer carboxyfluorescein，the green fluorescent protein-tagged viral movement protein and assays of invertase, the cellular pathway and mechanism of phloem unloading was investigated in several fruit species such as apple, grape, blueberry, Chinese jujube, walnut, and Camellia oleifera fruit, etc. We observed that the transition of phloem unloading pathway in some species, while in other species in which phloem unloading pathway remain unchanged at different growth stages of fruits. Among them, apple and blueberry adopt an apoplasmic phloem unloading pathway during the whole fruit development. Nevertheless, the transition occurred in grape, Chinese jujube, walnut and oil-tea fruit during the growth season. For grape berry, a shift of phloem unloading from symplasmic to apoplasmic pathway occurred in developmental onset of ripening. The predominance of the apoplasmic phloem-unloading pathway in Chinese jujube is interrupted by a symplasmic pathway during fruit development; On the contrary, the predominance of the symplasmic phloem-unloading pathway during oil-tea fruit development is interrupted by an apoplasmic pathway. Also, phloem unloading pathway changes at different part of fruit, symplasmic in the seed pericarp and apoplasmic in the fleshy pericarp in developing walnut fruit. These results suggest the diversity and complexity of phloem transport mechanism and sugar accumulation in different fruit species. Related references: Zhang LY, Peng YB, Pelleschi ST, Fan Y, Lu YF, Lu YM, Gao XP, Shen YY, Delrot S, Zhang DP. Evidence for apoplasmic phloem unloading in developing apple fruit. Plant Physiology, 2004, 135: 574-586 Nie PX, Wang XY, Hu LP, Zhang HY, Zhang JX， Zhang ZX, Zhang LY *. The predominance of apoplasmic phloem unloading pathway is interrupted by a symplasmic pathway during Chinese jujube fruit development. Plant and Cell Physiology, 2010, 51(6): 1007–1018 Wang XY, You HL, Zhang LY *. The cellular pathway and enzymatic activity for phloem unloading transition in developing Camellia oleifera Abel. Fruit. Acta Physiologiae Plantarum, 2018,40：23. Wu GL#, Zhang XY#, Zhang LY#, Pan QH, Shen YY, Zhang DP. Phloem unloading in developing walnut fruit is symplasmic in the seed pericarp and apoplasmic in the fleshy pericarp. Plant and Cell Physiology, 2004, 45 ((10): 1461-1470 Zhang LY，Peng CC,

73

NOTE

Zou KQ, et al. A monosaccharide transporter is localized to sieve plate and plasmodesmal channel in developing apple fruit. Chinese Science Bulletin 2005, 50(4): 344-347 Fan RC, Peng CC, Xu YH, Wang XF, Li Y, Shang Y, Du SY, Zhao R, Zhang XY, Zhang LY, Zhang DP. Apple sucrose transporter SUT1 and sorbitol transporter SOT6 interact with cytochrome b5 to regulate their affinity for substrate sugars. Plant Physiol. 2009, 150: 1880-1901 Hu LP, Sun H, Li R, Zhang LY, Wang S, Sui X, Zhang ZX. Phloem unloading follows an extensive apoplasmic pathway in cucumber (Cucumis sativus L.) fruit from anthesis to marketable maturing stage. Plant Cell Environ, 2011, 34: 1835-1848. Li Y, Li LL, Fan RC, Peng CC, Sun HL, Zhu SY, Wang XF, Zhang LY*, Zhang DP. Arabidopsis sucrose transporter SUT4 interacts with cytochrome b5-2 to regulate seed germination in response to sucrose and Glucose. Molecular Plant, 2012, 5(5):1029-1041 Key words: phloem unloading, photoassimilate transport, fruit, sugar transporter

74

NOTE

Regulatory network analysis reveals regulators of root architecture in apple rootstock Liu Lin1, Wang Yu-ying1, Zhang Shi-zhong1, Shu Huai-rui1, Yu Zi-peng, Xu Yang1

(1Shandong Agriculture University) Abstract: Lin Liu1, Yu Zi-Peng1, Xu Yang1, Yu-ying Wang1, Shi-zhong Zhang1, Shu Huairui1# Institution: 1State Key Laboratory of Crop Biology, Shandong Agricultural University, Taian, Shandong 271018, P.R. China. Employing ortholog identification, an apple protein-protein interaction (PPI) network was constructed in this study. 30, 792 PPIs of 7,537 apple proteins were obtained after deduplication. Then we found 244 proteins were associated with growth and development of primary roots, and constructed a sub-network. Interactions of auxin, ethylene, abscisic acid, cytokinin and jasmonic acid relevant proteins were found from the apple PPIs network. Results showed that auxin response genes played an indispensable role in the network, suggesting its important roles in growth and development of root in apple. In addition, we calculated the expression difference of the two IAA/AUX (MDP0000303142, MDP0000213864) and TIR1 (MDP0000498419) genes in apple seeds under auxin, abscisic acid, salicylic acid, methyl jasmonate, drought, salt, heat and cold stress. Considering the results above, we verified the interactions of seven IAA associated proteins (MDP0000303142, MDP0000213864, MDP0000498419, MDP0000270789, MDP0000296324, MDP0000124810, MDP0000143749) in the predicted network using yeast two-hybrid, and overexpression two MdIAA/AUX genes and an MdTIR1 gene in Arabidopsis, which showed a phenotype of reduced primary root elongation and increased lateral root number. Similarity, apple seedlings displayed same conditions after transgenic with Agrobacterium rhizogenes. This study provided valuable resources for protein functions of apple, and verified the interactions of seven auxin relevant proteins and function of predicted genes, IAA/AUX and TIR1, in apple. Key words: apple, protein interaction, network, root, auxin

75

NOTE

Plant Therapy: a Nonpharmacological and Noninvasive Treatment Approach Medically Beneficial to theWellbeing of Hospital Patients Muhammad Ali Khan1, Noor ul Amin2, Muhammad Imtiaz Khan1 (1 Department of Horticulture, Abdul Wali Khan University Mardan Pakistan; 2 Department of Horticulture, Agriculture University Peshawar Pakistan) Abstract: A green atmosphere and interaction with nature (plants and flowers) can considerably improve the human senses and sanity by decreasing the stress associated with anxiety, depression, neurotic impairment, and other psychological symptoms. The current paper reports a therapeutic horticultural study’s findings regarding the effect of indoor foliage plants and flower arrangements on health prospects of surgical patients. Two surgical wards, ward A (with foliage plants and arranged flowers) and ward B (without foliage plants and flowers), were selected for the study. A total of 270 patients were randomly assigned to either ward to give 135 patients in each. Patients admitted to ward A had significantly more optimistic and promising health improvements than those in ward B. Provision of foliage plants and flower arrangements to the patients in ward A resulted in shorter postoperative stays, lower intake of analgesics, lower pain intensity, less stress fatigue, and improved vital signs (blood pressure, heart rate, respiration rate, body temperature) as compared to patients in ward B. Moreover, analyses showed that patients in ward A had a stronger psychological frame of mind regarding their recovery from surgery and had more positive emotions and feelings regarding their stay in the hospital. They also felt that the ward atmosphere was more calming, pleasant, and satisfactory. Additionally, small group discussions and focal interviews with ward doctors and nurses confirmed the findings of the questionnaire that foliage plants & flower arrangements create a cherished environment in the ward, reduce patients’ stress, improve medical and psychological status of patients, and also convey positive messages of the hospital. These findings confirm the therapeutic value of horticultural activities, particularly in surgical patients in a stressed hospital setting. Key words: Horticultural therapy · Patients health · Vital signs · Pain analgesics · Hospitalization days

76

NOTE

Genetic diversity and rapid detection of pear viruses Nam-Yeon Kim1, Hyo-Jeong Lee1, Rae-Dong Jeong1 1Chonnam

National University

Abstract: Field surveys to investigate the incidence and occurrence pattern of viruses in pear leaves and fruits were conducted during 2017 in Korea. In total, 158 pear leaf and 35 pear fruit samples that showed disease symptoms were collected during June to September from farmers’ fields in five major pear producing areas in Korea (Sangju, Namyangju, Ulsan, Cheonan, and Naju). Multiplex reverse transcription-polymerase chain reaction (Multiplex RT-PCR) was used to test the samples for the presence of one or more of the following viruses: apple stem pitting virus (ASPV), apple stem grooving virus (ASGV), and apple chlorotic leaf spot virus (ACLSV). Disease incidence was 95.6% in 2017, and ASGV was detected in almost all samples cross the different regions studied. The percentage of virus incidence in the collected leaf samples was as follows: ASGV, 95.6%; ASPV, 34.2%; and ACLSV, 19.0%, while that in fruits samples was as follows: ASGV, 100%; ASPV, 31.4%; and ACLSV; 0%. In addition, the percentage of virus incidence in the collected regions was as follows: Sangju, 92.5%; Namyangju, 100%; Ulsan, 93.3%; Cheonan, 94.1%; and Naju, 100%. Furthermore, we investigated the degree of infection of the three viruses in commercial nursery trees of pear cultivars such as ‘Shinwha’, ‘Niitaka’, ‘Whasan’, ‘Chuwhang’, and ‘Manpung’. The ACLSV, ASGV, and ASPV infection rate in the scion of pear cultivars was 10%, 56%, and 25%, respectively. Furthermore, development of rapid and sensitive diagnostic methods to verify that the planting material is virus-free is of paramount importance to control the spread of pear viruses. A novel reverse transcription recombinase polymerase amplification (RT-RPA)-based method was developed for rapid detection of ASGV and ASPV. Sensitivity analysis showed that the detection limit of RT-RPA in ASPV-infected sample was 150 pg/µl of RNA, while in ASGV-infected sample, it was at least 470 pg/µl of RNA. The major improvement in the assay is the reduction in the reaction time for the target viruses is to as little as 1 min and the assay can be easily performed both in the laboratory and in the field. This assay is a promising alternative method for pear breeding programs or virus-free certification laboratories. Keywords: Detection, Incidence, Pear viruses

77

NOTE

Enhanced in vitro regeneration of rose (Rosa indica L.) cv. American Beauty Shahid Iqbal 1, Babar khan 1 1

Nanjing agricultural University

Abstract: In vitro regeneration of rose (Rosa indica L.) is a quick and efficient approach for multiplication to acquire desired traits and vigorous disease-free plants. Nodal sections used as ex-plant and cultured on MS (Murashige and Skoog) medium supplemented with different combination and concentration of BAP, KI, Zeatin and 3% sucrose. Twenty-one days of the nodal section, maximum shoot induction recorded on MS+2.0 mg/l BAP+0.5 mg/l Zeatin. Multiple shoot induction (6-7 shoot per plant) also recorded when these plantlets were sub-cultured on the same medium. For rooting, healthy shoots were excised and cultured on half strength (½) MS medium supplemented with 1.5 mg/l IBA and 1.0 mg/l IAA. Rooting starts after twenty days of transferring to medium while the frequency of rooting was 4-5 roots per plant. Then regenerated young plantlets were successfully acclimatized to the green-house for further growth and experiments. Keywords: Rose, regeneration, rooting, acclimatization

78

NOTE

IPT5b promoter variation alters cytokinin level in apple rootstocks Yi Feng1, Yi Wang1, Zhenhai Han 1 (1 College of Horticulture, China Agricultural University) Abstract: Plants experiencing salt-induced stress often reduce cytokinin levels during the early phases of stress-response. Interestingly, we found that the cytokinin content in the apple rootstock ‘robusta’ was maintained at a high level under salt stress. Through screening genes involved in cytokinin biosynthesis and catabolism, we found that the high expression levels of IPT5b robusta roots were involved in maintaining the high cytokinin content. We identified a 42bp deletion in the promoter region of IPT5b, which elevated IPT5b expression levels, and this deletion was linked to salt tolerance in robusta×M.9 segregating population. The 42bp deletion removed an ACT-box binding site, and our results suggest that ACT-box negatively regulates IPT5b expression in response to proline. Under salt stress, the robusta cultivar maintains high cytokinin levels as IPT5b expression cannot be inhibited by proline due to the deletion of the ACT-box, leading to improved salt tolerance. Key words: salinity; genetic variation; apple rootstock; cytokinin; isopentenyl transferase

79

NOTE

Increasing watermelon nutrient efficiency by grafting onto nonself rootstocks Yuan Huang 1 (1 Huazhong Agricultural University) Abstract: Grafting is a widely used technique in fruit bearing vegetables. The main purpose of grafting is to control soil- borne diseases and increase plant tolerance to a range of abiotic stresses, including salinity, low temperature, and drought. Watermelon is an important vegetable, and about 40% watermelon plants are grafted in China. Our study showed that nonself rootstocks grafting can significantly increase watermelon nutrient efficiency, including nitrogen, potassium, magnesium and boron, the physiological mechanism will be discussed in my presentation. Key words: Watermelon, grafting, nutrient efficiency, physiological mechanism

80

NOTE

Antagonistic activity of chitinolytic bacteria of various taxonomic groups against Colletotrichum gleosporioides, a pathogen of horticultural significance Muhammad Anees1, Kim Kil Yong 2 (1 Kohat University of Science & Technology, Kohat; 2 Institute of Environmentally Friendly Agriculture, Chonnam National University)

Abstract: The present study was based on assessment of antagonistic activity of chitinolytic bacterial strains belonging to various taxonomic groups against different C. gleosporoides strains. The pathogenicity of the different fungal strains was demonstrated by using pepper fruit inoculation assays. The chitinolytic bacterial strains Paenibacillus elgii HOA73, Lysobacter capsici HS124, Streptomyces griceous, Pseudomonas fluorescens, and Paenibacillus ehimensis MA2012 were evaluated for antagonistic activities against the phytopathgenic fungal strains. The bacteria significantly inhibited C. gleosporioides strain 40003, the inhibition ranging from 17-37%. Similarly, 5-41% inhibition of C. gleosporioides 40896 was noticed. Moreover, C. gleosporioides 40965 and 42113 were also inhibited. The n-butanol extracted crude compound from the culture filtrate of P. ehimensis MA2012 completely inhibited the spore germination of C. gleosporioides as compared to the non treated control. It was demonstrated that the chitinolytic strains of bacteria belonging to different groups inhibited growth of C. gleosporioides pathogenic towards pepper and their conidial germination. The chitinolysis may be considered as an important trait for screening the putative biocontrol strains of bacteria against the plant pathogens causing anthracnose. An antifungal compound produced by P. ehimensis MA2012 was also isolated and purified. Key words: Pepper disease; Antifungal; Antagonistic; Paenibacillus; Chitinolytic

81

NOTE

Molecular cloning and expression analysis of the FcSEP1 Gene in Rongan kumquat Ling Su1, Bin Li1, Ying Hu1, Cong Luo1, Zaiyun Ynag1, Peisi Luo1, Xinhua He 1 1

College of Agriculture, Guangxi University.

Abstract: Flower is the main reproductive organ of higher plants, and it is of great significance to the reproduction of higher plants. It was found that SEP genes were mainly involved in the regulation of flower and fruit development in higher plants. The FcSEP1 gene is an important gene in the SEPALLATAT (SEP )gene family of Rongan kumquat, and its distinctive flowering characteristics are different from those of other citrus fruit trees, and its molecular mechanism of floral formation is not yet clear. In order to explore the function of the FcSEP1 gene, FcSEP1 gene was cloned from Rongan kumquat by homologous gene cloning method. The bioinformatics analysis indicated that FcSEP1gene contained 750bp open reading frame and encoded 250 amino acids, with molecular weight 28.41558kDa. Homology alignment and phylogenetic tree analysis showed that the protein had high homology with SEP proteins of other plants, which there is the highest homology with Actinidia, Lotus and Cherimoya, and was different from the Clementine and Citrus. The qRT-PCR analysis showed that FcSEP1 was mainly expressed in flower organs and young fruits, and the expression of FcSEP1 in floral organs was the highest in early stage. With the passage of time, the expression of FcSEP1 was higher in young fruits with diameter of 0.4cm, and slowly expressed in young fruits with diameter of 0.6cm、0.8cm、1.0 cm. There was a little expression in the stem, but almost no expression in the young leaf or the old leaf. In addition, the yeast two-hybrid interaction experiment showed that a protein interacting with FcSEP1 protein was an alcohol dehydrogenase(ADH1) in Kumquat. This study preliminarily verified the function of FcSEP1 gene, and laid a foundation for exploring the molecular mechanism of flower formation involved in FcSEP1 gene of Kumquat. ▲This research was supported by the National Natural Science Foundation of China (31460508) and the Innovation Team of the Guangxi Citrus Industry Project. Keywords: Rongan kumquat; FcSEP1; Gene cloning; Expression analysis

82

NOTE

Insecticidal principles from cassava, Manihot esculenta (Crantz): the promising molecules against major pests of horticultural crops JAYAPRAKAS C.A. (ICAR Central Tuber Crops Research Institute) Abstract: Indiscriminate use of synthetic pesticide to ensure plentiful production and productivity of agricultural commodities has culminated in diversified negative connotations. Development of insecticide resistance, resurgence of secondary pests and contamination of pesticides in agro-products are some of the proven and visible fallout due to the unwise use of synthetic pesticides. Phytochemicals have long been touted as alternatives to synthetic chemicals in integrated pest management strategies. The search for natural products with biological activities is continuing across the globe to save environment from the pollution by synthetic insecticides. Cassava, Manihot esculenta (Crantz) is a significant root crop, and its tubers serve as staple or subsidiary food for over 800 million people in the tropical and subtropical countries. Leaf of cassava is a storehouse of protein and many vital nutrients; despite, commercially it is less exploited due to the coexistence of cyanoglucosides. We have isolated the insecticidal molecules from cassava biowaste and commercially formulated in to three bioformulation viz. Nanma, Menma and Shreya against sucking and borer insect pests of major horticultural crops. Mealybugs are kept under strict vigil at foreign trades due to their widespread damage on most economically important food crops and ornamental plants. Rhizoecus amorphophalli is a very noxious pest severely infesting on the stored tubers of yams and aroids; the infested tubers are unfit for using as seed materials. Mealy substance protects the pest from the penetration of insecticides. In order to formulate a befitting biopesticide against mealybug, the ultra structure and chemical nature of mealy substance were studied. Mealy substance collected from R. amorphophalli was subjected to solubility test using solvents of various polarities, and was chemically characterised by TLC, column chromatography, HPLC, IR and NMR studies. Its ultrastructure was studied by SEM. Subsequently a commercial formulation christened Shreya was developed with the combination of neem oil and the insecticidal principles isolated from cassava biowaste, against the mealybugs, including papaya mealybug, Paracoccus marginatus William of important horticultural crops. A biofumigant was also isolated from cassava leaves to manage the pests of stored tubers of yams and aroids. Efficacy of the bioformulations against mealybug was compared with the locally available chemical insecticides. The bioactive principles isolated from cassava leaves and tuber rinds was formulated as commercial products under the name Menma and Nanma to treat against the major pests of banana viz. Odoiporus longicollis Olivier (banana pseudostem borer) and Cosmopolites sordidus (Germar) (rhizome weevil). We designed a Pilot Plant for the commercial level extraction of bioactive principles from cassava and the machineries have been commissioned at our laboratory. Key words: cassava, biopesticides, mealybugs, characterization pseudostem weevil

83

NOTE

The regulatory relationship between lncRNAs and reactive oxygen species during tomato resistance to Phytophthora infestans Jun Cui 1, Ning Jiang 1, Jun Meng 1, Yushi luan 1 (1 School of Life Science and Biotechnology,Dalian Uinversity of Technology) Abstract: Tomato is a major crop plant constituting a major worldwide agricultural industry. Tomato late blight (LB) is one of the most devastating diseases of field-grown tomatoes by the oomycetes pathogen Phytophthora infestans. The tomato LB, which has a worldwide distribution, causes serious economic loss for field-grown tomatoes, and therefore is regarded as a major threat to tomato production. During tomato resistance to P. infestans, low levels of reactive oxygen species (ROS) that produced by tomato plants can act as signaling molecules in response to pathogen infection, but late massive ROS generation is toxic to the cell and may lead to peroxidation of lipids, damage to cellular membranes, disease susceptibility and ultimately cell death. So, explicating the regulation mechanism of ROS was crucial to tomato resistance to P. infestans. In this study, a number of tomato resistant lncRNAs were identified by comparative transcriptome analysis. Of these lncRNAs, we found that lncRNA16397 acted as an antisense transcript of GLUTAREDOXIN 22 (SlGRX22) to regulate its expression, and also induced SlGRX21 expression when lncRNA16397 was overexpressed. In addition, disease symptoms and ROS accumulation in tomatoes overexpressing lncRNA16397 and SpGRX (SlGRX21) were fewer and lower than those in WT after P. infestans infection. This result suggests that tomato lncRNA16397 induces SlGRX expression to reduce ROS accumulation and alleviate cell membrane injury, resulting in enhanced resistance to P. infestans. In addition, another lncRNA, lncRNA33732 was overexpressed in tomato, resulting in an increased expression of the RESPIRATORY BURST OXIDASE (SlRBOH). Less serious disease symptoms and more H2O2 accumulation in tomato plants that overexpressed lncRNA33732 were displayed after P. infestans infection, compared with the tomato plants that overexpressed empty vector. While, the resistance and H2O2 accumulation were impaired and decreased after SlRBOH silencing in tomato plants. These findings suggested that lncRNA33732 induced the SlRBOH expression to increase the H2O2 accumulation in the early defense reaction of tomato to P. infestans attack, resulting in enhanced resistance to P. infestans. Our results provide insight into lncRNAs involved in the response of tomato to P. infestans infection, demonstrate that the lncRNAs-ROS network is an important component of the P. infestans network in tomato and provide candidates for breeding to enhance biotic stress-resistance in tomato. This work is supported by grants from the National Natural Science Foundation of China (Nos. 31471880 and 61472061). Key words: Marker assisted breeding; germplasm collection; large-scale genotyping; high-density SNP array

84

NOTE

Transcriptome analysis of sweet cherry (Prunus avium) fruit abscission in low chilling regions QIU Zhi lang, YANG Kun, WEN Zhuang, WEN Xiao peng (Guizhou University) Abstract: Sweet cherry (Prunus avium), a member of Rosa family (Rosaceae), has important economic value because of its bright appearance and delicious taste. However, excessive fruit abscission is a big nut for orchardists and causes great damage to its industry since fruit-setting is crucial for its yield. To understand the molecular mechanism underlying fruit abscission in sweet cherry, we profiled genes of the abscission fruit using Illumina technology. By de novo assembly, 168,330 unigenes representing 221,403 assembled unique transcripts were obtained from three fruit drop peak stages. In differentially expressed gene（DEG） analyses, a total of 11,820DEGs were found in the first stage (Fruit diameter=0.52-0.68 cm), however, only 653 and 104 DEGs were uncovered from the second stage (Fruit diameter=1.25-1.60 cm) and third stage (Fruit diameter=1.95-2.20cm), respectively. Further analyses focused on genes involved in phytohormonal regulation, plant-pathogen interaction, starch and sucrose metabolism, calcium signaling, cell wall functioning and metabolic pathways. Our results indicated that many genes were involved in signaling pathways such as auxins, cytokinins, gibberellins, abscisic acid, ethylene, jasmonic acid, and salicylic acid etc. In addition, DEGs were enriched in carbohydrate and amino acid metabolism. It was noteworthy that the MADS-box family transcription factor, which plays an important role in organ shedding, was also enriched and there was a significant differences in expression between normal fruit and shedding fruit. To validate the DEG analysis, expression of interested genes was quantified by qRT-PCR. The available evidences predicted fruit abscission associated genes in sweet cherry. The output of this work provided a valuable data for further genetic and genomic studies so as to full elucidation of the sweet cherry fruit abscission puzzle at the molecular level. Keywords: sweet cherry, transcriptome, organ abscission, fruit drop

85

NOTE

Physical and morphological attributes of Okra against the heat stress Sumeera Asghar 1, Muhmmad Rahid Shaheen1 (1 University Of Agriculture Faisalabad) Abstract: Okra (Abelmoscus esculentum L.) is an important summer vegetable of family Malvaceae. As temperature of the world is rising day by day due to climate change, the physiological behavior of crops is also changing and tolerance against heat is getting minimize. For this purpose, a research trial was conducted to screen different okra genotypes against high temperature (45/35°C day/night).Plants were grown in growth room at (28/22 °C day/night) temperature for four weeks. After four week temperature was gradually increased by 2°C to avoid sudden osmotic shock until the desired high temperature (45/35°C day/night) was achieved and genotypes were kept at this temperature for one week. Finding of this research showed wilting of seedlings, reduced leaves size, induced senescence and change of colour from green to yellow, black drastic decrease in fresh and dry matter contents reason can be the high transpiration rate disturbance or injuries in the physiological processes occurring within cell showed that OH-152, OH-713 and OH-139 were most tolerant genotypes in contrast Garnier and Green gold were found to be sensitive and Tokita was the most sensitive genotype among allgenotypes. Their search findings conclude that heat stress had a significant effect on the physiological, morphological and biochemical mechanisms of Okra genotypes. Key word: Heat stress,Okra

86

NOTE

Protein changes in response to photoperiod during dormancy induction in peach leaves and flower buds Shaoxuan Li 1, Qiuping Tan 1, Mingyue Sun 1, Dongmei Li 1 (1Shandong agricultural university) Abstract: Bud dormancy in deciduous fruit trees is a key feature for the survival of winter chill but is a limiting factor for forcing cultivation in the greenhouse. Photoperiod is an important signal in dormancy induction; the quality and quantity of many genes and proteins can change and undergo a transition from active growth to dormancy. The aim of this work was to provide new insights into these changes during the early stage of dormancy. We analyzed protein changes in response to photoperiod during dormancy induction in peach (Prunus persica cv. Chunjie) leaves and flower buds. The results showed that short photoperiod could get the buds into dormant-induction period under non-low temperature conditions. However, the dormancy induction factor for long photoperiod treatment was the decreasing of the temperature. Sixty-five differentially expressed proteins were revealed, 42 of which were identified. The critical expression period of the differentially expressed proteins was mid-September in the leaves and mid-October or slightly earlier in the flower buds. Compared with that of the other identified proteins, the expression of proteins associated with stimulus responses and stress defense was higher and occurred earlier in short-photoperiod dormancy induction, whereas the expression of proteins associated with photosynthesis and growth was lower. This study is the first to identify the name, expression pattern, functional category, and biological function of various proteins in peach leaves and flower buds during photoperiod dormancy induction Key words: Dormancy induction, Temperature, Photoperiod, Peach

87

NOTE

Strategies to Improve Vanadium Stress Tolerance of Watermelon Muhammad Azher Nawaz1, Fareeha Shireen1, Chen Chen1, Zuhua Zheng1, Hamza Sohail1, Waqar Ahmed2, Yuan Huang1, Zhilong Bie1 （1College of Horticulture and Forestry Sciences, Huazhong Agricultural University, Wuhan, China; 2 Cultivating New Frontiers in Agriculture (CNFA)） Abstract: Strategies such as use of soil amendments, growth promoting microbes, plant growth regulators and biostimulators are utilized to minimize the adverse effect of heavy metals on plants. Vanadium (V) is a transition metal with ubiquitous presence in the Earth’s crust. V adversely affects plant growth and development, however, limited information is available as to its effect on plants and management strategies. Considering this, we utilized grafting and melatonin to improve the V stress tolerance of watermelon and investigated the mechanism involved. V application (50 mg/L) substantially reduced the growth of watermelon, however, grafting watermelon onto bottle gourd and pumpkin rootstock improved the V stress tolerance of watermelon by reducing the V concentration in the leaf tissues, improving the relative chlorophyll content (SPAD index) and photosynthetic assimilation, up-regulating the expression of SOD (Cla008698, Cla0012125, Cla009820 and Cla001158), glutathione S-transferase (Cla013224) and glutathione peroxidase (Cla021039) genes in the leaves, and enhancing the activities of antioxidant enzymes (SOD, CAT). The scanning electron microscopy (SEM) of root tips showed minimal damage for pumpkin roots compared with watermelon and bottle gourd roots under V stress conditions. Results regarding melatonin-pretreatment (0.1 µM) of watermelon seedlings exposed to V stress (50 mg/L) showed that melatonin-pretreated seedlings have higher relative chlorophyll content (SPAD index), photosynthetic assimilation, and plant growth compared with non-treated seedlings. Melatonin-pretreatment reduced V concentration in the leaf and stem and improved antioxidant system of watermelon seedlings. Considering the result of this study, grafting and melatonin can be utilized to improve plant growth and V stress tolerance of watermelon. Key words: Abiotic stress, Heavy metals, Antioxidants, Grafting, Melatonin

88

NOTE

Increasing salt tolerance of cucumber by grafting onto pumpkin rootstock ZHILONG BIE (Huazhong Agricultural University) Abstract: Cucumber (Cucumis sativus L.) is one of the most popular vegetables under protected cultivation conditions, and it is sensitive to salt stress. Previous research work of our group has demonstrated that grafting with rootstocks, such as pumpkins and bottle gourds, could be a valid strategy in increasing the salt tolerance of cucumber. The increased tolerance to salinity of grafted-cucumber based on three main reasons: limited Na+ transport to shoot, activated antioxidant enzymes and stabilized photosynthetic system. Among these reasons, the higher ability of controlling Na+ transport from root of rootstock to the shoot of scion is the most important one. The roots cortex of pumpkin rootstock had a higher ability to restrict the transport of Na+ to stele and the loading of Na+ in the xylem. Using the X-ray microanalysis, the ions distribution patterns were studied between pumpkin and cucumber in various positions, compared with cucumber, the pumpkin plants accumulated Na+ mainly in the roots, and maintained a higher level of K+ and Ca2+ in the shoots. In addition, the higher vacuolar H+-ATPase (VHA) and vacuolar H+-PPase (VPP) activities of pumpkin grafted plants indicated that the pumpkin root was more efficient in Na+ regionalization in vacuolar. The pumpkin-grafted cucumber plants increase their salt tolerance based on a root-sourced respiratory burst oxidase homologue (RBOH) - dependent H2O2 production, which enhances Na+ exclusion from the root and promotes an early stomatal closure. Using the non-invasive micro-test technique (NMT), the Na+, K+ and H+ flows were investigated between different grafted combinations. Results showed that the decreased leaf Na+ content of pumpkin-grafted plants was achieved by higher Na+ exclusion in roots, which was driven by the Na+/H+ antiporter energized by the plasma membrane H+-ATPase. Key words: Salinity, grafting, cucumber, pumpkin

89

NOTE

Comparison of growth, fruit setting characters and yield of different banana varities Xiao Qu1, Deng Yingyi1, Li Feng1 (1 Guangxi University) Abstract: In order to evaluate the performance of different banana varieties planted in Guangxi, The growth, fruit setting and yield characters of six banana varieties (Guijjiao No. 6, Zhongjiao No. 3, Zhongjiao No. 4, Zhongjiao No. 6, Brazil Banana and Nantianhuang) planted in early September in Longzhou County, Chongzuo City, Guangxi Province were compared. It could provide a theoretical basis for the variety structural adjustment of bananas in Guangxi. The results shows as follows: During the same development period, , the growth of Zhongjiao No. 3 was the most prosperous. The weakest one was Nantianhuang, the medium were Guigui No. 6, Zhongcao No. 4 , Zhongjiao No. 6 and Brazilian banana among these six species. The growing period of Guijiaoo No. 6 and Brazilian bananas were longest, which was 17.8 days longer than that of Zhongjiao No. 3 and Zhongjiao No. 4 with the shortest growing period, and that of Nantianhuang and Zhongjiao No. 4 were medium. The yield of Guijiao No. 6, Zhongjiao No. 3, Zhongjiao No. 4 and Zhongjiao No. 6 ,with no significant difference among them were the highest, the midium was Brazilian bananas’, and the lowest was Nantianhuang . The synthetic fruit traits of Zhongjiao No. 4, Guijiaoo No. 6, Zhongjiao No. 3 and Zhongjiao No. 6 were better than others. Judging from the comprehensive trait performance, Zhongjiao 3, Guijiaoo 6, Zhongcao 4 and Zhongcao 6 performed well, which were suitable for planting in Guangxi and obtained higher yields. Nantianhuang and Brazilian bananas performed poorly. The monthly growth of pseudostem height, pseudostem circumstance, and leaf number of different banana varieties showed significant or extremely significant correlation with the monthly accumulated temperature. In a certain temperature range, high temperature promoted the growth of banana plants, and low temperature suppressed banana plants. Key words: bananas; variety; growth; fruit setting character; yield

90

NOTE

Asteraceae Inflorescence patterning and development Yafei Zhao1, Teng Zhang1, Suvi Broholm1, Anneken Rijpkema1, Sari Tähtiharju1, Katriina Mouhu1, Victor Albert1, Teemu Teeri1, Paula Elomaa1 1

University of Helsinki

Abstract: Angiosperms represent a huge diversity of inflorescence and floral structures. Asteraceae, the largest family of flowering plants, represents with the unique inflorescence architecture (capitulum) that consists of different types of flowers (ray, trans and disc). However, the mechanisms underlying flower type specification and differentiation, and the key genes in defining flower initiation and IM patterning are largely unknown. Here, our studies in Gerbera hybrida show that GhUFO is the master regulator of flower meristem identity that ectopic GhUFO expression confers floral fate to the determinate inflorescence meristem. Such inflorescence determinacy is maintained by the uniform expression of GhLFY. Additionally, GhLFY has developed a novel function for the distinct ontogenetic pattern of ray flower, suggesting the independent evolutionary origins of various floral types from separate branching systems. Meanwhile, floral type specification and differentiation, previously shown to be controlled by CYC2-clade TCP transcription factor (e.g. GhCYC3), are under progressing. We show that CIN-like TCP transcription factor GhCIN1 and SEP-like MADS-box transcription factor GRCD5 effectively bind to GhCYC3 cis-regulatory region in transient luciferase assay during early and late ray flower developmental stages respectively, thus defining the differential expression pattern of GhCYC3 for floral type identity. Altogether, we provide evidences of how modification in spatial-temporal expression pattern of key developmental regulators contribute to the evolutionary success of Asteraceae inflorescence. Key Words: inflorescence, Asteraceae, LEAFY, UFO, TCP, floral type

91

NOTE

Effects of phosphate fertilization methods on growth and nutrient uptake of Blueberry AiBin Wang, LiuYang Zhang, YuXiao Guo, LingYun Zhang (Beijing Forestry University) Abstract: To investigate the effect of phosphate fertilizer application on growth and nutrient uptake of blueberries, two-year old ‘Misty’ blueberry seedlings was taken as test object. By means of completely randomized design, setting up four kinds of fertilization methods (DF), linear fertilization (LF), average fertilization (AF) and exponential fertilization (EF), with no fertilization as the control (CK). Based on principal component analysis, the best phosphate fertilization method were comprehensively evaluated on the basis of the morphological indexes, physiological indexes of leaves and soil physicochemical properties, compared with the control. The results showed that all the fertilization methods could not only enhance the length of blueberry basal branches and the crown remarkably, but also increase soluble sugar content, soluble protein content and chlorophyll content in leaves and the number of basal branches. The total nitrogen, total phosphorus, total potassium, nitrate nitrogen, ammonium nitrogen, available potassium and pH in the soil were lower than that of CK. meanwhile, the available phosphorus and EC were higher than CK. The effects of exponential fertilization on the length of blueberry basal branches, diameter of blueberry basal branches, number of blueberry basal branches, crown, leaf phosphorus content, soluble sugar content, soluble protein content and chlorophyll content were the most obvious. The result indicate that exponential fertilization treatment increased length of blueberry basal branches, diameter of blueberry basal branches, number of blueberry basal branches, and crown significantly, compared those of CK. Meanwhile, the leaf phosphorus content of exponential fertilization is more stable than other treatments. The effects of different phosphate fertilization methods on the growth of blueberry are as follows: EF> AF> DF> LF> CK. In conclusion, each fertilization treatments can promote the growth of blueberry, among which the exponential fertilization is the best. ( Key Laboratory of Forest Silviculture and Conservation of Ministry of Education， Beijing Forestry University Beijing 100083） Key words: blueberry；phosphate fertilizer；principal component analysis；physical and chemical properties of soil

92

NOTE

Morphological and molecular analyses of reciprocal hybrids between Slim Whitman and Pinza, two Narcissus pseudonarcissus cultivars Xi Li, Dongqin Tang, Yimin Shi (Shanghai Jiao Tong University) Abstract:

Narcissus pseudonarcissus, also known as daffodil, is a world-famous

ornamental flower. In this study, for the first time, cross-pollinations between two widely cultivated N. pseudonarcissus varieties ‘Slim Whitman’ and ‘Pinza’ were performed. After eight consecutive years of cultivation, 27 reciprocal hybrids with different genotypes survived，15 hybrids in Slim Whitman× Pinza and 12 in Pinza× Slim Whitman, respectively. Twenty ornamental and agronomic characters were observed to evaluate the pattern and extent of genetic variability of the hybrids and relatedness with their parents. The hybrids showed great variation in most morphological characters compared with the parents, especially in leaf and flower characters. Hybrids SP03, SP04, SP05, SP12, SP13, PS04, PS06, PS07, PS08 and PS11 had evident growth advantage in some aspects compared with both parents. Of these hybrids, SP04 got novel flowers with white petals and a yellow-orange corona, and had the potential to become a new popular N. pseudonarcissus cultivar. Hybrids SP01, SP03, SP05, PS04, PS06 and PS07 also possessed a great ornamental value. By cluster analysis based on morphological traits and RAPD molecular markers, genetic relationships among the reciprocal cross hybrids and their parents were further analyzed. The 27 reciprocal hybrids and their parents grouped into divergent clusters, showing that there was rich genetic variation among the hybrids tested. This study will pave the way for hybridization breeding programs of N. pseudonarcissus. Key words: morphological characters; narcissus (daffodil); RAPD; reciprocal crosses

93

NOTE

Molecular identification and characterization of CONSTANS-like (COL) genes family in mango﹟ Xiujuan Zhang, Xinhua He, Cong Luo, Xinxi Lu, Haixai Yu, Jinwen Chen, Yan Fan (Guangxi University) Abstract: CONSTANS (CO) is a central regulator of photoperiod pathway, which channels inputs from light, daylength, and circadian clock to promote the floral transition in model plants. Mango (Mangifera indica L.) is one of the most economically fruits widely grown in the tropical and subtropical areas around the world. The flowering habit of mango was domesticated day-neutral. Information on the molecular characterization of the CO-like (COL) genes in mango is very limited. In this study, using a global search of the mango transcriptome dates, a total of 31 members of CO-like (COL) genes were identified, and many of them were previously unreported. All these genes were divided into four groups based on the phylogenetic relationship. Some MiCOL members showed high sequence similarity with published COL proteins of Arabidopsis. Tissue-specific expression showed that gene numbers of higher expression in leaves, stems and flowers among the 31 MiCOL genes were seven, eight and four genes respectively. So MiCOL genes may function as tissue-specific regulators in different organs. Flowering development expression showed that ten genes were highly differentially expressed in flowering samples of mango, and illustrated that MiCOL genes may correlation with mango flowering induction. Stress treatments expression showed that five, six and five genes among 31 MiCOL genes revealed significant up-regulated expression under low temperature, drought and high salt conditions, respectively. Therefore MiCOL genes may relate to mango stress response. The discovery of MiCOL genes and the characterization of their expression patterns will provide a basis for future clarification of their functions in mango flower induction and stress response. ﹟This work was supported by National Natural Science Foundation of China (No.31660561), Guangxi Science and Technology Major Project （GXST-AA17204097-3），Guangxi innovation driven project（AA17204026-2）and the Innovation Team of Guangxi mango Industry Project (nycytxgxcxtd-06-02). Keywords: Mango, CONSTANS, Sequence analysis, Expression analysis

94

NOTE

Physiological species identification of Hami melon powdery mildew in spring and autumn of Turpan, Xinjiang yan wang1, liangyou li2, Haiyan Zhang3 1 Turpan Agricultural Technology Extension Center;2 Xinke Horticultural Crop Research Institute of Turpan;3 Turpan Xinke Horticultural Crop Research Institute

Abstract: In order to clarify the types and dominant physiological species of Hami melon powdery mildew in spring and autumn of Turpan city, the pathogenic bacteria were collected in Gaochang, Shanshan and Tuokexun counties during the period from March to October of spring and autumn. In this paper,microscopic examination of spore revealed that the pathogens were Podosphaera xanthii.13 common identification systems of muskmelon powdery mildew were used to identify the host in seedling stage. Two identification methods were used to identify the host of muskmelon by spraying spore suspension and planting in greenhouse. Keywords: Hami melon;Powder mildew;Physiological species; Turpan

95

NOTE

Effect of propionazole on the calyx abscics ratio and quality of the fruit of Korla Fragrant Pear Jianping Bao. (College of Plant Science , Tarim University, Alar Xinjiang 843300, China 2The National and Local Joint Engineering Laboratory of High Efficiency and Superior-Quality Cultivation and Fruit Deep Processing Technology of Characteristic Fruit Trees in South Xinjiang, Tarim University, Alar Xinjiang 843300, China) Abstract: Persistent calyx can negatively affect Korla fragrant pear shape and quality. At present, applying chemical agents is always considered an important effective way to improve abscission calyx fruit, and the truth is that propionazole have indeed bettered off calyx abscising this way. The flowers from five trees each were sprayed at full bloom stage with 0, 100, 300mol/L propionazole. The results showed the calyx abscics ratio, Vc contents, and soluble sugar contents of ‘Korla Fragrant Pear’ which were sprayed 100mol/L propionazole increased by 66.7%, 19.87%, 4.4% and 2.29% compared with 0mol/L, respectively. However, the fruit hardness decreased by 8.12%, and the stone cell contents was the lowest. The overall results showed that the application of 100mol/L in pear tree is the best. This work was supported by Xinjiang Production and Construction Group key S&T Special Projects (2017DB006) Keywords: Pear,propionazole ,calyx abscics ratio,quality

96

NOTE

Strategies to Improve Vanadium Stress Tolerance of Watermelon Muhammad Azher Nawaz, Fareeha Shireen, Chen Chen, Zuhua Zheng, Hamza Sohail, Waqar Ahmed, Yuan Huang, Zhilong Bie (Huazhong Agricultural University) Abstract: Strategies such as use of soil amendments, growth promoting microbes, plant growth regulators and biostimulators are utilized to minimize the adverse effect of heavy metals on plants. Vanadium (V) is a transition metal with ubiquitous presence in the Earth’s crust. V adversely affects plant growth and development, however, limited information is available as to its effect on plants and management strategies. Considering this, we utilized grafting and melatonin to improve the V stress tolerance of watermelon and investigated the mechanism involved. V application (50 mg/L) substantially reduced the growth of watermelon, however, grafting watermelon onto bottle gourd and pumpkin rootstock improved the V stress tolerance of watermelon by reducing the V concentration in the leaf tissues, improving the relative chlorophyll content (SPAD index) and photosynthetic assimilation, up-regulating the expression of SOD (Cla008698, Cla0012125, Cla009820 and Cla001158), glutathione S-transferase (Cla013224) and glutathione peroxidase (Cla021039) genes in the leaves, and enhancing the activities of antioxidant enzymes (SOD, CAT). The scanning electron microscopy (SEM) of root tips showed minimal damage for pumpkin roots compared with watermelon and bottle gourd roots under V stress conditions. Results regarding melatonin-pretreatment (0.1 µM) of watermelon seedlings exposed to V stress (50 mg/L) showed that melatonin-pretreated seedlings have higher relative chlorophyll content (SPAD index), photosynthetic assimilation, and plant growth compared with non-treated seedlings. Melatonin-pretreatment reduced V concentration in the leaf and stem and improved antioxidant system of watermelon seedlings. Considering the result of this study, grafting and melatonin can be utilized to improve plant growth and V stress tolerance of watermelon. Key words: Abiotic stress, Heavy metals, Antioxidants, Grafting, Melatonin

97

Walnut seeding growth characteristics comparison research Yan Song, Rui Zhang, Shan Gao, QiTao Xu (Tarim University) Abstract: The breeding management technology of high quality walnut seedlings is

one of the important links to promote the stable development of walnut industry in China. The careful observation and study of the biological characteristics of seedlings in different periods will help to understand the growth state of the seedlings and the rules of fertilizer requirements. The growth characteristics of walnut seedlings in different sowing dates and different sowing methods were studied in this experiment. By observing the growth pattern of different seeding methods, photosynthetic fluorescence and the change of chlorophyll in the 1 year old seedlings, to analyze the characteristics and differences of the seedling stage of different seeding methods, and the quality of the walnut seedlings of different seeding methods was evaluated in combination with various factors to improve the walnut variety and walnut improvement, which provides theoretical support for the application of rapid propagation technology and seedling management. The results show that the growth of walnut height has an obvious peak period from the late July to the middle of August; but the growth of the diameter is not particularly obvious, and it is in a steady state of growth, the growth time is longer than that of the plant. Sowing date 1 (sowing in April 16th) and ridging seeded walnut seedlings had relatively little difference and grew well, which was suitable for sowing time and seeding methods. With the increase of fertilizer application, the chlorophyll content (SPAD) of walnut leaves will increase. Key words: walnut, growth,chlorophyll,photosynthetic characteristic

98

NOTE

Based on ITS, RBCL sequence and leaf shape of xinjiang almond Study on genetic relationship of germplasm resources Yan Zhou, Jun Yu, Rui Zhang.

(Tarim University) Abstract: A comparative analysis was made on the botany traits of the leaves and fruits of 24 almond species, such as xinjiang ‘paper skin’ and ‘amannisha’. After the total DNA was extracted, PCR amplification was performed on ITS and RBCL sequences respectively, and the sequence was spliced and homologous. MEGA5 software was used to construct phylogenetic trees of different almond species based on ITS and RBCL sequences. By comparison of botanical traits, the leaf length of ‘pointed blade’ was up to 11.51 cm that is 5.63 cm longer than ‘the king of almonds’; ‘Paper skin’ blade width was up to 3.48 cm that was 1.77cm wider than ‘the king of almonds’ ;The longest petioles of Bitter almonds was 1.77cmskin higher than the shortest ‘the king of almonds’ of 3.11cm.;The leaf shape index of ‘Short high-yield almonds’ was 4.12;The yield of ‘yarkand’ was up to 72.9 percent that was the highest in 24 almond species. The yield of ‘stones' was only 31.7 percent. According to the analysis of bioinformatics software, ITS sequence length was 608 to 610 bp, including 42 mutation sites and G+C content is 61.16 percent to 61.90 percent. The sequence length of RBCL was 689 to 707 bp, and its variation site was 23, and G+C content was lower at 43.28 percent to 43.34 percent. Based on the phylogenetic tree of ITS and RBCL sequence showed that the genetic distance of ITS sequence between 0.000 and 0.008, RBCL sequence between between 0.000 and 0.0014.Among them, 23 almonds,such as ‘paper skin’ and ‘amannisha’, have the same genetic background, and ‘yellow double almond’ was unique. The purpose of this study was to explore kinship relation of xinjiang almond germplasm, and to provide a scientific basis for the development, protection and utilization of almond germplasm resources. Key words: ITS, RBCL, leaf shape, xinjiang almond, kinship relation

99

NOTE

Incidence of clubroot in Shanghai and Effect of Exogenous Salicylic Acid on Seedling Growth, Physiological Characteristics and Resistance-Clubroot ( Plasmodiphora brassicae ) in Pakchoi（Brassic campestris ssp. chinensis Makino） Hongfang Zhu1, Xiaofeng Li2, Yuying Zhu2, Zhaohui Zhang3 (1Horticulture Research Institute, Shanghai Academy of Agriculture Sciences. Horticulture Research Institute, Shanghai Academy of Agriculture Sciences. 3Shanghai

2

Academy of Agriculture Sciences.) Abstract: Clubroot, which is caused by the soil-borne obligate biotrophic protist Plasmodiophora brassicae Woron., is the most important root disease of Brassica crops worldwide。In recent years, the incidence of clubroot in the suburbs of Shanghai, China, has increased yearly. Until 2017, 39 counties and 9 towns of Shanghai had been broken out clubroot and the occurrence area had reached 47.12 hm2. The identificational result showed that the clubroot of Qingpu distract in Shanghai was physiological races No.7. SA, as a signal molecule, can induce plants to resist pathogens and produce resistance. We studied the protective effect of exogenous salicylic acid (SA) on the reactions of physiological indicators and inducing clubroot- resistance of pakchoi, with pakchoi pakchoi variety ‘Xinaiqing’, after inoculated clubroot (P. brassicae) by the method of the soil bacteria inoculation. We selected 0.2~0.8 mmol·L-1 exogenous salicylic acid （SA）to treatment the inoculated pakchoi plants, investigated the effects of on growth, clubroot-resistance, reactive oxygen and defense enzyme activity of leaf and root，and discussed the mechanism of SA to induce the clubroot-resistance. The results showed that clubroot inhibited the growth significantly and increased the damage of membrane lipid peroxidation. The best effect on the alleviation of clubroot damage was 0.6mmol·L-1 SA obviously. At this concentration, the growth, clubrootr-resistance, the activity of superoxide dismutase (SOD), peroxidase (POD), ascorbate peroxidase (APX), polyphenol oxidase (PPO), phenylalanine ammonialyase (PAL), glutathione reductase (GR) in leaves and root were increased significantly, while malondialdehyde (MDA), hydrogen peroxide (H2O2) and the production rate of superoxide anion (O2·-) were significantly decreased. The results indicated that dosage effect of SA existed on the alleviation of clubroot in pakchoi plants, and the best alleviating effect on clubroot disease stress damage was 0.6mmol·L-1 SA by irrigating at the plant roots, which was favorable for the plant to grow, and improve the ability of clubroot-resistance. Key words: exogenous salicylic acid, pakchoi; clubroot, growth, ROS, defensive enzymes

100

NOTE

Treatment of H2O2 promoting the berry early ripening of ‘Kyoho’ Zhen-Guang Wang, Yi-He Yu, Guo-Hai Zhang, Da-Long Guo.

(Henan University of Science & Technology) Abstract: Reactive oxygen species (ROS) play an important role in plant development. The different concentrations of H2O2 (0, 100, 300, 500 mmol/L) were sprayed to ‘Kyoho’ berry on 25 days after anthesis. The results showed that all the different concentrations of H2O2 could accelerate the ripening of ‘Kyoho’, and 300 mmol/L was the best which could promote the berry ripening of ‘Kyoho’ 20 days earlier than the control. After the treatment of 300 mmol/L H2O2, the diameter of berry increased significantly, and the content of anthocyanin, soluble solids and sucrose increased significantly with comparison to the control. In addition, some enzyme activities were also increased significantly, such as, SOD activity, NOX activity, cellulase and PG activity. The content of H2O2 increased at the veraison of berry. During this period, the activity of CAT decreased and the rate of superoxide anion production reached the maximum. But the increase of H2O2 did not cause cell damage, in other words H2O2 was involved in berry development as a signaling molecule. In summary, the suitable concentration of exogenous H2O2 could adjust the pathway of ROS related enzymes and promote the grape berry early ripening.

Key words: early ripening, grape, H2O2, ROS

101

NOTE

Melatonin delays leaf senescence of Chinese flowering cabbage through suppressing ABF transcription factors-mediated ABA biosynthesis and chlorophyll degradation Zhong-qi Fan, Xiao-li Tan, Jian-fei Kuang, Wei Shan, Wang-jin Lu, Jian-ye Chen South China Agricultural University

Abstract: Melatonin and abscisic acid (ABA) are known to play opposite roles in regulating leaf senescence. However, the molecular mechanism underlying the direct link between melatonin and ABA involving in leaf senescence remains poorly defined. In this study, we found that exogenous application of melatonin delayed postharvest leaf senescence of Chinese flowering cabbage, with melatonin-treated cabbages maintaining higher level of maximum quantum yield (Fv/Fm) and total chlorophyll content. Melatonin treatment also led to lower expression level of a series of chlorophyll catabolic genes including BrPPH, BrPAO, BrNYC1, BrNOL, BrRCCR, BrSGR1 and BrSGR2. Lower endogenous ABA level and expression of ABA biosynthetic genes BrNCED, BrABA2 and BrAAO3 were also found after melatonin treatment. Significantly, three ABA-responsive element (ABRE)-binding transcription factors BrABF1, BrABF4 and BrABI5 were identified. BrABF1, BrABF4 and BrABI5 localized in nucleus and their expressions were repressed by melatonin. Through electrophoretic mobility shift assay and transactivation analysis, we further revealed that BrABF1, BrABF4 and BrABI5 activated the expression of BrNCED, BrAAO3, BrNYC1, BrNOL, BrPPH, BrPAO, BrRCCR and BrSGR1, by directly binding to their promoters. Moreover, transient over-expression of BrABF1, BrABF4 and BrABI5 in tobacco leaves induced ABA accumulation and promoted chlorophyll degradation via the up-regulation of tobacco ABA biosynthetic and chlorophyll catabolic genes, resulting in the accelerated leaf senescence, whereas these effects were significantly antagonized by melatonin treatment. Our data reveal that BrABF1, BrABF4, and BrABI5 are activators of leaf senescence of Chinese flowering cabbage, and melatonin delays leaf senescence through suppressing ABFs-mediated ABA biosynthesis and chlorophyll degradation. Keywords: Chinese flowering cabbage, leaf senescence, melatonin, ABA, ABF

102

NOTE

Compatibility Interaction of Stenting on Hybrid Tea Rose with Different Rootstock NISAR HUSSAIN1, Adnan Younis2, Faisal Hayat1, Adeel Shahid2, Sumeera Asghar1. (1College of Horticulture, China Agricultural University, Beijing, P.R. China;2Institute of Horticultural Sciences, University of Agriculture, Faisalabad, Pakistan) Abstract: In commercial horticulture particularly in ornamental new techniques are developing for quick and quality production of flowers. In this study we used stenting instead of routinely grafting and examine the compatibility interaction of four scion varieties of hybrid tea rose (Brandy, Almanti, Alec’s red, Motrea) with three different rootstocks (Rosa chinensis, Rosa canina, Rosa multiflora). Successful stenting and healing percentage were higher in R. Chinensis followed by R. canina and R. multiflora respectively. Interaction of Almanti and Motrea on R. canina rootstock led to significantly higher soluble sugars and proteins contents. However in all interaction of R. canina and R. chinesis IAA/ABA ratio were higher that lead deeper and wider root system. Flower diameter and stem length were higher in R. canina and R. multiflora. Whereas, flower quality index were maximum in Almanti and Motrea followed by Brandy and Alec’s red on R. canina and R. chinensis respectively. Conclusively, stenting form best compatibility interaction in R. canina and could be used for in-demand cut flower production. Key words: hybrid tea rose, rootstock, stenting, compatibility, flower quality

103

NOTE

The multi-level regulatory network mediated by citrus AGL6 in quality forming zhenyu He, Tiantian Zhao, Yaoqiang Shi, Meiyan Shi, Juan Xu. Huazhong Agricultural University Abstract: Citrus plants are rich in sugar, acid, also contains flavonoids, carotenoids, aroma compounds and other functional substances. Most of the regulatory network mediated by transcription factors simultaneously involved in these metabolic pathways has not yet been uncovered in citrus. This study explained the effect of AGAMOUS like-6(AGL6) on various metabolisms in citrus and built the model of regulation and degradation AGL6 in citrus. CsAGL6 directly binds to genes involved in primary and second metabolism and several other processes in citrus and regulates the contents change of metabolites. In the further research, CsAGL6 protein directly binds to chaperones (CsCLPB1-4, CsHSP70-2/5), Nucleoside diphosphate kinase(CsNDPK3) , E3-liagse-ubiquitination (CsSlrP) and CLPX1 to affect CsAGL6 proteins. Keywords: citrus; primary metabolism; second metabolism; degraded ; ChIP-seq; RNA-seq ; metabolisms ;CoIP-Mass

104

NOTE

Effect of Selenium on Redox State, Antioxidant Enzymes Activity and Related Gene Expression in leaves of Salt-Stressed Tomato seedlings Ming Diao, Yan Zhou, Jinxia Cui, Wei Xu, Huiying Liu a Department of Horticulture, Agricultural College, Shihezi University, Shihezi, 832003, Xinjiang, P.R. China b Key Laboratory of Special Fruits and Vegetables Cultivation Physiology and Germplasm Resources Utilization of Xinjiang Production and Construction Crops, Shihezi, 832003, Xinjiang, P.R. China

Abstract: In order to understand the tolerance mechanism of Se on tomato under salt stress, two cultivars of tomato ( Solanum lycopersicum ) differing in salt tolerance were used as experimental materials to investigate the effects of exogenous selenium (Na2SeO3 0.05 mM）on lipid peroxidation, H2O2 content, redox state, antioxidant enzyme activity and related gene expressions in leaves of tomato seedlings under NaCl （100 mM）stress. The result showed that application of Se significantly alleviated salt-induced growth inhibition, especially for the sensitive genotype Shuangfeng 87-5 and dramatically suppressed H2O2 and malondialdehyde (MDA) accumulation. Se mediated intracellular GSH and AsA content to keep their level and GSH /GSSH and AsA/DHA ratios over the control especially in the case of salt-induced reducing power reduction. External Se counteracted salt-induced decrease in activities of glutathione peroxidase (GPX) in Grx system and thioredoxin reductase (TrxR) in Trx system and the activities of enzymes related with the ascorbate-glutathione cycle including dehydroascorbate reductase (DHAR), monodehydroascorbate reductase (MDHAR) and glutathione reductase (GR) in both genotypes, and reduced the salt-induced increase in ascorbate peroxidase (APX) activities (except at 24 h for Shuangfeng 87-5) . External Se up-regulated leaf MDHAR (except at 24 h and 120 h), GPX and TrxR in both cultivars, DHAR1 and GR (except at 24 h) mRNA levels in Shuangfeng 87-5 and DHAR1 (except at 120 h) and GR (except at 120 h) mRNA level in Jiahe No. 9 under salt stress. Overall, these results indicated that elevated intracellular reducing power levels and key antioxidant enzyme activity in Trx, Grx systems and ascorbate-glutathione (AsA-GSH) cycle and related gene expressions, when concerning ROS scavenging systems, play an important role in Se increases salinity tolerance of tomato plants and alleviates salt-induced oxidative stress. Key words: Selenium; NaCl stress,Tomato,Redox state,Antioxidant enzymes,Gene expression

105

NOTE

Influence of Seven Dwarfing Interstocks on the‘Fuji’Apple under Drought Stress Xing Liang Li, Jun Ke Zhang, Min Ji Li, Bei Bei Zhou, Qiang Zhang, Qin Ping Wei. (Beijing Academy of Forestry and Pomology Sciences) Abstract: Drought-tolerance evaluation of apple dwarfing interstocks provided valuable information for their application on water-saving cultivation, and main effect factors exploration laid a theoretical basis for better understand of the drought-tolerance mechanism. In present study, the growth and physiological indicators of ‘Fuji’ apple grafted on seven dwarfing interstocks, including M26, M9-T337, GX, CG24, SH1, SH6 and SH40 treated at control, moderate and severe level of drought stress were evaluated. After 50 days of treatments, results showed that the trunk growth rate (TGR) and the shoot growth rate (SGR) of scion grafted on GX, CG24 and M9-T337 were worst restricted, whereas those on SH6 and SH40 exhibited more stable TGR and SGR in all levels of stress treatment. Besides, higher net photosynthetic rate (Pn) and leaf water potential (LWP) of scion under normal water conditions on M9-T337 and CG24 were observed respectively, but they were much lower than those on other interstocks while under drought stress. The significant elevations of leaf relative electrolytic leakage (REC) of scion on GX and CG24 occurred under drought stress, whereas those on SH6 showed the most stable REC than those on other interstocks. Collectively, comprehensive evaluation by subordinate function value (SF) method was employed based on above five indexes, drought tolerance of‘Fuji’apple on different interstocks were ranked in following orders: SH6 > SH40 > SH1 > M9-T337> M26 > CG24 > GX. Moreover, comparing analysis showed that four antioxidase including of superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX) and dehydroascorbate reductase (DHAR) performed higher activity levels of ‘Fuji’ apple on SH6 than those on GX. And cluster analysis of gene expression in SH6 and GX samples showed that six drought-relative genes (DREB1A, DREB2A, DREB2B, DREB2C, DREB6 and ZAT10) higher expressed in samples on GX interstock, whereas four antioxidase genes (SOD1, APX 1, CAT1 and DHAR2) higher expressed in samples on SH6, which highlighted the vital roles of antioxidant enzymes in contribution to the drought tolerance of scion of apple on different dwarfing interstocks. Key words: Apple, Drought stress, Dwarfing interstock, Antioxidase

106

NOTE

Tetraploid Carrizo citrange rootstock (Citrus sinensis Osb. X Poncirus trifoliate L. Raf.) enhances natural chilling stress tolerance of common clementine (Citrus clementina Hort. ex Tan) Julie Oustric (Université de Corse) Abstract: Low temperatures can disturb the development, growth and geographic distribution of plants, particularly cold sensitive plants in Mediterranean area, where temperatures can reach low levels. In citrus crops, scion/rootstock combinations are used to improve fruit production and quality, and increase tolerance to biotic and abiotic stresses. In the last decade, several studies have shown that tetraploid citrus seedlings or rootstocks are more tolerant to abiotic stress than their respective diploid. The objective of this study was to test whether the use of tetraploid rootstocks can improve the chilling tolerance of the scion. We compared physiological and biochemical responses to low seasonal temperatures of common Clementine (Citrus sinensis Osb. ×Poncirus trifoliata L. Raf.) grafted on diploid and tetraploid Carrizo citrange rootstocks, named C/2xCC and C/4xCC, respectively. During the coldest months, C/4xCC showed a smaller decrease in net photosynthesis (Pn), stomatal conductance (Gs), chlorophyll fluorescence (Fv/Fm), and starch levels, and lower levels of malondialdehyde and electrolyte leakage than C/2xCC. Specific activities of catalase (CAT), ascorbate peroxidase (APX) and dehydroascorbate reductase (DHAR) were higher in C/4xCC during the cold period, whereas chlorophyll, proline, ascorbate and hydrogen peroxide (H2O2) levels and superoxide dismutase (SOD) activity did not vary significantly between C/4xCC and C/2xCC throughout the study period. Taken together, these results demonstrate that tetraploid Carrizo citrange rootstock improves the chilling tolerance of common clementine (scion) thanks to a part of the antioxidant system. Key words: Antioxidant, citrus, cold stress, photosynthesis, polyploidy, rootstock.

107

NOTE

Two 7-O-di-glucosyltransferases directly compete with 1,2-rhamnosyltransferase during the biosynthesis of bitter flavonoid neohesperidoside in citrus Jiajing Chen, Ziyu Yuan, Juan Xu. Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture and Forestry, Huazhong Agricultural University Abstract: Flavonoid di-glycosides significantly affect the taste and commercial value of citrus fruit. However, the functions of many glycosyltransferases catalyzing flavonoid glycosylation remain poorly understood. In this study, we identified three 7-O-di-glucosyltransferases (dGlcT) genes closely related to the 1,2-rhamnosyltransferase (1,2RhaT) in citrus genomes. In transgenic tobacco BY2 cells, over-expression of CmdGlcT-1 or CsdGlcT-2 catalyzed narigenin-7-O-glucosides into a bitterless compound naringenin-7-O-di-glucosides, whereas over-expression of Cm1,2RhaT converted the same substrate into the bitter compound naringin (narigenin-7-O-neohesperidoside). Furthermore, the 1,2RhaT was more efficient than the dGlcTs in catalyzing narigenin-7-O-glucoside. In citrus species, only 1,2RhaT, but not dGlcT, was directly pertinent to the bitter naringin accumulation as demonstrated by association analysis of 50 cultivars and co-segregation analysis of a F1 population derived from Citrus reticulata × Poncirus trifoliata. The dGlcTs showed an opposite expression pattern to CHS and CHI, two genes encoding rate-limiting enzymes of naringenin biosynthesis, during citrus fruit development stages. Naringenin-7-O-di-glucosides were not detected in citrus fruit, which might be the result of un-coupled availability of dGlcTs and naringenin, in addition to the substrate competition between 1,2RhaT and dGlcTs. In the past, human selection of the deletion and functional mutation of 1,2RhaT led to the step-by-step evolution of the flavor-related metabolic network in citrus. Our research provides the foundation to potentially improve the taste and increase the nutrition contents in citrus fruit through rapid manipulation of the network by knocking-out 1,2RhaT or enhancing the expression of dGlcT using genetic transformation. Key words: Citrus, bitterness, flavonoid, flavonoid-7-O-di-glucosides, neohesperidoside

108

NOTE

Study on the Metabolic Enzyme Activity of Different Jujube Cultivars Abstract: Jujube is the largest economic fruit tree planted in Xinjiang. In recent years, the phenomenon of fruit cracking of red dates is severe. The fruit cracking rate is as high as 30% to 40%, which seriously affects the development of the industrial chain of jujube. Therefore, this test uses crack resistant varieties “Tengzhoutangzao”, “ Hengyangzhenzhu, “Huizao”, “Zhongyangmuzao” and cleft-brosting varieties “Daliyuanzao”, “Junzao”, “Jinsixiaozao” and “Shitingzao” were used as test materials to measure green The changes of cell metabolic enzyme activities in flesh and peel of jujube fruit during maturation, white maturation, semi-red period, and full red period, and the correlation analysis was used to explain the relationship between cell metabolic enzyme activities and fruit cracking in the pulp and pericarp of different jujube varieties. The results showed that the activities of catalase and catalase in the crack-resistant cultivars were significantly higher than that of the cleavable cultivars during the ripe-to-half red stage, and the pectinase and cellulase activities in the rind of the cultivars. The period from the white mature stage to the semi-red stage was significantly higher than that of the anti-cracking species; the catalase activity in the peel-cleavable cultivars was significantly lower in the mature stage to the semi-red stage than that in the anti-cracking species; and the CAT and SOD enzymes Activity was negatively correlated with cracking fruit, and pectinase and cellulase were positively correlated with fruit cracking. Key words: Jujube; Dehiscent fruit; Enzyme activity

109

NOTE

Characterization of a Novel Litchi R2R3-MYB Transcription Factor that Involves in Anthocyanin Biosynthesis and Tissue Acidification BIAO LAI, Lina Du, Bing Hu, Dan Wang, Huicong Wang, Guibing Hu. (South China Agricultural University) Abstract: The fruit maturation of litchi (Litchi chinensis) is characterized by dramatic changes of pigments in pericarp and flavor compounds in aril. Among them, the biosynthesis of anthocyanins is the most noticeable. Previous studies showed that LcMYB1 and LcbHLH transcription factors participated in regulating the anthocyanin biosynthesis of litchi. In this study, we describe the cloning and functional characterization of LcMYB5, a unigene identified from litchi transcriptome. Expression studies indicated that LcMYB5 is constitutive expression in all tissues tested and during pericarp development but is mainly expressed in newly developed aril. Overexpression of LcMYB5 in tobacco (Nicotiana tabacum) leads to an up-regulation of endogenous bHLHs, CHS, F3H and DFR genes, and enhanced anthocyanin accumulation in reproductive tissues. Heterologous expression of LcMYB5 in an2 and an4 petunia mutant W115 resulted in upregulation of AN1 and DFR gene and pigmented petals, suggesting that LcMYB5 can partly complement the an2 and an4 mutant. More interesting, the pH values in petals and leaves from transgenic lines were significant lower than wild type in both tobacco and petunia, indicating LcMYB5 also involved in pH regulation. And during the development of litchi aril, the expressions of LcMYB5 were generally paralleled with the contents of malic acid. These results indicated that LcMYB5 involved in not only anthocyanin biosynthesis but also tissue acidification in tobacco and petunia and probably also in litchi. LcMYB5 enhanced anthocyanin accumulation by activating endogenous bHLHs and structural genes responsible for biosynthesis of anthocyanin precursor but not the latest structural gene UFGT. The tissue acidification in response to LcMYB5 overexpression might involve in the upregulation of tonoplast H+-ATPase gene. Key words: Litchi, R2R3-MYB, Anthocyanin Biosynthesis, Tissue Acidification

110

NOTE

Study on the Metabolic Enzyme Activity of Different Jujube Cultivars Jianyu Wang (Tarim University) Abstract: Jujube is the largest economic fruit tree planted in Xinjiang. In recent years, the phenomenon of fruit cracking of red dates is severe. The fruit cracking rate is as high as 30% to 40%, which seriously affects the development of the industrial chain of jujube. Therefore, this test uses crack resistant varieties “Tengzhoutangzao”, “ Hengyangzhenzhu, “Huizao”, “Zhongyangmuzao” and cleft-brosting varieties “Daliyuanzao”, “Junzao”, “Jinsixiaozao” and “Shitingzao” were used as test materials to measure green The changes of cell metabolic enzyme activities in flesh and peel of jujube fruit during maturation, white maturation, semi-red period, and full red period, and the correlation analysis was used to explain the relationship between cell metabolic enzyme activities and fruit cracking in the pulp and pericarp of different jujube varieties. The results showed that the activities of catalase and catalase in the crack-resistant cultivars were significantly higher than that of the cleavable cultivars during the ripe-to-half red stage, and the pectinase and cellulase activities in the rind of the cultivars. The period from the white mature stage to the semi-red stage was significantly higher than that of the anti-cracking species; the catalase activity in the peel-cleavable cultivars was significantly lower in the mature stage to the semi-red stage than that in the anti-cracking species; and the CAT and SOD enzymes Activity was negatively correlated with cracking fruit, and pectinase and cellulase were positively correlated with fruit cracking. Key words: Jujube; Dehiscent fruit; Enzyme activity

111

NOTE

Better Mind; Better Work Effects of Plants on Adolescent as Mental Stress Measured by EEGs Ahmad Hassan, Jiang Tao, Guo Li, Mingyan Jiang, Li Nian, Chen Qibing. (Sichuan Agricultural University) Abstract: Background: Educational stress for many university students is the leading cause of poor mental health. Stress is a natural process that every student faces in their daily school life, and removing this stress can lead to problems. Therefore, the present study was conducted to check the relaxing effects of horticultural activity on university students and to investigate how brainwave activity changes in subjects. Methods: A comparative experiment was performed among 40 Chinese adults (50% male, 50% female) by transplanting plants (horticulture activity) and computer tasks (control activity) for 10 minutes. The participant effects of both activities were recorded by measuring blood pressure, EEG and State-Trait Anxiety Inventory (STAI) results. Results: Systolic blood pressure was significantly lower while transplanting plants than while performing the control task. Furthermore, significant changes in brainwaves were observed during both activities. The STAI anxiety score was also significantly lower after transplanting plants. Conclusions: Our results provide scientific evidence that the horticultural activity can promote physiological and psychological relaxation in university students. Key words: mood, relaxation effects, EEG, gender, gardening

112

NOTE

Acquisition of virus eliminated apple plants by thermotherapy and the factors influenced the eliminating efficiency Jun Ke Zhang, Xing Liang Li, Min Ji Li, Bei Bei Zhou, Yu Zhang Yang, Qiang Zhang, Qin Ping Wei (Beijing Academy of Forestry and Pomology Sciences) Abstract: Reliable and efficient detection and elimination methods for eight apple viruses and viroids, including Apple necrotic mosaic virus (ApNMV), Prunus necrotic ringspot virus (PNRSV), Apple scar skin viroid (ASSVd), Apple green crinkle virus (AGrCV), Apple dimple fruit viroid (ADFVd), Apple chlorotic leaf spot virus (ACLSV), Apple stem grooving virus (ASGV), and Apple stem pitting virus (ASPV), from infected apple plants was established using thermotherapy. Based on multiple alignments of available virus or viroid characteristic genes, high compatible degenerate primer pairs were designed and an efficient and sensitive detection method was developed using quantitative real-time PCR (qPCR), which were further verified by short interfering RNA (siRNA) deep sequencing. Coupled with root protecting and shoot growth promoting measures, potted apple plants of six cultivars were subjected to thermotherapy for 30 days, followed by virus detection and shoot tip grafting. Finally virus-free plants of five apple cultivars were achieved, the virus elimination efficiency was over 30% for the Kudowu, Fuji 2001, and Devil Gala, and was over 10% for Red Jonathan and Shizuka, by contrast no virus-free plants were detected for Shinano Gold. The results demonstrated the variability in the applicability of thermotherapy among different apple cultivars. Correlation analysis of the factors influencing the elimination efficiency in the different cultivars showed that total shoots, total candidate shoots and the shoot growth rate positively correlated with the virus elimination efficiency. In addition, the correlation coefficients of the elimination efficiency and the virus free plant number were significantly related to the shoot growth rate, implying a vital role of the shoot growth rate in virus elimination using thermotherapy. Our study provides a new qPCR assay for those eight apple viruses and stresses the importance of cultivar characteristic in virus elimination by thermotherapy. Key words: Apple, Virus detection, Thermotherapy, Virus elimination

113

NOTE

Comparative analysis of ATP citrate-lyase enzyme activity and gene expression among citrus cultivars Ling-Xia Guo, Li-Juan Luo,Cai-Yun Shi, Yong-Zhong Liu. (Huazhong Agricultural

University)

Abstract:ATP-citrate lyase（ACL，EC4.1.3.8）catalyzes the citric acid to produce acetyl-CoA and oxaloacetic acid in cell cytoplasm. Of them, the cytosolic acetyl-CoA enters into the biosynthesis pathway of many secondary metabolites, which makes ACL very important in overall plant metabolism. However, the information about how ACL regulates citric acid metabolism and participates in the biosynthesis of secondary metabolites in citrus is still scarce. In this study, fruits of ‘Anliu’ orange (Citrus sinensis cv. Anliu), ‘Niuher’ navel orange (C. sinensis cv. Niuher), ‘Guoqing No. 1’ satsuma mandarin (C. unshiu cv. Guoqing No. 1), ‘Egan No. 1’ Ponkan (C. reticulata cv. Egan No. 1), ‘Zaoxiang’ pummelo (C. grandis Osbeck cv. Zaoxiang) and ‘HB’pummelo (C. grandis Osbeck cv. HB) were used to investigate the ACL activity changes during the late fruit development of different citrus cultivars and its relationship with citric acid metabolism. The results showed that the citric acid content in all cultivatrs’ fruits decreased gradually during the late stage of fruit development. Moreover, the ACL enzyme activity and acetyl-CoA content decreased gradually either in detected citrus cultivars except for ‘Anliu’ orange, in which the ACL enzyme activity increased gradually but the acetyl-CoA content decreased. However, ACL gene expression increased gradually during the late fruit development of all detected cultivars. These results indicated that ACL involves in the citric acid degradation process in citrus fruit, but the relationship between ACL enzyme activity and gene expression or citric acid content in fruits is complicated among cultivars. Keywords: acetyl-CoA, ATP -citrate lyase, Citrus, Citric acid

114

NOTE

Three LcABFs transcription factors are involved in the regulation of chlorophyll degradation and anthocyanin biosynthesis during fruit ripening in Litchi chinensis Bing Hu, Jietang Zhao, Hui-Cong Wang, Guibing Hu. South China Agricultural Univsersity Abstract: During litchi (Litchi chinensis Sonn.) fruits ripening, two major physiological changes, degreening (chlorophyll degradation) and pigmentation (anthocyanin biosynthesis) are visually apparent. However, the specific factor triggering this important transition is still unclear. In the present study, we found that endogenous ABA content increased sharply when chlorophyll (Chl) breakdown initiated and ABA level peaked just before the onset of anthocyanin accumulation, suggesting ABA plays an important role during litchi fruit pigmentation. Then we characterized three ABSCISIC ACID RESPONSE ELEMENT-BINDING FACTORs (LcABF1/2/3) belonging to group A of basic leucine zipper (bZIP) transcription factors previously shown to be involved in ABA signaling under abiotic stress. LcABF1 transcripts increased onset of Chl degradation and the expression of LcABF3 accumulated when anthocyanin biosynthesis. In addition, dual luciferase assay and yeast one-hybrid system indicated that LcABF1/2 recognized ABA-responsive elements in the promoter region of Chl degradation-related genes (PAO and SGR), while LcABF2/3 bound the promoter region of LcMYB1 and anthocyanin biosynthesis-related structural genes. Indeed, Nicotiana benthamiana leaves transiently expressed LcABF1/2 showed a senescence phenomenon with Chl degradation, and LcABF3 overexpression increased the accumulation of anthocyanin via activating LcMYB1, which is the key determinant of anthocyanin biosynthesis. These data indicate that LcABF1/2/3 are important transcriptional regulators of ABA-dependent litchi fruit ripening involving in both Chl degradation as well as anthocyanin biosynthesis. Key words: Abscisic acid, ABF, chlorophyll degradation, anthocyanin biosynthesis, transcriptional regulation, fruit ripening, Litchi chinensis.

115

NOTE

CsPH8, a p-type proton pump gene plays a key role in different accumulation of citric acid in citrus Caiyun Shi, Liu Yong-Zhong, Yang Huan, Ning Dong-Yuan, Syed Bilal Hussain (Huazhong Agricultural University) Abstract: Plant cell has three types of proton pumps including vacuolar H+-ATPase (V-ATPase), vacuolar H+-pyrophosphatase (V-PPase) and plasma membrane-type H+-ATPase (P-type ATPase) which have the function in proton and citric acid transport. CsPH8 is a citrus p-type proton pump gene. Previous study showed that the reduction of CsPH8 expression level was possibly the main reason for citric acid low accumulation in ‘Honganliu’ orange (Citrus sinensis) or ‘acidless’ pumelo (C. grandis) fruits. In this study, we found that CsPH8 was located in the tonoplast. Moreover, comprehensive analysis indicated that the low expression level of CsPH8, rather than genes of V-ATPase or V-PPase, was always accompanied with low content of citric acid in a given tissues, such as in leaf and vice versa; additionally, CsPH8 expression profile was consistent with the change profile of citric acid content during the fruit development of navel orange ‘Newhall’, ‘Anliu’ orange, and ‘Zaoxiang’ pumelo. Interestingly, CsPH8 transient overexpression in acidless pumelo juice sacs and strawberry fruits significantly increased the titratable acid content in acidless juice sacs and strawberry fruits, respectively. On the contrary, RNA-interfering CsPH8 expression significantly decreased the titratable acid content in ‘Zaoxiang’ pumelo juice sacs. Taken together, these results proved that CsPH8, rather than genes of V-ATPase or V-PPase, plays a key role in different accumulation of citric acid in citrus. Key Words: Citrus; Fruit quality; Citrate accumulation; Vacuole; Proton pump

116

NOTE

Application of Gray Correlation Method in Comprehensive Evaluation of Salt Tolerance of Turnip(Brassica rapa L.) in Seedling Stage Yu Zhou. Tarim University Abstract: In order to improve the scientific and rational evaluation method of tunip salt tolerance，Salt solution simulated salt stress experiment was conducted under 100 mmol / L NaCl and Na2SO4,plant height (PH), root length (RL), root / shoot ratio (RSR), fresh shoot weight (SDB), fresh weight of roots (RDB) ), Soluble protein content (SP) and chlorophyll content (SPAD) were determined and the gray correlation method was applied to evaluate the tunip salt tolerance.The results showed the root-to-crown ratio and the fresh weight of underground parts are not the main evaluation indicators of salt tolerance of turnip seedlings.The root length is not suitable as an index to evaluate the salt tolerance of seedlings during the seedling stage.Plant height is the best indicator of salt tolerance of turnip seedlings.Variety No. 4 showed high salt tolerance in complex salt stress and No. 5 showed salt sensitivity.It can be used as a base material for salt tolerance breeding and improvement of germplasm resources. Key Words: Turnip; Seedling stage; Gray relational degree; Comprehensive evaluation

117

NOTE

Transcriptional Regulation of Key Genes of Citrulline Biosynthetic Pathway Mediated By Various Rootstock Ali Aslam, Ali Aslam, Liu Wenge. (Zhengzhou Fruit Research Institute, Henan, China) Abstract: Watermelon is considered to be a largest natural source of citrulline. Transcriptional regulation of citrulline biosynthetic pathway genes and quantification of citrulline was studied in watermelon grafted on pumpkin, gourd, wild, seeded, watermelon (self grafted). No graft served as a control. Citrulline content was significantly higher in pumpkin rootstock. Citrulline content was significantly different among all the developmental stages in all grafted and no grafted plants. Peak period of citrulline accumulation reached early in wild and gourd rootstock. Maximum citrulline produced in later stages in all rootstocks. Citrulline content begins to decline near or after maturity in gourd and wild rootstock. We assume that wild and gourd rootstock caused early maturity as citrulline declines after maturity. Rootstock enhanced citrulline by delaying the maturity. High transcript level for GAT, NAG and NAGK can be related to high citrulline amount in pumpkin and among downstream stream genes, In ASS gene family, ASS1 interact antagonistically with ASS2 and ASS3 while ASL gene family work synergistically resulted in low degradation of citrulline in hetero grafted. Experiment was laid out according to Randomized Complete Block Design (RCBD) and three biological replicates were used for analysis. The significant differences between expression values were statistically evaluated by standard deviation. Two ways ANOVA for citrulline quantity was performed and tested for statis¬tical significance using Statistics 8.1. Key words: Watermelon, Citrulline, Transcript Level, Hetero grafted, Biosynthetic pathway

118

NOTE

The Partly Seed Abortion Characteristics and Differences in Seed Development as Influences by Different Pollen Sources and temperature in Litchi cv.‘Guiwei’ Dan-Rong Xie, Jie-Tang Zhao, Xu-Ming Huang, Hui-Cong Wang. (South China Agricultural University) Abstract: The seed abortion (Chicken tongue) is a common hereditary phenomenon in litchi. ‘Guiwei’ is a typical partly abortive cultivar, whose seed development can be divide into three types: early abortion, late abortion and normal. The seed abortion rate affects not only taste but also edible rate, and therefore the most important factor affecting the fruit quality of ‘Guiwei’. In this research, we investigated seed abortion rate in different orchards for several years and the effects of different pollen sources and temperature on seed development. Seed abortion rate of ‘Guiwei’ varied among orchards and production years ranging from 50% to 83%. The skewed distribution of seed weight suggested that the seed abortion of ‘Guiwei’ belong to qualitative trait. Pollen sources had a remarkable influence on the seed develoment of ‘Guiwei’. Self-pollination tended to produce fruits with abortive seed, while cross-pollination tends to produce large seed fruits. The cause of seed development failure in self-pollination fruit is not self-incompatibility, but a retard in endosperm development. Xenia phenomenon in ‘Guiwei’ means the filial genotype determines its seed development. More interestingly, temperature displayed critical role in the seed development of ‘Guiwei’. During the crucial seed development stage (before 45 days after anthesis), lower temperature favour the seed development and tend to produce big seed fruits. The boudary temperature line for seed develoment is around 22℃. Trees grew under 18/22℃ (night/day temperature) produced 40% seed abortion fruits with average seed weight around 1.5 g, while those grew under 22/26℃ produced 80% seed abortion fruits with average seed weight around 0.35 g. The seed development phenotype of different pollinators indicated that the seed development of 'Guiwei' do not follow Mendelian inheritance. And the significant effects of temperature on seed development suggested that seed abortion of ‘Guiwei’ might be rgulated by an epigenetic mechanism. Key words: Litchi chinensis Sonn., seed development, pollen source, temperature, epigenetics

119

NOTE

Studies on the Anther Culture Technology in Processing Tomato shuling shan, shengqun pang, xiaoshan guo, guorun zhang. (Department of Horticulture, Agricultural College, Shihezi University) Abstract: Studies on the Anther Culture Technology in Processing Tomato Shan Shuling, Pang Shengqun*, Guo Xiaoshan, Zhang Guoru (Department of Horticulture, College of Agriculture, Shihezi University, Xinjiang Production and Construction Corps Key Laboratory of Special Fruits and Vegetables Cultivation Physiology and Germplasm Resources Utilization, Shihezi, Xinjiang, 832003, China） Abstract : Processing tomato (Lycopersicon esculentum Mill.) is a traditional daily food in many countries and regions. Processing tomato is also the basic raw material of the tomato food industry. Processing tomatoes are unique in flavor, rich in nutrients and high in lycopene content. A wide variety of products can be made from processing tomatoes. Therefore, processing tomatoes have become an important functional food, ranking first in the world both in production and in consumption. The tomato varieties in this study were hybridized combinations C1, C2, and C3. Acetate-magenta staining was used to observe the development of pollen microspores under a microscope. The morphology and anatomical characteristics of the microspores was observed at different developmental stages. In addition, processing tomato anthers were used as explants to determine the optimum MS medium for callus induction and for callus proliferation. The results were as follows: 1. The bud length of the hybridized combinations C2 and C3 ranged from 5.00 to 5.99 mm during microspore development of uninucleate microspores . In comparison, the bud length of C1 ranged from 6.00 to 6.99 mm. The mononuclear and apical cytological features were that the cells were perfectly round, with the nucleus near the cell wall and the germination hole. Floral form was enlargement, slightly open, with yellow-green bracts. The anther color was yellow-green and the anther was easy to peel. 2. The callus induction rate from anthers differed significantly among the three hybridized combinations. The callus induction rate of C1 (13.33%) was highly significantly greater than the induction rates of C2 and C3. The best medium for inducing callus formation from processing tomato anthers was MS + 0.5 mg/L 2,4-D + 1.0 mg/L KT. The calli that were induced from the tomato anthers could be classified roughly into three types based on color and density. The first type of callus was yellow-white. Its outer surface was loose but its inner surface was dense. The second type of callus was green, indicating that there were no callus-like protrusions. The third type was white and dense. 3. The callus proliferation rate ranged from 3.33% to about 90%. The optimum culture medium for callus proliferation was MS +1.0 mg/L 6-BA + 0.2 mg/L NAA. In addition, a low concentration of 0.1 mg/L TDZ caused knobs to form on the calli. Furthermore, the calli did not proliferate substantially. Key words: processing tomato; microspore development; callus; induction; proliferation

120

NOTE

Inheritance of Major Gene Plus Polygene Underlying Bolting and Flowering Traits in Non-heading Chinese Cabbage Xiaofeng Li, Hongfang Zhu, Yuying Zhu, Ruixian Hou, Wen Zhai

(Shanghai Academy of Agriculture Sciences) Abstract: It performed genetic analysis of bolting and flowering traits in non-heading chinese cabbage, and the result could contribute to the identification for bolting-resistant cultivars of non-heading chinese cabbage.The mixed major gene plus polygene inheritance model was used to analyze the inheritance of bolting and flowering traits in non-heading chinese cabbage with six generations of early bolting variety M10-1(P1) , bolting variety M10-2(P2) and their F1 , B1 , B2 and F2 generations. The results showed that the bolting trait was fitted the genetic model of two pairs of additive-dominant-epistatic major gene plus additive-dominant polygene model. It confirms that bolting trait was mainly controlled by two major genes expressing in the mode of additive-dominant-epistatic effects, and that additive effects of the two major genes were similar. In addition, there were main of the second major gene in the dominant effect. There were additive ×additive interaction effect and dominant × dominant interaction effect of major gene and negative additive effects of polygene. Heritabilities of major genes in B1, B2, and F2 generations were 83.83%, 87.82% and 88.31%, respectively, while those of polygene in B1, B2, and F2 generations were all 0%, with an average of 86.65%. The rate of environmental variation was 13.35% in the total phenotypic variance. The bolting trait in non-heading chinese cabbage was dominated by major genes, and that environmental factors played a key role in inheritance. Thus, the selection of bolting trait in non-heading chinese cabbage was effective in early generations. The flowering trait was similar to the bolting trait inheritance. Heritabilities of major genes was 9.57% on an average, and the variance with an average of 90.43% was affected by environmental factors. These findings revealed that the flowering trait in non-heading chinese cabbage was greatly affected by environmental factors and that the flowering trait should not be considered as an identification indicator of bolting resistance in non-heading chinese cabbage. Key words: Non-heading chinese cabbage, Bolting trait, Flowering trait, Major gene plus polygene, Genetic model

121

NOTE

Early Screening of Processing Tomato Seedlings Treatment with Ethylmethanesulfonate xiaoshan guo, shengqun pang, shuling shan, guoru zhang. (Department of Horticulture, Agricultural College, Shihezi University) Abstract: Early Screening of Processing Tomato Seedlings Treatment with Ethylmethanesulfonate Guo Xiaoshan，Pang Shengqun，Shan Shuling，Zhang Guoru College of Agriculture, Shi hezi University, Department of Horticulture Key Laboratory of Characteristics of Fruit and Vegetable Cultivation Physiology and Germplasm Resources Utilization Processing tomato seeds (strain JW001) were soaked for 12 hr in solutions containing 2, 2.5, 3, 3.5, 4, 4.5% ethylmethanesulfonate (EMS). Seed germination rates were determined. The surviving seedlings were grown in the greenhouse and the following variables were measured: embryonic axis length, radicle length, lateral root number, seedling height, stem diameter, and root vigor. The agronomic traits of seedling stage plant the mutant strains were observed and the number of variants were counted. The results showed that the seed germination rate and the emergence rate gradually decreased as the EMS concentration increased. The germination potential and germination rate even reached zero in some treatments. The radicle length and the embryonic axis length were both significantly different in the EMS treatment than in the untreated control. Furthermore, both variables decreased as the EMS concentration increased. The EMS delayed and inhibited seed germination. In some cases it had lethal effect on the seeds. Seedling root activity was high in the EMS treatment than in the control. Root vigor gradually decreased as the EMS concentration increased. The EMS treatment had little effect on the growth of the tomato seedlings. The optimal treatment was soaking dry seeds in a 3.5% EMS solution for for 12 h.In the second part of the experiment, 1000 processing tomato (strain M0) seeds were treated with 3.5% EMS for 12 hours. A total of 631 seeds germinate,597 seedlings emerged, and 572 survived. The germination rate, emergence rate and survival rate were 63.1%, 59.7% and 57.2%, respectively. Field observations indicated that five seedlings were short and compact with distorted leaves. Four seedlings had three cotyledons.One seedling had twin cotyledons.Four seedlings had two cotyledons and no growing point. Four seedlings sensitive to low temperatures leave turn purple.Nine seedlings had nearly oval, had spiny leaves. Fifteen seedlings had broad leaves. Three seedlings leaves crack.Two seedlings had leaf deformities.The leaves of one seedling were yellow-green in comparison with the wild type, and the leaves were slender and more pronounced than the control.the total variation frequency was 4.6%. The variability of leaf phenotype and plant type variation was 7.6% and 0.8%, respectively. Key words: Ethyl Methanesulfonate (EMS); Processed Tomato；Half lethal concentration；Mutant;

122

NOTE

Cloning and Functional Analysis of the Candidate Gene PCP021016.1 for PcDw in Pear Haiyue Zhang, Yuxiong Xiao, Xiaodong Zheng, Caihong Wang, Yike Tian. Qingdao Agricultural University Abstract: Fruit tree dwarfing and compact planting has become an important mode of modern orchards production, this enables high-density planting, earlier fruiting and higher yield per hectare, and efficient mechanized management. Producing elite varieties with dwarf growth habit and high fruit quality is a primary goal to realize dwarfing and densely cultivation of pear. The dwarf type mutants found in Pyrus communis is characterized by the short shoot internodes, compact crown and less tree height, which could severed as an important genetic resource for breeding dwarf varieties. It was reported that the dwarf trait was controlled by the dominant gene PcDw. So far, the sequence information of the gene was unclear. In this study, the full-length cDNA sequence of PCP021016.1, one of the candidate genes of PcDw, was cloned from the progenies of ‘Aihuali’ (a dwarf seedling of the dwarf variety ‘Le Nain Vert’)בChili’ (a traditional variety in China with the standard phenotype). The length of the complete CDS of PCP021016.1 was 1917 bp. Subcellular localization showed that PCP021016.1-GFP was located on the cell membrane. The promoter of PCP021016.1 gene was cloned from dwarf and standard progenies, and a 20-30 bp deletion of CT repeat sequence was identified in the dwarf type. PlantCare analysis showed that the deletion was a series of CTRMCAMV35S elements, whose main function was to improve the transcription level of the gene. An InDel marker was developed to distinguish the dwarf and standard individuals in the population of ‘Aihuali’ × ‘Chili’. Ectopically expressing of PCP021016.1 into tobacco could change the growth habit distinctively. The plant height of transgenic tobacco increased significantly, and flowering earlier than control. Underground part observation indicated that both the length and the fresh weight of the transgenic tobacco roots increased significantly. According to anatomical survey, the cells of the elongation region of the transgenic tobacco roots were longer and narrower than that of the control. In the transverse section of stem, the cells of the transgenic plants were smaller and in higher density, and the vascular bundles were more developed. In the longitudinal sections of stem, the cortical cells of the transgenic plant were much slender than the control. The results indicated that PCP021016.1 gene could promote the elongation growth of roots and stems, and promote the stem cells division and the vascular bundles formation. This knowledge suggests a function analysis of the candidate gene PCP021016.1 for PcDw in pear and will contribute to the molecular breeding of dwarf varieties, which is crucial for pear production in modern orchards. Key words: Dwarf pear, PcDw gene, PCP021016.1 gene, Nicotiana tabacum L., genetic transformation

123

NOTE

Red LED light irradiation affects chlorophyll and carotenoid metabolism to improve coloration of postharvest citrus fruit Jinli Gong, Yingzi Zhang, Man Zhu, Jiajia Lin, Yunliu Zeng, Yunjiang Cheng, Pengwei Wang Huazhong Agricultural University Abstract: The coloration of citrus fruit is a very important feature for most cultivars. The pericarp of Fortunella margarita Swingle cannot completely change color when fruits reach commercial harvesting standards, this could seriously decrease their commercial value. Here, we reported that applying red LED light on postharvest citrus fruit not only accelerated peel degreening , but also kept them at the preferable freshness. This study evaluated the effect of red LED light irradiation on the pigments contents of postharvest citrus fruit. The results indicated that red light can promote coloration, accompanied by changes in plastid ultrastructure, chlorophyll and carotenoid contents. Our findings provide important information for enhancing postharvest citrus coloration using red LED light.

Key words: postharvest, citrus, degreening, red LED light, coloration

124

NOTE

Saline-alkaline stress gene development Huiji Li. (Shihezi University, XinJiang) Abstract: As the secondary salinization developed, with the saline-alkali soil area increasing, saline-alkali stress has become an important abiotic factor that limiting the growth and development of crops. With the development of biotechnology, salinization is reappraised. some studies shown that neutral salt stress and alkali salt stress were two kinds of stresses, they are both similarities and differences, now many researches paid much attention to their differences. There are many researches about the growth and physiology of plants under neutral salt and alkali salt stresses, but recent years, scientists devoted to search differences on genes level. This article reviews the neutral salt and alkali salt resistant genes from the points as follows:(1) Osmotic regulated genes, such as P5CS(Valine), BADH(Betaine dehydrogenase), CMO(Choline monooxygenase), mtlD(Mannitol), gutD(Sorbitol), OTSBA(Trehalose), Imtl(Inositol) and other small molecule synthetic genes;(2) Genes related with the antioxidation, such as APX(Ascorbate peroxidase),ERF(ascorbic acid) DHAR(Dehydroascorbate reductase) Fer(Ferritin) SOD(Superoxide dismutase) PST1(mutant) PPR40(Mitochondrial electron transfer) etc., these genes are the elimination of reactive oxygen, which relieve ROS damage to cells;(3) Ion transport genes, such as NHX(Na+/H+ reverse transporter gene), CAX(Ca2+/H+ reverse transporter gene) , HKT(Na+/K+ transporter gene) , AVP(pyrophosphatase), SOS(SOS protein). Those genes transport intracellular Na+ to the outside by the Na+/H+ antiporter, then the Na+ concentration of the cytoplasm deceases.(4) Growth regulation genes such as VHA(Proton pump), ICK(Protein kinase inhibitor);(5)Transcriptional regulatory factors such as bZIP(Leucine Zipper), SPL(Sphingosine Phosphate Lyase), MYB(Phenylpropane secondary metabolism pathway), DREB(Transcription factor protein), etc. These transcription factors act on the cis-acting elements in genes, initiate or regulate salt and alkali resistant gene expression. Key words: Salt stress,alkaline stress,gene,abiotic stress

125

NOTE

Construction of columnar apple yeast two-hybrid library and screening and functional identification of MdCoL interaction proteins Yihe Wang, Xin Sun, Jun Zhu, Hongyi Dai, Yugang Zhang. (College of Horticulture, Qingdao Agricultural University) Abstract: The Characteristics of Columnar apple are short and thick with up-right trunk and it’s convenient to pruning. It’s suitable for potted and high density planting, appropriate to mechanization management. Columnar apple is controlled by dominance singal-gene Co, located in 10th chromosome. It’s found that MdCoL is the key gene that controlled the form of columnar apple characters. The regulation mechanism of MdCoL gene on columnar apple is rarely studied, which is the theoretical basis for column formation and new variety breeding. Yeast two-hybrid library was used to screen the MdCoL interaction proteins in the paper. The results are as blow: 1. The pGBKT7-MdCoL vector was constructed and transformed into Y2HGold. Self-activation and toxicity-test for pGBKT7-MdCoL was detected in SD media. The results showed the expression product of bait gene couldn’t activate report gene and it’ s no toxicity to yeast strain. 2. Double-strands cDNA was gained by SMART and it was cloned into plasmid vector pGADT7, the cDNA library was constructed. The capacity of primary library was about 2.0ｘ106 cfu, recombination rate was 100%, insert fragment scattered 400bp~2kbp and average length was above 1kbp. The results indicated that the yeast two-hybird library could be used to separate aim genes. 3. pGBKT7-MdCoL was transformed into Y2HGold through co-transformation, and cultured on SD-Leu-Trp media. Then, the cDNA library expression vector was transferred into the clone containing bait vector. The clonings of MdCoL interacting proteins were screened on SD-Leu-Trp-His/AbA (200ng/ml), and transfered to SD-Leu-Trp-His-Ade/X-α-gal（20mg/mL）media. After PCR verification, 126 candidates cloning were gained and 19 cDNA complete sequences were obtained. Functional annotation of the interaction-assocaiated protein was carried out by Blast comparsion. 4. Using of the qRT - PCR, we analysis the relative expression of MdCoL protein genes in different organs of the columnar apple and standard apple in different period, the expression of MdCaL, MdETH, MdRUBP, MdDREB2 were significantly higher in columnar apple ' Wi' ‘Wijcik’ (Wi) than the standard apple ‘McIntosh’ (Mc) , except MdPP2C. The expression of NCED in the columnar appleWi , a key gene in the ABA synthesis of MdDREB2, was also higher than the standard apple Mc. 5. The validation of interaction between MdCoL and MdDREB2 was confirmed by qRT-PCR, yeast two-hybird and bimolecular fluorescence interaction (BiFC), which determined that MdCoL interact MdDREB2 and the interrelationship occurred in the nucleus. Key words: Columnar apple, MdCoL gene,Yeast two-hybrid, Bimolecular fluorescence complementation

126

NOTE

Investigation of kernel rate of different jujube varieties Qiuling Gao. (Tarim University)

Abstract: The number kernel of jujube is one of the factors that influence the cross breeding process, in order to breed new varieties with good characters, select properties excellent maternal plant. In this study, 43 fine jujube varieties were used as test materials, in 2016 and 2017, kernel rate, shrivelle kernel rate, fertility rate and double kernel rate, and compare the differences between two years, at the same time, we studied the change law of contents of the seed percentage of 8 jujube varieties in the region and the origin and Shandong area. The results show that, the percentage of kernel rate, shrivelled kernel rate, fertility rate and double kernel rate of 43 jujube cultivars were quite different, kernel rate is 0 %~143.33%, shrivelled kernel rate is 0%~60%, fertility rate is 0~140%, double kernel rate is 0~43.33%, 60.46% of them have a kernel rate of more than 50%; There were little differences in kernel rate, shrivelled kernel rate, fertility rate and double kernel rate among 43 jujube cultivars in different years, In 2016, it increased by 3.22%, 3.08%, 0.14% and 2.48% respectively compared with 2017; Among them, the percentage of kernel rate of 8 jujube varieties in this area is 87.5% higher than that in Shandong area, which is 3.33%~40.88% higher than that in Shandong area. By using the cluster analysi, 43 kinds of jujube varieties are divided into 5 categories, the higher the percentage of kernels is, the higher the fertility rate and the double kernel rate, the lower shrivelled kernel rate, It was found that the kernel rate, fertility rateand double kernel rate of Lu Zao 9 were the highest, and the shrivelled kernel rate was the lowest, Therefore, it can be used as an ideal material for the hybrid maternal plant. Key words: Jujube, kernel rate,variety

127

NOTE

First report on the association of Colletotrichum gloeosporioides species complex with citrus wither tip disease in Pakistan Najeeb Ullah, Khalid Pervaiz Akhtar, Muhammad Yasin Ashraf, Ehsan Ullah Khan. NIAB Abstract: Pakistan is an important global producer and increasingly, an exporter of citrus (Kinnow mandarin). However, in Pakistan, unusual weather and prevalence of diseases play a significant role in decreasing its export potential. Wither tip caused by multiple species of Colletotrichum is a consistent problem for citrus industry. Unfortunately, in Pakistan little is known about the prevalence and breadth of losses to this disease and more importantly, the lack of precise identification of Colletotrichum spp. involved can hamper the management strategies, if any. In the present study, Colletotrichum spp. isolated from infected organs of citrus (twigs and fruits) sampled in different regions of the country were investigated based on morphological and molecular criteria. The orchards observed were found severely affected by wither tip and mummified fruits were frequently seen on infected plants. Twenty one isolates of Colletotrichum were purified from these samples and mycelial growth, colony colour, size and shape of conidia were determined for the selected isolates. For their molecular confirmation, rDNA-ITS and partial β‐tubulin region of seven representative isolates were sequenced (NCBI GenBank accession numbers; MH173880, MH173881, MH173882, MH173884, MH173885, MH173886 and MH179057; partial β‐tubulin sequences submission is in process). Phylogenetic reconstruction based on ITS and partial β‐tubulin data revealed a complex of species, dominated by Colletotrichum gloeosporioides and C. siamense involved in wither tip of citrus in Pakistan. Koch’s postulates were fulfilled by pathogenicity tests on detached citrus leaves which turned dark brown (necrotic) around mycelial agar plug five days post inoculation. From morpho-cultural and multi-gene phylogeny it is first time reported that two species: C. gloeosporioides and C. siamense which reside within the C. gloeosporioides species complex are associated with wither tip of citrus in Pakistan. Keywords: Citrus, rDNA-ITS, partial β‐tubulin, mummified fruits, wither tip, Pakistan

128

NOTE

Post-harvest application of ethephon improves fruit coloration and preserves better antioxidant capacity in Eureka lemon (Citrus limon (L.) Burm. f.) Peiyu Zhang, Zhiqin Zhou. (College of Horticulture and Landscape Architecture, Southwest University, Chongqing, China) Abstract: External color of fruits is a key factor that affects consumer acceptability, and poor peel coloration in lemon causes economic losses to the producers. Bagging is a traditional and widely used method which imparts typically “lemon yellow” color to the fruit, but it’s time consuming and labor intensive. In recent years, ethephon degreening has been studied in selected early maturing citrus cultivars, but limited in lemons. The effect of post-harvest ethephon degreening on Eureka lemon peel color and fruit quality was investigated, and the quality of ethephon-degreened lemon was compared to that of bagged fruits. Selected young lemon fruits were bagged with yellow paper bags (150 mm × 180 mm) in March 2017. The bagged yellow-peeled and non-bagged green fruits were harvested on 15 November 2017. Half of the non-bagged fruits were immersed in 1000 mg/L ethephon aqueous solution for 1 min, and the other half as control. Then all of the fruits were stored in climatic cabinate (20℃, RH 85%). The measurement of fruit color, quality index and antioxidant capacity was conducted at 0, 3, 6, 9 d after treatment. After 9 d in storage, ethephon-degreened fruits showed an increased citrus color index (-0.075), closing to bagged fruits (-0.074) but significantly higher than the control (-6.971). The content of total chlorophylls (0.166 μg/g FW) of degreened fruit peel was also decreased at 9 d, which was consistent with the colorimeter results. Ethephon and bagging treatments resulted in lower soluble solid content (7.80% and 7.77%), and degreened fruits showed the lowest content of titratable acid (7.28%) at the end of storage. Ascorbic acid in the juice was decreased during storage, and control fruits exhibited the highest content (69.47 mg/100 mL), followed by degreened and bagged fruits (60.00 and 53.47 mg/100 mL). The content of total phenolics in ethephon-degreened and control fruits was increased and significantly higher than bagged fruits both in peel and pulp at 9 d, while degreened lemons had a lower content of total flavonoids compared to control, but significantly higher than bagged fruits. At 9 d of storage, degreened lemon peel showed significantly higher values of ABTS, DPPH and FRAP (35.58, 10.99 and 16.94 μmol TE/g FW, respectively) than control and bagged fruits. In addition, for flesh, the 3 types antioxidant activities of degreened fruits were also the highest (8.401, 3.783 and 8.666 μmol TE/g FW, respectively). In conclusion, ethephon degreening in Eureka lemon could enhance the peel coloration and impart uniform yellow color to the fruits after 9 d. Fruit flavor quality was also improved and more or less the same levels with bagged fruits, but interestingly, ethephon-degreened lemon fruits showed superior antioxidant capacity especially compared to bagged fruits. The results suggested that post-harvest ethephon degreening may be an alternative efficient and economical method to improve fruit color in lemon industry. Key words: Eureka lemon, ethephon degreening, fruit quality, antioxidant capacity

129

NOTE

The maturity degree, phenolic profiles and antioxidant activity of Eureka lemon [Citrus limon (L.) Burm. f.]: A negative correlation between total phenolic, antioxidant capacity and soluble solid content Xinying Dong, Zhiqin Zhou. (College of Horticulture and Landscape Architecture, Southwest University, Chongqing, China) Abstract: Lemon fruits are widely accepted for their bright colors, pleasant flavors, tart taste and nutritional value. In this study, the maturity degree, phenolic profile and antioxidant capacity of Eureka lemon [Citrus limon (L.) Burm. f.] harvested at different months of the year were investigated in an attempt to analyze the relationship between total phenolic, antioxidant capacity and maturity degree of fruits. We found that the fruits harvested in November outperformed others in terms of weight, color and soluble solid content (SSC), and fresh consumption were suggested because of their high marketability in this month. In regard to the phenolic composition, 8 phenolic acids and 8 flavonoids were detected. The main phenolic acids were ρ-coumaric acid and ferulic acid. The contents of the sum of individual phenolic acids, the maximum was found in the pulps of April fruits (269.36 ± 26.08 μg/g FW), whereas that was found in the peels of June fruits (769.28 ± 8.81 μg/g FW). The contents of eriocitrin and hesperidin were higher than other flavonoids. The maxima of the sum of individual flavonoids in the pulps and peels, they all appeared in August (3098.42±161.64 μg/g FW in pulps and 9003.91±213.45 μg/g FW in peels). Additionally, in pulps, total phenolic content (TPC), total flavonoid content (TFC) and antioxidant capacities were highest in April, while in peels, TFC and antioxidant potency composite (APC) index was also highest in April. However, the highest TPC in the peels was detected in August. There is a significant positive correlation between TPC and APC, and a negative correlation between SSC and TPC (R2=0.7955 of pulps and R2=0.4150 of peels). SSC was also negatively correlated with APC in pulps (R2=0.7224). In a word, our results showed that the contents of phenolic compounds and antioxidant activities of lemons varied significantly with maturity degree depending on different harvest time, which provided a theoretical basis for the potential utilization of lemons fruits in the future. Key words: Phenolic acids; Flavonoids; Total phenolic content; Antioxidant activity; Lemon

130

NOTE

Transcriptome profiling of glutathione improving tolerance of tomato in response to salt stress Yan Zhou, Ming Diao, Xianjun Chen, Yanyun Sun, Yulong Feng, Yueyi Li, Chaoyuan Hou, Huiying Liu. (a Department of Horticulture, Agricultural College, Shihezi University, Shihezi, 832003, Xinjiang, P.R. China b Key Laboratory of Special Fruits and Vegetables Cultivation Physiology and Germplasm Resources Utilization of Xinjiang Production and Construction Crops, Shihezi, 832003, Xinjiang, P.R. China) Abstract: At present, soil secondary salinization is one of the most harmful environmental factors limiting plant growth and yield of tomato (Solanum lycopersicum L.) under protected cultivation in China. Our previous studies showed that exogenous GSH application increases resistance to salt-induced oxidative stress by enhancing the antioxidant defense system, and regulating GSH synthesis and metabolism to maintain cellular redox homeostasis. However, there is limited available transcriptome information for the identification of genes involved in molecular mechanisms of exogenous glutathione alleviating salt stress in tomato. Here, the RNA-Seq technique was applied to analyze the gene transcriptome sequencing of non-salt stress (CK), 100 mM NaCl（N）, 100 mM NaCl + 5 mM GSH（NG）, 100 mM NaCl + 1 mM BSO（NB） and 100 mM NaCl + 1 mM BSO + 5 mM GSH（NBG）in tomato seedling leaves. The results showed that in the CK_N, N_NG, N_NB and NB_NBG treatment groups, 3385, 2527, 4116 and 2541 differentially expressed unigenes were detected, respectively. 125 differentially expressed genes related to photosynthesis, ROS-scavenging, Ca2+ and hormone signal transduction, glycometabolism, protein synthesis and heat shock were screened by GO and KEGG. Among these differentially expressed gene, salt stress down-regulated 6 photosynthesis-related genes and down-regulated ROS scavenging-related genes (TAP, CAT and GRX) and polyamine synthesis pathway-related genes (ODC, ADC and CHLN). Salt stress also up-regulated Ca2+ and brassinosteroid signal transduction, pectin and sucrose metabolism, and Hsp, ribosomes, and osmotic-associated proteins genes. Exogenous application GSH up-regulated PSI and PSII -related genes (psbZ and psaA) and Calvin cycle-related genes (rbcL) , down-regulated TAP, CAT, GRX and polyamine synthesis pathway related genes (ODC, ADC and CHLN) and regulated Ca2+ and brassinosteroid signal transduction, pectin and sucrose metabolism, and Hsp, ribosomes, and osmotic-associated proteins during salt stress. qRT-PCR analysis showed that the expression profiles of DEGs were consistent with those of RNA-seq analysis. Exogenous GSH application reduces the salt-induced photosystem damage, activates ROS scavenging systems and polyamine synthesis pathway, participates in Ca2+ and brassinosteroid signal transduction systems and protein biosynthesis, and regulates osmotic balance to improve tomato salt tolerance. The results of this study provide further insight into the molecular mechanisms of exogenous GSH alleviate salt stress in tomato, and also identify some attractive candidate genes and valuable information for improving salt stress tolerance in tomato through genetic engineering. Keywords: Tomato, Salt stress, Glutathione, Gene expression, Transcriptomic analysis

131

NOTE

Apple bZIP transcription factor MdbZIP44 regulates ABA-promoted anthocyanin accumulation Jian-Ping An, Xiao-Fei Wang, Yu-Jin Hao. (Shandong Agricultural University) Abstract: Phytohormone abscisic acid (ABA) induces anthocyanin biosynthesis, however, the underlying molecular mechanism is less known. In this study, we found that the apple MYB transcription factor MdMYB1 activated anthocyanin biosynthesis in response to ABA. Using a yeast screening technique, we isolated MdbZIP44, an ABA-induced bZIP transcription factor in apple, as a co-partner with MdMYB1. MdbZIP44 promoted anthocyanin accumulation in response to ABA by enhancing the binding of MdMYB1 to the promoters of downstream target genes. Furthermore, we identified MdBT2, a BTB protein, as an MdbZIP44-interacting protein. A series of molecular, biochemical, and genetic analysis suggested that MdBT2 degraded MdbZIP44 protein through the Ubiquitin-26S proteasome system, thus inhibiting MdbZIP44-modulated anthocyanin biosynthesis. Taken together, we reveal a novel working mechanism of MdbZIP44-mediated anthocyanin biosynthesis in response to ABA. Key word: ABA; bZIP transcription factor; anthocyanin; MdMYB1; ubiquitination; MdBT2

132

NOTE

Molecular Regulation Mechanism of AG Genes on Double flowered Cymbidium goeringii Chongbo Sun, Yue Chen. (Zhejiang Academy of Agricultural Sciences) Abstract: Cymbidium goeringii is a member of monocot. The highly evolved flower of C.goeringii with highly modified lip and fused column, or double flower offers an opportunity to understand the molecular mechanism of floral development in monocots. In the core eudicot model plant, the C-class MADS-box gene, AG play a key role in formation of double flower. Our prophase study had isolated AG that showed different expression pattern in C.goeringii and its double-flowered mutant. In this project, we screen the up-and down-regulated genes which interacted with AG, and analyze the function and expression pattern of these genes in C.goeringii and its double-flowered mutant through yeast one-hybrid analysis, yeast two-hybrid analysis, real-time quantitative reverse transcription-PCR, and ectopic expression analysis. The results reveal the molecular mechanism of formation of double-flowered C.goeringii mutant. This research will provide the knowledge for comprehending developmental biology to verify the validity of the quartet model of flower development in monocots. This could also contribute to comprehend the molecular mechanism of formation of other double flower. Key words: Cymbidium; flowering; MADS-box; AG

133

NOTE

Effects of Salt and Alkaline Stresses on the Growth and Root Ion Micro-distribution in Chili Pepper Haiying Zhang. （Shihezi University） Abstract: In order to supply the differences of neutral salt stress and alkali salt stress on the chili pepper, Tianjiao33, Nanhan Jinta and Sanyingjiao were stressed with 90 mmol/L NaCl, Na2SO4, NaHCO3, Na2CO3, mixed neutral salts (NaCl+Na2SO4=9:1) and mixed alkali salts(Na2CO3+NaHCO3=9:1) respectively. Growth parameters such as height, stem diameter indicated that except the NaCl treatment of Sanyingjiao, the other treatments inhibited the growth of three kinds of chili peppers. The growth inhibition decreased in the order of Na2CO3 > mixed alkali salts (Na2CO3: NaHCO3=9:1)> NaHCO3 > mixed neutral salts > NaCl > Na2SO4. Among three varieties, the growth of Tianjiao33 was inhibited more, and less inhibitory on Sanyingjiao. The results of root ion micro-distribution showed that with the stress of mixed alkali salt, the contents of Na+、Cl-、K+ and value of Na+/K+ of three pepper verities were much more than that of mixed neutral salts treatment. The ion contents of Tianjiao33 increased 2 times than that of the other two varieties, which broken the ion balance, and lead to slow development of peppers. Key words: chili pepper; neutral salt; alkali salt; stress; growth; ion micro- distribution

134

NOTE

Microbe-metal interaction induced physiological and metabolic changes in spinach grown in heavy metals polluted soil Jamil Muhammad (Kohat University of Science and Technology) Abstract: The growth of vegetable crops was adversely affected by heavy metals through production of reactive oxygen species (ROS), which disturb the balance between oxidative stress and antioxidative defense responses. Microbe-metal interaction is a promising technology that can be used to alleviate heavy metals stress in plants. This study investigated the protective role of two bacterial strains (Bacillus aerius and Bacillus cereus) on physiological and metabolic changes in spinach grown on heavy metals polluted soil. Results revealed that plants grown in heavy metals contaminated soil showed significant reduction in germination and plant biomass, total nitrogen (TN) and proteins (TP) contents, whereas significan tincreased in level of metallothioneins (MTs) and antioxidative enzymes (superoxide dismutase (SOD), peroxidase (POD), catalase (CAT) and ascorbate peroxidase (APX)) were observed. Conversely, plants inoculated with respective bacterial strains alleviates heavy metals induced reduction in plant biomass by improving seed germination, total nitrogen and proteins contents and reducing the level of metallothioneins and antioxidative enzymes. It was further noted that both bacterial strains significantly improved the stomatal microstructural alterations in plants grown in heavy metals polluted soil. The current finding proved that heavy metals resistance strains not only alleviate heavy metals toxicity but also improve plant growth by altering various physiological and biochemical processes. Key words: Bacillus spp, Heavy metals toxicity, Antioxidative metabolism, Metallothioneins, SEM.

135

NOTE

Test of Variety Purity and Genetic Diversity with SSR Markers for Watermelon New Hybrid Cultivars ‘Kangbing948’ and ‘Shenkang988’ Li Chao Han1, Gu Wei Hong1, Song Rong Hao2, Yang Hong Juan1, Zhu Li Hua1. (1Horticultural Research Institute, Shanghai Academy of Agricultural Sciences;2Plant Protection Research Institute, Shanghai Academy of Agricultural Sciences) Abstract: Simple sequence repeat (SSR) molecular markers were used to test variety purity of watermelon hybrids ‘Kangbing948’ and ‘Shenkang988’, and were used to analyze genetic diversity of parental germplasms of the two watermelon varieties. Two pairs of specific primers (primer BVWS00209 and BVWS00233) out of 38 pairs of SSR core primers were selected to make a rapid variety purity test. The seed purity of ‘Kangbing948’ and ‘Shenkang988’ detected by SSR markers were 97% and 98% , respectively. Compared with results of morphological identification of ‘Kangbing948’ and ‘Shenkang988’ in field, the coincidence rate of the variety purity detected by SSR markers was higher than 99%. And the DNA fingerprints of those parental germplasms of ‘Kangbing948’ and‘Shenkang988’ were constructed by using polymorphic sites of the selected SSR primers. The results showed that the technical system can meet the requirements of rapid variety purity test of the watermelon new hybrids ‘Kangbing948’ and ‘Shenkang988’ in laboratory. Key words: Watermelon, New variety, SSR markers, Variety purity, Distinctiveness, Fingerprint

136

NOTE

Comparative and parallel transcriptional and metabolic studies for fruit quality and exocarp in sand pears Hong Wang1, Jing Lin1, Youhong Chang1, Cai-Zhong Jiang2. 1

Institute of Pomology, Jiangsu Academy of Agricultural Science;2 Crops Pathology

and Genetics Research Unit, United States Department of Agriculture, Agricultural Research Service Abstract: A sand pear cultivar, Sucui1 (SC1), is widely cultivated in the Yangtze River basin, mainly because its fruits have excellent flavor and exocarp than its parent Cuiguan and Huasu. The plant metabolome is regarded as a bridge between transcriptome and phenome to some extent. Combined transcriptomic and metabolomic analyses were carried out in fruits of these three cultivars. The results show both distinct and overlapping aspects of transcription and metabolism within and between cultivars. Using parallel transcriptome and metabolome we identify candidate genes and metabolites potentially responsible for variation in fruits quality and exocarp and provide evidence of transcription-metabotype-phenotype linkage.

Key words: Transcriptome, metabolome, sand pear, fruit quality, exocarp

137

NOTE

Genome-Wide Identification and Characterization of SBP-like Transcriptional Factor Family in Pineapple and Expression Profiling during Flowering Induction by Ethephon Hongna zhang. (South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences) Abstract: SQUAMOSA promoter binding protein (SBP) transcription factors play important regulatory roles in floral transition and flower development. In this study, 17 AcSPLs distributed in 12 chromosomes were identified based on genome-wide identification in pineapple. Their chromosomal localization, gene structures, and conserved motifs were also analyzed. Phylogenetic analysis indicated that AcSPLs were clustered into five groups through multiple sequences aligned with Arabidopsis and Oryza sativa. Duplication analysis manifested that segmental duplication and tandem duplication might give rise to the expansion of the SBP-like gene family in pineapple. The expression levels of AcSPL4, AcSPL8, AcSPL10, AcSPL14, AcSPL16, and AcSPL17 presented noticeable changes from the expression level of the control group, suggesting that these members of the AcSPL gene family might play important roles in specific stages in the process of ethephon inducing flowering in pineapple. Key words: Pineapple; SPL; Genome-wide identification; Flowering induction; Ethephon

138

NOTE

Study on the Feasibility of Populus euphratica leaves retting substrate for cucumber Seedling Wenying Yao, Hongbin Du. (Tarim University) Abstract: With Jinyan no.4 cucumber seeds as experimental materials, through the determination of the physicochemical properties of the compost matrix of Populus euphratica leaves, slag and vermiculite with different proportions (contrast to traditional nutritional soil: vermiculite = 1:1 ), and seedling test, to explore the feasibility of Populus euphratica leaves retting substrate for cucumber seedling. The results showed that there were significant differences in the effects of different proportion of leaf substrates of Populus euphratica on cucumber seedling growth. T2 (Populus euphratica:slag =2: 1) and T5 (Populus euphratica: vermiculite= 1: 1), had the best seedling growth effect and were superior to CK. Therefore, the composting substrate of Populus euphratica leaves is feasible for cucumber seedling. Key words: Populus euphratica leaves retting substrate,Cucumber seedling,Seedling index.

139

NOTE

Rhizosphere arbuscular mycorrhizal fungal communities of tomato and potato-onion in monocropping and intercropping systems show a different response to P fertilizer inputs Danmei Gao1，Xinjie Pan1，Xingang Zhou1，Naihui Li1，Fengzhi Wu1 (1 Northeast Agricultural University) Abstract: Arbuscular mycorrhizal fungi (AMF) play key roles in supporting ecosystem sustainability, stability and function. AMF community responses to either fertilization or host plants have been investigated. However, the interactive effects of fertilizer inputs and host plants from different cropping systems on rhizosphere AMF community are little explored. In this study, tomato and potato-onion rhizosphere AMF community abundances and compositions in inter- and mono-cropping systems along an experimental fertilization gradient were analyzed by quantitative PCR and Illumina MiSeq sequencing, respectively. P fertilization increased rhizosphere Olsen P content but intercropping decreased that in both tomato and potato-onion rhizosphere except in tomato when no P fertilization was applied. Percentage AMF colonization decreased in both tomato and potato-onion roots with increases in P fertilization. P fertilization decreased tomato and potato-onion rhizosphere AMF abundances, intercropping increased AMF abundance in tomato rhizosphere but decreased that in potato-onion rhizosphere. Intercropping decreased AMF diversity in tomato rhizosphere at P < 60 mg kg-1 while increased that diversity at P > 60 mg kg-1. There was an opposing trend in AMF diversity in potato-onion rhizosphere. Taxonomic analysis showed that Glomerales, paraglomerales and Diversisporales were the dominant orders in both tomato and potato-onion rhizosphere and their relative abundances were changed differently by P fertilization and cropping systems. AMF community composition was significantly structured by P fertilization in tomato rhizosphere while by cropping system in potato-onion rhizosphere. Overall, our results found that responses of contrasting rhizosphere arbuscular mycorrhizal fungal communities from different host plants in inter - and mono -cropping systems to P fertilization were distinctly different. Key words: Arbuscular mycorrhizal fungi, Community diversity, Cropping system, Fertilization, Solanum lycopersicum, Allium cepa var. aggregatum Don.

140

NOTE

A single complex locus is responsible for the production of multiple flavour-related monoterpenes in ripe kiwifruit Yunliu ZENG1，Adam J. Matich2，Mindy Y. Wang3，Peter A. McAtee3，Denise C. Hunter3，Sara R. Jaeger3，Niels Nieuwenhuizen3，Xiuyin Chen3，Yar-Khing Yauk3， Ross G. Atkinson3 (1Huazhong Agricultural University, Wuhan 430070, China. 2PFR, Palmerston North, New Zealand. 3The New Zealand Institute for Plant and Food Research Ltd (PFR), Private Bag 92169, Auckland, New Zealand) Abstract: Terpene volatiles are important flavour compounds in many fruit including citrus, grape and strawberry. In some kiwifruit varieties, the monoterpene 1,8-cineole has been suggested to be a key flavour compound. Here we demonstrate using sensory analysis that 1,8-cineole contributes a characteristic mint. To understand the genetics of 1,8-cineole production, a segregating population was screened by Fast-GC. Two QTL for 1,8-cineole production were identified on linkage groups (LG) 28 and 29 in the ‘Red5’ kiwifruit genome. Several terpene synthase (TPS) loci were identified in the genome and the 1,8-cineole QTL on LG29 co-located with a complex cluster of putative TPS genes. Transient expression in Nicotiana benthamiana and analysis of recombinant proteins expressed in E. coli showed that four genes in the cluster (AcTPS1a-d) encoded functional TPS enzymes producing nerol, 1,8-cineole, sabinene, and an unknown sesquiterpene respectively. The expression of AcTPS1b and AcTPS1c correlated with accumulation of 1,8-cineole and sabinene during fruit ripening. Transient over-expression of AcTPS1b in A. eriantha fruit confirmed this gene produced 1,8-cineole in Actinidia. Structural analysis showed that AcTPS1b and AcTPS1c are natural variants at key TPS catalytic site residues previously shown to change enzyme specificity in vitro. Our results demonstrate how variation at a single locus can produce a wide diversity of terpene products in planta. Key words: cineole, eucalyptol, flavour, kiwifruit, ripening, volatiles

141

NOTE

Genetic Diversity and Relationships Among Chinese Loquat （Eriobotrya japonica）Accessions Assessed by SSR Markers Developed from Transcriptome Sequencing Mingming Wang College of Horticulture and Landscape Architecture, Southwest University, Chongqing, China Abstract: Genetic diversity and relationships among 74 loquat accessions were assessed using the simple sequence repeats (SSRs) developed from transcriptome sequencing. A total of 14,146 SSR markers were mined from 11,998 sequences screening of 90,752 nonredundant transcriptome unigenes in loquat (Eriobotrya japonica) representing a total size of 77,021,222.4bp. Dinucleotides and trinucleotides repeat SSRs were dominant, accounting for 55.56% and 24.77% of the total, respectively. The most abundant dinucleotides and trinucleotides motifs were AG/CT and AAG/CTT with frequencies of 85.99% and 24.34%, respectively. Based on these SSR sequences, a total of 240 primers were screened in the loquat samples, and the results showed that 175 primers exhibited amplification, of which 36 were polymorphic. A total of 88 alleles were amplified in the population studied with the mean value of 2.44 alleles per locus, while the number of alleles per locus ranged from 2 to 6. The polymorphic information Content (PIC) ranged from 0.01 to 0.70, indicated a moderate degree of polymorphism with an average value of 0.33. Cluster dendrogram sorting these accessions into three groups, of which group A mainly comprised of white-flesh accessions of Fujian and Zhejiang province, and group B mainly consisted of red-flesh accessions of ‘Jinfeng’ from Luzhou city in Sichuan province, and group C contained most red-flesh ones from Chengdu city in Sichuan province, showed a distinct separation among these accessions. These results were consistent with their geographical locations and fruit characteristics. The dendrogram also indicated that some triploids of these accessions generally shared pretty close relationships with their female diploids. This study confirms that it is feasible for SSR markers which developed from transcriptome sequencing to evaluate genetic diversity and relationships of loquat accessions. The polymorphic markers make them a suitable tool for identification of genetic linkage map construction, dominant characteristics locus exploration, molecular marker-assisted breeding and evolutionary evaluation of triploid loquat in further studies. Keywords: Eriobotrya japonica; SSR markers; Transcriptome sequencing; Genetic diversity and relationships

142

NOTE

Effect of Elevated CO2 Concentration on Physicochemical Properties of Soil Planted Lycium barbarum Rong Ha, Yaping Ma，Bing Can (Ningxia University, China) Abstract: The impact of climate change on plant physiology is one of the hotspots of current academic research. It is believed that one of the remarkable features of global climate change is the greenhouse effect, which caused by the increased concentration of greenhouse gases such as CO2. The CO2 concentrations ([CO2]) gradually increased in the past 150 years, and reached 400 μmol●mol-1 by 2016. It is predicted that the atmosphere [CO2] will reach 720~760 μmol●mol-1 by the end of the 21st century. It has received attention on the effect of elevated [CO2] on plant growth, fruit quality, and physicochemical properties of cultivated soil. Therefore, this research simulated and controlled [CO2] through open top chamber(OTC), and use the sensor induced CO2 concentration. CO2 supplied by CO2 cylinder, and controlled by electromagnetic valve. The chambers installed self-developed OTC automatic control system. Ventilation from 8:00 to 20:00 per day to simulate the climate change environment of [CO2] elevation. The experiment had three concentration levels: normal atmospheric concentration (CK) is 380±20 μmol●mol-1, the concentration of after 0.5 times increase (TR1) is 570±20 μmol●mol-1and the concentration of after 1 times increase (TR2) is 760±20 μmol●mol-1. Each treatment was repeated three times, with a total of nine air chambers. Each chamber planted the same species of Lycium barbarum, and the cultivation and management methods were consistent. To determine the changes of NPK contents under different [CO2] conditions in the soils of planting Lycium barbarum, and to study the effect of elevated atmospheric CO2 on physicochemical properties of planted soil. The results showed: (1) Elevated [CO2] can effectively increase the content of N in the soil. The total N content of treatment was 0.48 g/kg and 0.45 g/kg respectively, compared with CK, significantly increased 12.5% and 20%; The available N increased 9.35% and 6.07%, but there was no significant difference. (2) Long-term high [CO2] treatment significantly reduced the content of available K and P in soil and decreased with the increase of [CO2]. The content of available K about two treatments was 254.19 mg/kg and 241.01 mg/kg, which was 4.93% and 9.86% lower than CK, and the available P of two treatments was decreased 18.02% and 23.56% than CK. (3) The content of soil organic matter increased slightly compared with CK, TR1 and TR2 respectively increased 4.15% and 13.47%, but the difference was not significant; It has little impact of elevated [CO2] on soil pH, ranging from 7.7 to 7.9; the content of soil soluble salts showed that the treatment was higher than CK, with an increase of 9.23% and 27.42%.In conclusion, the physicochemical properties of soli which planted Lycium barbarum have a certain response to the elevation of [CO2], which is beneficial to increase the content of C, N and soluble salts in the soil. Keywords: elevate CO2 concentration,soil,physicochemical properties,planted Lycium barbarum

143

NOTE

Storability and Shipping Potential of Modified Atmosphere Packed ‘Samar Bahisht Chaunsa’ Mangoes at two different Storage Temperatures Sana shabbir1，Faisal Hayat2，Hafiz Umer Javed1，Aman Ullah Malik3，Muhammad Nawaz Khan 4 (1College of Food science and nutritional engineering, 2College of Horticulture, 3Institute

of Horticultural Sciences, 4 Citrus research institute)

Abstract: Modified atmosphere packaging (MAP) technology is gaining popularity worldwide for its potential of extending shelf life of fresh produce with better fruit quality. The current study was conducted to evaluate the influence of Modified Atmosphere packaging (MAP) on storability and shipping potential of ‘Samar Bahisht Chaunsa’ mangoes at two different storage temperatures. The physiologically uniform mature fruits were harvested from a commercial orchard. After harvesting, fruit were physically de-sapped and subjected to prochloraz (0.5ml/L) dip followed by air drying, packaging and transport to PRTC in a reefer van at 18°C. The mangoes fruit were divided into two lots followed by packaging in MAP bagged (Fresh ‘n’ Smart® type of MAP bags) and un-bagged (control). These packed fruits were stored at two different storage temperature (12oC and 17oC; 85-90% RH) for four 8, 18, 25 and 30 days storage. The Color development was greater in un-bagged fruits kept at 17°C during ripening stage, while as concerned with chilling injury; more symptoms of discoloration were observed at 12°C as compared to 17°C. Fruit weight loss and skin shriveling was significantly different regarding to packaging, storage temperatures and storage periods. Similarly, un-bagged fruits had more lenticels and sap index than bagged. At 17°C and in un-bagged fruits, weight loss was higher, while minimum weight loss was observed at 12°C in MAP bagged fruits. As regards the MAP environment, a consistent increase in CO2 was observed at both temperatures and was higher on 18th day of storage (18% at 12°C and 25% at 17°C). At both temperatures (12°C & 17°C), the taste was significantly better in the fruit that removed after 8 days of cold storage; where the non-MAP bagged mangoes had better taste as compared to MAP bagged at 12°C and vice versa in case of 17°C. At both temperatures, the taste score was significantly decreased after 18 days storage period. Further studies are needed to explore optimal MAP bagging type, understand the physiological changes in S.B. Chaunsa and rectify the issue of poor skin color development and off-flavor production. Key words: Mango, shelf life, respiration, storage temperature, shipping potential

144

NOTE

Genome Duplication Improves the Resistance of Watermelon Root to Salt Stress Hongju Zhu，Wenge Liu (Zhengzhou Fruit Research Insititute, CAAS) Abstract: Salinity is a major abiotic stress factor that affects crop productivity.

Roots play an important role in salt stress in plants. Watermelon is a salt-sensitive crop; however, tetraploid watermelon seedlings are more tolerant to salt stress than their homogenotype diploid ancestors. To obtain insights into the reasons underlying the differences in salt tolerance with respect to the ploidy of plants, self-grafted and cross-grafted diploid and tetraploid watermelon seedlings were exposed to 300 mM NaCl for 8 days. After the treatment, the tetraploid rootstock-grafted watermelon plants showed higher salt stress tolerance than the diploid plants. There were no significant differences in the dry weight and physiological effects between the rootstocks with the same ploidy. The tetraploid rootstock-grafted watermelon plants exhibited higher leaves and root dry weight, net photosynthetic rate, leaf stomatal conductance and transpiration rate than the diploid rootstock-grafted watermelon plants throughout the salt treatment process. The activities of antioxidant enzymes and contents of osmoregulatory compounds in the roots were higher in the tetraploid rootstock-grafted watermelon plants than in the diploid plants during the entire salt response process. Similar K+ and Na+ concentrations were detected in the same rootstock plants, and K+ was preferentially accumulated in the aerial parts than in the roots. The stems exhibited the highest K+ concentrations, followed by leaves and roots. The K+ concentrations in the diploid rootstock-grafted watermelon seedlings were lower than in the tetraploid rootstock-grafted plants. Taken together, our results suggest that genome duplication improves the resistance of tetraploid watermelon root to salt stress. Key words: tetraploid, watermelon, graft, salt stress, K+ flux, root

145

NOTE

Identification of Ploidy of Hybrid Progeny and Meiosis Observation in Natural Tetraploid Loquat Senlin Liang，Jiangbo Dang, Qigao Guo，Guolu Liang.

(College of Horticulture and Landscape Architecture,Southwest Univesity) Abstract: Tetraploid is an important resource in loquat and could be used to create a large number of triploid seedless loquat. The abnormality of meiosis and the genetic rule of hybrid ploidy were preliminarily researched by the observation of meiosis and the ploidy identification of hybrids，which lay the foundation for the use of tetraploid loquat to create new materials. In this study，the ploidy of ‘B431’was determined by flow cytometry and chromosome production. The meiotic process of Pollen Mother Cells (PMCs) of‘B431’was observed by modified smear method，and the chromosome numbers of hybrid progenies were counted by chromosome production.The cross parents had diployid（‘XingNingYiHao’，‘HuaBaiYiHao’），triployid（‘H324’）and tetraploid（‘B431’）.The cross combination included diployid × triployid，tetraploid × diployid，tetraploid × triployid and tetraploid×tetraploid. Cross-pollination was conducted in the fall of the year and seeds were collected in May of the following year. Root tips were used to chromosome count after seed germinated. The results showed that ‘B431’ was tetraploid loquat（2n=4x=68）and had abnormal chromosome behavior during meiosis，such as out-of-plate chromosomes，precocious chromosomes，laggard chromosomes，chromosome bridges，micronuclei，and few triodes. The chromosome associations at the diakinesis were mainly bivalents and reached 55.54%. Moreover， there were a small quantity of univalents and patitial multivalents.There were dyads， triads，polyads and micronuclei in the tetrad. Diploid loquat had normal chromosome behavior during meiosis and‘B431’could be autotetraploid. The ploidy of hybrids included not only diploids，triploids，tetraploids，pentaploids and hexaploids，but also a small amount of aneuploid plant which somatic chromosomes between 35 to 101. These hybrids of pentaploid，hexaploid and autotetraploid could be used as new resources in loquat. Key words: Tetraploid of loquat；triploidy；meiosis；hybrid；ploidy.

146

NOTE

The identification of anthracnose-resistant loquat cultivars and development of Real-time PCR for rapid detection of Colletotrichum gloeosporioides Ting Yuan，Ting Liu, Di Wu，Guolu Liang College of Horticulture and Landscape Architecture, Southwest University, Chongqing, China Abstract: Anthracnose caused by Colletotrichum gloeosporioides is one of the major fungal diseases of loquat, which can infect leaves, fruits and seedlings. The current method used for screening resistance genotypes is investigation under field conditions, but it tends to cause higher experimental errors. Resistance breeding is one of the best and environmentally-friendly strategies to manage the anthrax. Accurate assessment of resistance is the key to the identification of candidate resistance genes. Here, we evaluated the resistance to loquat anthracnose of leaves from 32 loquat cultivars and fruit from 27 oquat cultivars. Through field investigation and indoor inoculation, the size of lesions was measured by the cross-cutting method. The results showed that there was a great difference among different varieties. In regard of leaves, there were 6 resistant, 8 moderately resistant and 17 susceptible varieties, accounting for 18.75 %, 25.00 % and 53.13 %, respectively. Varieties like 'Changlv 2', 'pll', 'Jinfeng' and 'Danyou 1' displayed higher resistance in leaves and the disease indexes were 4 %, 2 %, 2 % and 4 %. In regard of fruit, there were 1 resistant variety, 6 moderately resistant and 20 susceptible varieties, making up 3.70 %, 22.22 % and 74.07 %, respectively. The variety "Dayangwanbai" displayed higher resistance in fruit, whose disease index was 5 %. In addition, we established an effective and rapid quantitative system by using specific primer and the SYBR Green dye with real-time PCR technology. The primer CgF8/ITS4( CTACTTAGTGTTGGGGCCCTACAGC/TCCTCCGCTTATTGATATGC ) was targeted at the ITS region, which could generate a 202 bp amplicon. That the melt curve showed a single dissociation peak at the same temperature proved its specificity. The amplification efficiency of the quantitative detection system was 110.3%. The minimal amount of Colletotrichum gloeosporioides DNA quantified was 435.8 fg/μl, which was 103 times that of ordinary PCR and It's sensitive enough to detect the pathogen in the loquat issues. This new quantification PCR assay is sensitive enough to detect the pathogen in the loquat issues, and it’s also reliable and reproducible regarding the results. It can accurately detect and quantify the pathogen. In the follow-up experiments, we will carry out quantitative tests on the pathogenic bacteria of leaves and fruit with different levels of resistance at different inoculation times in order to explore the relationship between the resistance to loquat anthracnose and the amount of pathogenic bacteria in the loquat issues. Key words: Loquat, Anthracnose, Disease resistance, Real-time PCR

147

NOTE

A comparative proteomic study on the differentiation of amyloplast into chromoplast in yellow flesh kiwifruit Jiajia Lin1, Yunliu Zeng1

(1 HuaZhong Agricultural University.) Abstract: Starch degradation is accompanied by softening process, following by the formation of fruit flavor in kiwifruit. The sugar have seen as a signal to trigger fruit ripening and softening. However, the mechanisms underlying starch degradation and fruit ripen is still unclean in kiwifruit. In the study, we analyzed the degradation of starch in yellow-fleshed kiwifruits based on comparative proteomics analysis. Firstly, typical amyloplast-to-chromoplast differentiation was found in yellow-fleshed kiwifruit. This process was induced by ethylene and inhibited by 1-MCP. Secondly, we develop a new method to highly purify the amyloplasts and chromoplasts during starch degradation by gradient centrifugation. The results showed that the starch within kiwifruit flesh is similar to that in potato, but quite different from rice and wheat. Thirdly, the comparative proteomic analysis showed that a- and b-amylases are involved in plastid differentiation and is positively correlated with starch degradation and flavor formation. Taken together, this study provided an insight of amyloplast differentiation and flavor formation in yellow-fleshed kiwifruit.

Key words: kiwifruit; starch degradation; plastid differentiation; amylase.

148

NOTE

Synthetic Strigolactone Analog GR24 affects seedling growth and modifies abiotic stresses in cucumber Ren Huazhong China Agriculture University Abstract: Plant hormones are known to play important roles in plant growth and development as well as guard plants from biotic and abiotic stresses. In this study we examined the effect of strigolactone (SL) on cucumber germination and seedling growth as well as abiotic stresses caused by drought, salinity and chilling using varying concentrations of the synthetic analogue GR24. Results indicated that SL did not significantly affect germination. However, plants treated with higher concentrations of strigolactones affected seedling performance in a dose dependent manner with respect to radicle growth, primary root length, lateral root length and number of lateral roots. Under Drought, salinity and chilling conditions, plants treated with higher concentrations of strigolactones displayed higher survival 85% and above in plants treated with 5, 10 and 2µM whereas untreated plants had lower survival (12%) under salt stress, (20%) drought stress and (10%) in chilling stress. Overall results demonstrated that exogenous application of GR24 affects growth and development of young cucumber at high concentrations, however when applied under abiotic stress plants treated with higher concentrations of exogenous strigolactones demonstrated superior survival in Cucumis sativus L. Keywords: Strigolactones, abiotic stress, Cucumis sativus L., plant hormones

149

NOTE

A soluble inorganic pyrophosphatase interact with the bZIP transcription factor repressing the pectin methylesterification in growing pollen tubes in vitro Chao Tang, Juyou Wu, Shaoling Zhang (Centre of Pear Engineering Technology Research, State Key Laboratory of Crop Genetics and Germplasm Enhancement, College of Horticulture, Nanjing Agricultural University) Abstract: During the pollen tube growth of many species, soluble inorganic pyrophosphatase (sPPase, EC 3.6.1.1) plays a role in hydrolyzing inorganic pyrophosphate (PPi) and turning it into two inorganic phosphates (Pi). However, little is known about soluble inorganic pyrophosphatase in pear pollen tube. Here, we characterized a pear soluble inorganic pyrophosphatase (PbrPPa) that showed decreased expression level in the S-RNase-based self-incompatibility (SI). Silencing of PbrPPa expression led to low methylesterified pectin and increased cellulose levels in pollen tube growth. Through screening a pear pollen cDNA library, we identified one protein interaction partner: a bZIP transcription factor (PbrbZIP). Silencing of PbrbZIP expression also led to low methylesterified pectin and increased cellulose levels in pollen tube growth. This finding indicated that the two proteins acted in the same functional context. The interaction of PbrPPA and PbrbZIP in the nucleus was confirmed by bimolecular fluorescence complementation (BiFC) studies. Whereas PbrPPA-GFP has been found to be localized in the cytosol, PbrbZIP resides in the nucleus. Nevertheless co-localization with PbrbZIP resulted in the accumulation of PbrPPA-GFP in the nucleus. PbrbZIP could specifically bind to the ABRE-like motif in the promoters of two pear pectin methylesterase (PbrPME1 and PbrPME2). The repression activity of PbrbZIP to PbrPME1/2 gene expression is directly regulated by PbrPPA. Therefore, we proposed a mechanism in which the nuclear accumulation of PbrPPA regulated PbrbZIP-mediated transcription of PbrPME1 and PbrPME2 during pollen tube growth, affected by protein-protein interaction. Key words: "soluble inorganic pyrophosphatase""bZIP""pectin methylesterification"

150

NOTE

EFFECT OF BIO-FERTILIZER AND MINERAL FERTILIZERS ON GRAPEVINE (VITIS VINIFERA L.CV, MUSCAT HAMBURG) IN SUNLIGHT GREEN HOUSE CONDITION Niesong Qing1, Su Hong2, Shufen Tian3 (1College of Horticulture and Landscape, Hunan Agricultural University, Changsha, China, 2Research Centre for Grapes,Tianjin Academy of Aguricutural Sciences, Tianjin, China, 3Tianjin Facility Agriculture Research Institute) Abstract: The excessive use of mineral fertilizers and unbalanced application of nitrogen, phosphorus and potassium were common in protected cultivation, which leading to some serious problems, such as decline in the quality of the ecological environment, decrease yield and quality of the fruit. In the present study the effect of different proportion of mineral fertilizers with microbial bio-ferilizer (Streptomyces saraceticus, containing 164g/L free amino acid, soluble liquid fertilizer) were tested on five years old Muscat hamburg grapevine in sunlight green house under drip irrigation system. Soil microbiological activity, optimization of growth and fruit quality comparing with the traditional fertilization (100% mineral fertilizers) were evaluated. The concentration of microbial bio-ferilizer based on preliminary experiments 1%, 0.8%, 0.6%, 0.4%, 0.2% were applied in annual cutting seedlings (Muscat hamburg), 0.4% microbial bio-ferilizer gave the better result, and which was used for combined treatments with mineral fertilizers (N:P2O5:K2O=22:8:15). The treatments were 100% of recommended mineral fertilizers dose without bio-ferilizer (control) and 100%(T1), 75%(T2), 50%(T3) and 25%(T4) of traditional recommended mineral fertilizers dose plus bio-ferilizer.The results indicated that the total number of bacteria increases in comparison with the control, when Biofertilizer was added to traditional mineral fertilizers, the population of potassium-solubilizing bacteria was more numerous than control alone. Application of T1 and T2 was generally better than T3 and T4. Bio-fertilizer significantly increased yield parameters and fruit quality. CK, T1 and T2 treatments recorded the highest fruit weight and spike weight. At the same time, T2 recorded the highest average branch thick; moreover, it significantly improved TSS %, acidity % of fruit juice . Also, T2 improved Vc content and decreased tannins % of fruit juice without significant difference in comparison with control. Summarizing the entire investigation one can conclude that 0.4% microbial bio-fertilizer applied with 75% recommended mineral fertilizers was very effective in promoting physiological parameters. Keywords: Grapevine; Bio-fertilizers; Streptomyces saraceticus; Mineral fertilizers

151

NOTE

Effects of organic nutrient solution on Fruit Development and Quality of litchi Qin Chan-chan, Deng Ying-yi, Wang Hui, Qu Xiao, Pan Jie-chun, Xu Jiong-zhi, Mo Yun-chuan, Cheng Xi-ran (Guangxi University of Agriculture). Abstract: In this experiment, litchi of "Qinzhouhongli" was used as the research object. In the period of fruit growth and development, the litchi tree was sprayed by 500, 1000 and 1500 times the organic nutrient solution. The effects of different concentrations of organic nutrient solution on the single fruit weight, vertical and the horizontal diameter, fruit shape index, edible rate, soluble solid and amino acid content of litchi fruit pulp were studied with water as control (CK). The results showed that in the growth and development stage of litchi fruit, the organic nutrient solution with 500-1500 times dilution concentration had a significant effect on the growth of the vertical and the horizontal diameter of litchi fruit, and 1000 times the dilution of the litchi fruit was the most significant effect on the growth of litchi fruit. The growth and development of litchi fruit with different concentrations of organic nutrient solution basically showed a S curve. The 1500 times the maximum growth rate of the cross diameter and longitudinal diameter of the litchi fruit was from May 12th to May 15th, and the maximum growth rate of the 1000 and 500 times the control was from May 15th to May 24th, and the maximum length of the longitudinal diameter was from May 7th to May 15th.There was no significant effect on the fruit shape index of Litchi in the same period of different stages of fruit growth and development. The fruit shape index of each treatment fruit decreased gradually during the growth and development of fruit, and the growth of the cross diameter of litchi fruit was faster than that of longitudinal diameter from May 7th to June 12th.The organic nutrient solution with 500-1500 times dilution can significantly increase the single fruit weight, fruit size, soluble solids content, edible rate, total amino acid content of pulp, essential amino acid content, semi essential amino acid content and aspartate, glycine, serine, proline and C in non essential amino acids. However, the contents of alanine and lysine were not significantly different from those of control. Key words: organic nutrient solution, litchi ,fruit growth and development , quality

152

NOTE

Growth and respiratory metabolism adaptation mechanism of Distylium chinense during and after complete submergence Xiaoling Li, Gong Cheng, Ran Hao Wen (China Three Gorges University (CTGU)) Abstract: Distylium chinense (Fr.) Diels is an evergreen perennial shrub belonging to the genus Distylium of the Hamamelidacea. D. chinense is widely cultivated for it is an attractive ornamental tree that is found in gardens, along greenbelts and road sides and it is known for its beautiful and interesting flowers. Furthermore, D. chinense is also ideal for stabilizing solid earth embankments due to its robust root system, erosion tolerance, flood tolerance and resistance to burial in wet sand. D. chinense has a strong submergence tolerance, but the biological mechanism is not clearly defined. Grow characteristics and respiratory metabolism for the tolerance of D. chinense to long-term flooding were investigated through determining and analyzing the changes in root starch and soluble sugar as well as the contents of anaerobic respiration enzymes, including lactic dehydrogenase (LDH), ethanol dehydrogenase (ADH) and pyruvate decarboxylase (PDC)), in the D. chinense seedling. In the controlled experiments, the survival of all the seedlings under 30-d and 60-d complete submergence treatments almost reached 100% but fell to 67.5% and 47.5 % under the 90-d and 120-d complete submergence treatment, respectively. The 30- and 60-d submerged seedlings showed faster and stronger recovery than the 90- and 120-d submerged seedlings for the relative growth rate (RGR) of epicormic shoots, main stems and new leaves after de-submergence. The recovery patterns of carbohydrate (starch and soluble sugars) concentrations of roots, stems and leaves coincided with those of the full recovery of the number of epicormic shoots, main stem and new leaves and dry mass accumulation. The survival of seedlings was positively correlated with carbohydrate concentrations and dry mass accumulation. The results also showed that the contents of the anaerobic respiration enzymes in the roots and leaves of D. chinense seedling were increasing with the prolonged flooding duration, which indicated the roots and leaves adapt to long-term flooding by reinforcing their anaerobic respiration and activities of ADH that were higher than LDH for roots and leaves used in alcoholic fermentation mainly. The activities of anaerobic respiration enzymes in leaves were higher than that in roots, while leaves were more sensitive to flooding. The starch and soluble sugar in roots and leaves had similar trends with anaerobic respiration enzymes. However, roots starch was higher than leaves where soluble sugar was lower than roots. The higher content of starch were the important reason of strong submergence tolerance, and we consider it is “quiescence” strategy to adapt long-term complete submergence. This study provided the experimental support for the hypothesis that carbohydrate allocation to storage in roots and the adaptation of anaerobic respiratory metabolism enhances tolerance of D. chinense to complete submergence, which may be one of effective adaptation strategies of submergence tolerance. Therefore, D. chinense could be considered to be as native pioneer tree species in the re-vegetation in the WLFZ and the other similar degenerative riparian area and stream ecosystem. Key words: Distylium chinense, respiratory metabolism adaptation, complete submergence

153

NOTE

Effects of Different Fertilization Treatments on Fruit Yield and Quality of Citrus grandis var: Longanyou Rongfei Li, Chujuan Gan, Yaodong Chang, Qigao Guo, Guolu Liang (Southwest University) Abstract: In order to ascertain the effects of different fertilization treatments on the yield and quality of longanyou, 12-year-old longanyou was used as an experimental tree species to determine the fruit yield, fruit extrinsic and intrinsic quality of Longanyou and Correlation analysis between fruit color and intrinsic quality.The treatments were as follows: treatment 1 (T1: nitrogen 315 kg, phosphorus 173.25kg, potassium 306 kg and organic matter 1575 kg were used per hectare), treatment 2 (T2: nitrogen 450 kg, phosphorus 247.5 kg, potassium 438 kg and organic matter 2250 kg were used in per hectare), treatment 3 (T3: all applied organic fertilizer, 3000 kg in per hectare), treatment 4 (T4: total soluble fertilizer was reduced with fertilization times increasing, nitrogen 202.8 kg, phosphorus 252.3 kg and potassium 268.95 kg were used in per hectare), and control (CK: the trees that abandoned by farmers in the production). The results showed that:(1)In 2017, the yield per plant of T1, T2, and T3 increased compared to 2016, while T4 decreased by 30.38% .and T2 yield per plant was the highest in two years.(2)According to the color index analysis, the effects of fertilization treatment on pericarp color was not remarkable, but it remarkably affected the extrinsic qualities,such as the color of the pulp. The flesh color which were treated with fertilization is orange-red, the color of T2 is darker than the others, and the pulp color of CK is yellow-green. The fertilization had a prominent effect on the peel, sac and fruit firmness.(3)Fertilization treatment was beneficial to improve the intrinsic quality of fruit, the content of invert sugar, total sugar, sugar-acid ratio and Vc were the highest in the upper layer fruit of T2,while the soluble solids and the ratio of soluble solid and titratable acid in T3 were the highest, and the titratable acid content of both treatments was lower than CK.(4)The correlation analysis of the fruit color and fruit quality showed that if the fruit sugar content is higher, with the color of the fruit is brighter.The Conclusion expressed that the contents of sugar and soluble solids in T2 and T3 were the highest, so the fertilization treatments of T2 and T3 were the most suitable methods for the growth of Longanyou. Key words: Citrus grandis var. Longanyou, fertilization, fruit yield, internal quality, the color of fruit

154

NOTE

Transcriptome analysis and physiological response of radish under high temperature stress Zhuang Yang, Zhiwei Wang Institute of Tropical Agriculture and Forestry, Hainan University Abstract: Radish (Raphanus sativus L.), also known as Laifu, is a major annual or biennial root vegetable crop of Brassicaceae family. It is not only a kind of vegetable but also used for medicine. There are many varieties of radish and large cultivated area in China, but there are only a few heat resistant radish varieties in practical production, which greatly restricts the planting range of radish and the supply of radish in summer, so it can not meet the demand for radish by the vast majority of consumers. Therefore, studying on the response mechanism of radish under heat stress and breeding heat-tolerant plant cultivar are of great significance. Two radish varieties with different heat tolerance were selected to cultivate their seedlings in artificial climate incubator at 40℃ high temperature. After heat treatment of 0h, 6h and 12h, mRNA of the young leaves were sequenced, and the difference of gene expression between the two varieties with different heat tolerance under high temperature stress was compared and analyzed, and the functional genes related to high temperature resistance of radish were found. The results show that there are more differential expressed genes of both these two radish varieties during the first 6 hours than the next 6 hours. At the same time, the changes of superoxide dismutase (SOD), peroxidase (POD), malondialdehyde (MDA), free proline, chlorophyll, soluble protein and soluble sugar content of the young leaves of two varieties after heat treated for 0h, 6h, 12h, 1d, 3d, 5d and recovery treated for 1d and 3d were gained and analysed to explore the relationship between them and the heat-resistance of radish. This data set will aid in understanding how radish responds to high temperature stress and do a great favor to cultivate radish varieties that resist heat. Keywords: Radish (Raphanus sativus L.), Heat stress, Transcriptome analysis, Physiological response

155

NOTE

Regeneration capability study of Lilium brownii var. giganteum Lin Zhang, Yue Li, Yun Wu, Ruihan Min, Minyi Sun, Yiping Xia (Department of Horticulture, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou, China) Abstract: Lily is the second most popular bulbous flower around the world. L. brownii var. giganteum (LBG) is a natural variant of L.brownii (LB) which distributed exclusively to eastern sea islands of China, with a preponderant trait in bulb size and bulb scale numbers compared to its wild ancestor in natural habitat. Considering a relative long juvenile period from seeds and also to preserve desirable traits, bulb propagation has long been dominant in industry for Lilium spp. However, propagation rate remains relative low and implementing genetic resources from wild germplasm is being used widely in modern lily breeding. As LBG exhibits advantageous trait in bulb, we propose it as a potential new germplasm for studying bulb vegetative propagation in this economically important bulbous flower. Comprehensive high efficient regeneration system in vitro for bulblet and/or somatic embryos induction from various explants were first established as an endeavor to protect and conserve this rare germplasm, which also adds information to relative sporadic reports on micropropagation of LB or its variants. To compare with its natural ancestor and shed light on mechanism underneath its natural merit, comparison of regeneration capability to induce both bulblet (adventitious bud) and embryogenic callus were conducted for the two genotypes collected from the same habitat with Lilium Oriental Hybrid ‘Sorbonne’ (one of major cut lily cultivars) as a control. To eliminate the difference among the wild collected explants, regenerated bulblets in vitro of the same size were used. In addition, the first transcriptome dataset for in vitro bulblet of LBG was established. Starch and sucrose metabolism were found to among top hits via annotation, consistent with most starch granules found in scales of LBG via histological investigation. This dataset can be used to find novel transcripts, develop markers and serve as a starting point for molecular investigation of LBG. To the best of our knowledge, it is the first one for bulbs of LB variant species as there is only one sequence record from leaf tissue of LB so far. The current study provided comprehensive protocols for embryogenic callus and bulblet induction for this rare germplasm, conducted comparison with its natural ancestor, trying to explain its natural merit, which will further our understanding of regeneration capability of this economically important bulbous flower and bulbous plant in general. Key words: Lilium spp., regeneration, in vitro organogenesis, rare germplasm, expression analysis

156

NOTE

PGSD, the Plant Genome Sequencing Database for comparative and functional genomic analyses Xiaoming Song, Qihang Yang, Kanglu Zhao (North China University of Science and Technology) Abstract: In the last 20 years, the whole genome of more and more species have been completed, since the first genome of the model plant Arabidopsis thaliana published in the Nature journal in 2000. As of May 10, 2018, the genomes of 245 plant species have been completely sequenced according to our collection and statistics. These released genomes provide the rich resources for the comparative and functional genomics in the plants. The rapid development of sequencing technology has greatly promoted genome sequencing, from the first generation of Sanger technology to the second generation sequencing technologies, such as 454, Illumina, and SOLiD, to the now widely used third generation of sequencing PacBio technology. Generally, a released new genome will contain the genome assembly, gene numbers, gene annotation, repeats, WGD/T events, over and under-represented gene families, evolution analyses, expression pattern, and regulation networks of novel biology related with some species. In addition, genome re-sequencing is often found in some plant genomes project, which will help to reveal the roles of millions of SNPs. These markers will assist for breeding, and provided glimpses into functional genes, plant evolutionary history, and complex polyploid events. To make better use of these genomic data, we collected the genome sequencing information of these 245 plants. Here, the genomic information of these species was systematically analyzed, including species classification, genome size, gene number, chromosomes number, Scaffold N50, Sequencer types, published year and journal. Furthermore, we also construct the Plant Genome Sequencing Database (PGSD), which contain all the above mentioned information for each of 245 species. In addition, we also provide the references links and species database links for easy browsing and PDF for directly download. Moreover, the CDSs and protein sequences for these species can also be downloaded directly from our website. We believe that this website will greatly facilitate users to query, download and use these genomic data. The website will also continue to be updated and provide rich data resources for comparative genomics and functional genomics research in future. Key words: PGSD, Plant genome, Database

157

NOTE

Growth characteristics for 18 Rhododendron imported cultivars in Central Yunnan Ting Chen, Feng Shi Li, Ping Su Qu, Xing Qian, Jie Liu, Jia Wei Xie Flower Research Institute, Yunnan Academy of Agricultural Sciences Abstract: In order to select the suitable Rhododendron cultivars in the Central Yunnan region, the plant height and width, the branches' numbers, the foliage length and width in the branch and the truss characteristics of 18 Rhododendron imported cultivars were investigated in 2018, which were introduced from Belgium to Yunnan in 2013. The results showed that: 1) 18 Rhododendron cultivars had grown well and R. 'English roseum' had the best growth with 110 cm of plant height, 123.3 cm of plant height, and 86 of branches; 2) The foliage length and width in the branch increased quickly for the tested cultivars except R. 'Blue peter', R. 'Junifeuer', R. 'Brigitte' and R. 'Blue peter' which just had a slow increase in growth. 3) R. 'Halfdan Lem', R. 'Blue peter' and R. 'English roseum' had the better inflorescence characteristics among the 11 flowering Rhododendron cultivars. In conclusion, R. ‘English roseum’, R. 'Halfdan Lem', and R. 'Junifeuer’ the best.Rhododendron cultivars were more suitable for planting in the Central Yunnan region, which was the suitable area for planting Rhododendron. Key words: Rhododendron; imported cultivars; growth characteristics; Central Yunnan region

158

NOTE

BSA mapping for candidate genes associated with root growth angle in apple rootstocks Caixia Zheng1, Zhongxin Zhang1, Fei Shen1, Ting Wu1, Yi Wang1, Fengxue Xu1, Shanhai An2 (1Institute for Horticultural Plants, China Agricultural University; 2Shanghai Academy of Agricultural Sciences) Abstract: Root growth angle (RGA) is a substantial trait determining plant shallow or deep rooting architecture. To date, insufficient genetic information is available regarding RGA in apple (Malus domestica Borkh.). In this study, phenotypic variation in RGA of apple rootstocks was investigated using deep-rooted Baleng Crab (BC), shallow-rooted M9, and 1639 intraspecific hybrids of BC × M9 in 2015~2017. The RGA of hybrids segregated extremely between BC and M9 with an average of 23.53 which approximately equals to the mid-parental value. The frequency distribution exhibited a typical Gaussian model and the standard deviation (SD) between years was relatively low. These data indicated the additive polygenetic inheritance of RGA. The extremity bulks of deep rooting (D) and shallow rooting (S) consisted of 30 hybrids each with RGA < 15.098 and RGA > 50.49, respectively, and then bulked segregant analysis via next generation re-sequencing (BSA-seq) and BSATOS analysis strategy were used to call QTLs. In total, 25 QTLs with significant G’ values were detected, including six major QTLs, BC09.1, H14.2, M9.14.2, BC.14.2, M9.16.1, M9.17.1 . Based on the Mendelian model of variations and functional annotations, eight genes were predicted as candidate genes for RGA. The candidate genes are involved in gravitropism, light response, hydrotropism and auxin signaling. The data presented possibility for molecular assisted selection of deep rooting apple rootstocks and as well directed future work on the mechanisms of plant RGA. Key words: apple rootstocks, RGA, QTL-seq, candidate genes

159

NOTE

BSA mapping for candidate genes associated with salt/alkali tolerance in apple rootstocks Jing Liu, Zhongxin Zhang, Yi Wang,Ting Wu, Fengxue Xu, Fei Shen (China

agriculture university)

Abstract: Salt and alkali are severe abiotic stresses often limiting apple production. Molecular markers-assisted selection is the most promising approach in plant breeding programs. A total of 3258 hybrids derived from a cross between two apple rootstocks, salt and alkali tolerant Baleng Crab (BC)(Malus robusta) and salt and alkali sensitive M9 (M. pumila). For phenotyping in 2015~2017, at least nine (as three replicates) sand-cultured young plants of the hybrids from leafy cutting were drip irrigated with Hoagland’s solution with 100mM NaCl (salt), NaCO3 (alkali) treatment to pH=9.0. and both chemicals (salt and alkali) for 30 days. The severity was described as salt injury index (SID), alkali injury index (AID) and salt- alkali injury index (SAID).The SID, AID and SAID of the hybrids segregated extremely ranging 0.00~1.00, 0.00~0.94 and 0.00~1.00 with averages of 0.28, 0.38 and 0.63, respectively. which approximately equals to their mid-parental values , indicated the additive polygenetic inheritance of these traits. The standard deviation between years was relatively high. The extremity bulks of tolerant and sensitive to salt, alkali and salt-alkali consisted of 30 hybrids each with SID =0.00 , and 0.58 < SID < 1.00, 0.00 < AID < 0.19 and 0.59 < AID < 1.00, 0.00 < SAID < 0.35 and 0.91 < SAID < 1.00, respectively. QTLs were identified via generation re-sequencing based bulked segregant analysis and BSATOS analysis. For salt tolerance, three major QTLs, BC15.1, M02.1 and H16.1 were detected, while three QTLs, BC09.1, M06.1 and M16.1 were identified for alkali tolerance. Two significant major QTLs, BC16.1 and BC16.2 were associated with salt- alkali. Among these QTLs, the intervals of H16.1 for salt, M16.1for alkali and BC16.2 for salt- alkali were well overlapped. Based on the Mendelian model of variations and functional annotations, 12 genes were predicted as candidate genes from the intervals of these QTLs, including genes involved in stress response, transcription factors and epigenetic modification. The data exhibited complexity in genetic control of salt/alkali tolerance in apple rootstocks. Keywords: apple, rootstocks, salinity tolerance, alkali tolerance, QTL

160

NOTE

cDNA-AFLP analysis of transcrips induced in tomato (Solanum lycopersicum L.) by exogenous salicylic acid and calcium chloride during drought stress Xiangyang Xu, Dongye Zhang Northeast Agricultural University Abstract: Tomato is rich in nutrition, it is one of the most important fruit and vegetable crops around the world, also has an important position in China's vegetable industry. However, almost all varieties of cultivated tomato in the whole growth period are sensitive to drought resistance, especially in germination and seedling stages. Currently, the study focused on the physiology and biochemistry of tomato under drought stress, few reports on molecular biology of tomato drought. This test researched the response of plants under drought stress by regulation of salicylic acid and calcium. We research the differentially expressed genes in tomato seedlings under drought stress by cDNA-AFLP technology, and fragments were isolated and sequenced on the basis of the above analysis. We expect to elucidate the molecular mechanisms at the molecular level of salicylic acid, calcium chloride induced in growth process of tomato seedlings under drought stress. Lay the foundation for understanding the tomato drought, provide a theoretical basis for the tomato yield and quality cultivation. The main findings include: (1)According to the measurement results of physiological indicators, and combined with Observations of phenotypes, we got several key time points on drought, including 12 h, 24 h, 36 h, 2 d, 3 d, 5 d, 7 d. These time points also provide a basis for molecular test sample collection and analysis of gene expression patterns. (2)Tomato “DongNong 11537” was be treated, including normal control (CK1), drought control (CK2), the optimal concentrations of calcium chloride (C10), regular watering and spraying of the control treatment 10mmol·L-1 of CaCl2 (CKC), the optimal concentrations of salicylic acid (S0.3), regular watering and spraying control treatment (CKS) 0.3mmol·L-1 of SA . Total RNA of different time points above six kinds of samples were analyzed by cDNA-AFLP technique, used EcoR I and Mse I. Selective amplification used a total of 256 primer combinations, this study screened 213 differentially expressed transcript-derived fragments (TDFs). Final secondary amplified fragment was 106. (3)The 106 differential fragments were sequenced, and sequencing results conducted nucleotide blast and blastx on the NCBI. The number of fragments successfully recovered is 90 except the TDFs of no match. And the obtained 90 TDFs are classified, including unknown genes, transcription factors, transferring transport, genetic information processing, signal transduction. (4)Six TDFs associated with drought resistance were quantitative PCR validation, the results are consistent with the cDNA-AFLP analysis. The results of this study are reliable. While using multiple time points for analysis in real-time PCR, further accessed the detailed expression patterns of the validated gene in tomato drought response procedure. Key words: cDNA-AFLP; tomato; drought stress; salicylic acid; calcium chloride

161

NOTE

Mapping and candidate gene screening of Tomato yellow leaf curl virus resistant gene ty-5 Li Jing Fu, Liu zengbing (Northeast Agricultural University) Abstract: To identify the inheritance pattern and perform fine mapping of the ty-5 gene, P1, P2, F1, BC1 and F2 generations were obtained through a cross between ‘CLN32120a-23’ (containing the ty-5 gene, P1) and S. lycopersicum ‘Moneymaker’ (fully susceptible, P2). The results showed that resistance of the ty-5 gene was determined by a recessive effect. Meanwhile, we presumed that another resistance gene may be involved in mediating the resistance to Tomato yellow leaf curl virus (TYLCV). In this study, fine mapping was used to map the TYLCV resistance locus to an interval between NAC1 and TES2461 on the short arm of chromosome 4 with genetic distances of 0.5 cM and 0.8 cM, respectively. qRT-PCR results showed that four candidate genes, SlNAC1; LOC104229164; LOC101260925 and LOC101261508 having resistance-related expression patterns, were the likely target genes of ty-5. The relative expression level of candidate genes in CLN32120a-23 and Moneymaker was conformed by using qRT-PCR. Results showed three candidate genes: SlNAC1, LOC104229164, and LOC101261508 showed expression patterns related to the resistance response process, and all primers sequences of the candidate genes were reported in table 3. The three candidate genes were expressed at a low level before inoculation and increased slightly after inoculation. This expression level was then increased rapidly 10 days after inoculation (TYLCV) and continued to increase during the following days. In particular, compared with 0 days, the expression levels of all three resistance-related genes were increased at 10 and 15 days after inoculation (TYLCV). Nevertheless, the gene expression level of LOC101260925 was probably incompatible with being resistance related. In conclusion, the qRT-PCR results in our study indicated that the expression levels of SlNAC1, LOC104229164, and LOC101261508 were compatible with being resistance related, and the three candidate genes were probably the target genes of ty-5. In addition, we found that the codominant marker TES2461 can be used in marker-assisted selection (MAS) breeding. The SSR marker TES2461 (forward primer: 5′-GACTGCATTGGATTTGGCTT-3′; reverse primer: 5′-CAATCGATGCACAAAACACC-3′) was found to be linked with the resistance trait. A fragment of 550 bp was amplified in CLN32120a-23, a fragment of 780 bp was amplified in Moneymaker, and both of these nn0fragments were amplified in the F1 samples. Among total F2 plants, the susceptible plants showed the Moneymaker or F1 genotype, all of the resistant plants showed the CLN32120a-23 genotype, and eight susceptible plants showed the CLN32120a-23 genotype. The inoculation and molecular marker identification results of all F2 line plants showed a near consensus. The findings of this research provide the basis for future cloning of the ty-5 gene as well as MAS breeding and plant resistance mechanism studies. Key words: tomato; TYLCV; genetic analysis; qRT-PCR; gene mapping

162

NOTE

CmsCRC is involved in fingers stretch of fingered citron and activated under lower temperature Fanglei Liao, Yujing Wang, Qiyue Xu, Wen-rong Chen, Weidong Guo Zhejiang Normal University Abstract: The fingers of ‘Qingpi’ fingered citron, stretch out in winter with average temperatures around 4℃, but close to form the shape of a fist when the average temperature is more than 4℃. CRC belongs to YABBY family, regulating the pattern formation of the carpel in Arabidopsis. qRT - PCR technology was used to analyze the expression patterns of CRC in fingers-like fingered citron, fist-like fingered citron, and the citron during the stages of floral organ development. The result shows that the expression pattern of CRC in fist-like citron is quiet close to that of the citron, implying that the difference in the fruit shape of the fingered citron and citron is associated with the CRC gene expression patterns. The full length of CRC gene was identified from fingered citron and citron. Compare to citron, the promoter of CRC in fingered citron lacked two TATA - Box elements. Both CRC promoters in fingered citron and citron were connected with pGreen II 0800-luc, respectively, to construct expression vector. Then the vectors were transiently transformed into N. benthamiana by Agrobacterium. It follows that CRC promoter activity of fingered citron was lower than that of the citron under 20 ℃ cultures. After the culture at low temperature (4 ℃), the activity of fingered citron and citron CRC promoters were enhanced. However, the enhancement extent of fingered citron was greater than that of citron. Therefore, the CRC gene may be involved in mediating the fingers’ stretchability in fingered citron and can be induced at lower temperature. Key words: CmsCRC, fingered citron, fruit stretch, promoter activity, low temerrature

163

NOTE

Hyper-recombinant Plants: an emerging field for Innovative Ornamentals Breeding Fan Li, Jiwei Ruan, Shenchong Li, Jihua Wang ( Flower Research Institute) Abstract: The ornamental plant breeders, in the worldwide, are eager to develop and create innovative varieties with desirable traits that can be produced and commercialized. Traditionally, new ornamental plant varieties are almost exclusively created by conventional cross-breeding and subsequent selection of offspring individuals for the desired traits based on the principles of Mendelian genetics. The key factor for a success breeding is the genetic variation in the progeny, which determined by the degree of genetic material mixing after meiosis. However, meiosis is highly conserved in most eukaryotes which suppressed the meiotic recombination, resulting in a limited number of crossovers (COs), despite the large variation of physical genome size and chromosome number among species, as well as the large excess generation of its precursor at the beginning of meiosis. Recently, several anti-CO factors have been identified that limiting the meiotic recombination, such as FANCM which could increase three-fold recombination frequency. Those recombination suppressors provide an emerge tool to manipulate the recombination frequency in ornamental plants, thus could improve the mixing of genetic material and create more variations, thereby raising the consequent likelihood of producing new combinations of characteristics in progeny, as well as facilitating introgression of interesting alleles and desired traits. Therefore, applying the anti-CO genes in the breeding of ornamental plants to create hyper-recombinant plants is a new way to cultivate innovative species. Key words: Meiotic recombination suppressors, Increase recombination frequency, Ornamental breeding, Innovative species.

164

NOTE

Is plastid-nucleus retrograde signaling involved in vegetative phase change? Qingbo Zheng (China Agricultural University) Abstract: Plastid-nucleus retrograde signaling (PNRS) is essential for plant growth and development. Plant vegetative phase change governed by miR156 is under transcriptional control. We previously reported that hyper amount of hydrogen peroxide (H2O2) accumulated in chloroplast than cytosol or nucleus in apple. Whether or not PNRS participates in miR156 regulation is unclear. In this study, leaves from juvenile and adult phase of three hybrids of Zisai Pearl (Malus asiatica Nakai.) × Red Fuji (M. domestica Borkh.) were used as plant materials. RNA-seq and RT-qPCR data showed several PNRS genes were up regulated in adult phase, including Mg-proto IX/Fe-proto IX in protoporphyrin pathway and Ex1/Ex2 in singlet oxygen pathway. Significant higher levels of plastid super oxide but not singlet oxygen were detected in adult than in juvenile phase. When plastid H2O2 levels were modified with application of exogenous MV and DMTU, the expressions of MdMIR156a5/MdMIR156a12 and miR156 exhibited concomitant changes in in vitro shoots. The tetrapyrrole intermediates, Mg-protoporphyrin (Mg-ProtoIX) and heme contents were significantly higher in adult reproductive phase than in juvenile. Mg-proto IX and heme level increased with cellular GSH content in OTC treated in vitro shoots, however, the Mg-proto IX and heme kept constant when GSH decreased in BSO treated plantlets. Mg-proto IX and heme level was higher in MIM156 transformants than in wild type tobacco, but tobacco over-expressing MdMIR156a6 did not alter Mg-proto IX and heme contents. Together, singlet oxygen and Ex1/Ex2 signaling pathway as well protoporphyrins were not likely involved in MdMIR156 transcriptional regulation. Key words: Plastid-nucleus retrograde signaling, vegetative phase change, miR156

165

NOTE

Melatonin deficiency aggravates high temperature-induced damage to photosystem II in tomato plants Golam Jalal Ahammed (College of Forestry, Henan University of Science and Technology, Luoyang, 471023, China) Abstract: Despite a range of initiatives to reduce global carbon emission, the mean global temperature is increasing over time due to climate change. The occurrences of drought and heat events have become more prevalent in recent times, which pose a serious threat to global food security. Therefore, it is important to further explore important biological molecules that can confer thermotolerance to plants. Recently, melatonin has emerged as a universal abiotic stress regulator that can enhance plant tolerance to high temperature. Nonetheless, such regulatory roles of melatonin were unraveled mainly by assessing the effect of exogenous melatonin on plant tolerance to abiotic stress. Here, we generated melatonin deficient tomato plants by silencing of a melatonin biosynthetic gene, CAFFEIC ACID O- METHYLTRANSFERASE 1 (COMT1), to unveil the role of endogenous melatonin in photosynthesis under heat stress. We examined photosynthetic pigment content, leaf gas exchange and a range of chlorophyll fluorescence parameters. The results showed that silencing of COMT1 aggravated heat stress by inhibiting both the light reactions and the carbon fixation reactions of photosynthesis. The photosynthetic pigment content, light absorption flux, trapped energy flux, energy dissipation, density of active reaction centre per PSII cross section, the photosynthetic electron transport rate, the maximum photochemical efficiency of PSII photochemistry and the rate of CO2 assimilation all decreased in COMT1-silenced plants compared with that of non-silenced plants particularly under heat stress. However, exogenous melatonin alleviated heat-induced photosynthetic inhibition in both genotypes, indicating that melatonin is essential for maintaining photosynthetic capacity under stressful conditions. These findings provide genetic evidence on the vital role of melatonin in photosynthesis and thus may have useful implication in horticultural crop management in the face of climate change. Key words: chlorophyll fluorescence, heat stress, JIP test, melatonin, photosynthesis, tomato

166

NOTE

Changes of phytochemicals, antioxidant properties and gene expressions during development of sanhua-plum (Prunus Salicina Lindl.) Quan Li1, Xinbo Guo1, Xiaoxiao Chang2, Qiji Shan1

(1South China University of Technology, 2Guangdong Academy of Agricultural Sciences ) Abstract: Sanhua-plum widely cultivated in Guangdong province more than 15,000 hm2 belongs to Rosaceae family. Multifarious consumptions such as fresh-eating, juice, fermented wine and preserves are formed in commercial products. Meanwhile, evaluations of total phenolics, flavonoids, anthocyanins contents and antioxidant capacity have been carried out for ripe or treated sanhua-plum in postharvest storage. However, changes of phytochemicals, antioxidant properties and gene expressions did not be analyzed integrally during development of sanhua-plum. Therefore, sanhua-plum of five stages divided by fruit color consist of full-green (FG), red-appeared (RA), half-red (HR), full-red (FR) and purple-red (PR) were studied including total soluble sugar (TSS), titratable acidity (TA), total phenolic content (TPC), total flavonoid content (TFC), antioxidant quality (PSC assay) and cellular antioxidant activity (CAA assay) , enzyme activities of PPO and PAL, gene expressions of C4H, CHI, CHS1, DFR, F3H, LAR, ANR, ANS, PAL. Results showed that PR expressed the lowest TA, TP and the highest TSS, which could endow plums good taste. However, both PPO and PAL exhibited the strongest activities in PR stage, which indicated that intolerance storage should be noticed in PR. Besides, PSC value and CAA value minimized at PR stage while CAA value maximized at FR stage with a relatively high PSC value. The changes of antioxidant activities showed that FR could be a good choice for sanhua-plum. In addition, gene data showed that LAR was lowly expressed during fruit development, ANS was highly expressed during whole development, and ANR was highly expressed in RA and HR stages while lowly expressed in FR and PR stages, which could supply a reasonable explanation for color alteration. Additionally, expressions of other genes associated with phenolices and flavonoids could be the fundamental points for variations of those two phytochemicals. This work could give some significant advice on fresh-eating, harvest and processing for sanhua-plum with respect to phytochemicals and antioxidant properties. Gene regulations for better sanhua-plum could be focused by future studies. Key words: sanhua-plum，antioxidant properties，gene expressions

167

NOTE

Elevated carbon dioxide-induced changes in tea physiology: a climate change perspective Xin Li Tea Research Institute, Chinese Academy of Agricultural Sciences, 9 Meiling Road, Hangzhou, 310008, P.R. China Abstract: Increasing CO2 is one of the most prominent drivers of climate change. Elevated CO2 stimulates plant productivity by altering overall plant physiology, biochemistry and metabolism. However, studies exploring the effects of elevated CO2 on the most popular beverage crop, tea (Camellia sinensis L.) are scanty. Tea is a non-deciduous woody perennial plant species that shows increased photosynthesis and respiration when grown at CO2–enriched environment. It is believed that increased elevated CO2-induced photosynthesis enhances energy demand which triggers respiration as well. Moreover, elevated CO2 increases total carbon content, but decreases total nitrogen content, leading to an increased ratio of carbon to nitrogen in tea leaves. Elevated CO2 alters tea quality by differentially influencing the concentration of tea polyphenol, free amino acid, theanine and caffeine. Stimulation of both photosynthesis and respiration by elevated CO2 promotes biomass production, but plant defense response to specific pathogens is compromised due to altered secondary metabolism. Here we review the key physiological and metabolic processes associated with the tea quality in response to elevated CO2. In addition, potential impact of elevated CO2 on tea yield and defense is discussed. Key words: elevated CO2; tea quality; photosynthesis; respiration; tea yield; defense response

168

NOTE

Oleocellosis Induce Primary Metabolites Disorder and Enhance the Phenylpropanoid Metabolism in Citrus Fruits Mingfei Zhang, Yunjiang Cheng HZAU Abstract: Oleocellosis is a kind of physiological disorder in citrus fruit during development and postharvest storage. The surface flaw caused by oleocellosis brings severely economic losses to citrus industry worldwide, while there is limited information on dynamic changes of metabolites during oleocellosis development. In present study, ‘FengJie 72-1’ navel orange (Citrus sinensis Osbeck) which was easily occurred with oleocellosis, were selected for metabolism analysis. The results showed the burst of oleocellosis was accompanied with the coordinately accumulation of ROS, phenolic acids and flavanones. The contents of Ca and K were also changed. Furthermore, several metabolites derived from the TCA cycle and the glycolytic pathway, such as butanedioic acid and glucose were significantly decreased. The activity of phenylpropanoid pathway was significantly enhanced in oleocellosis-damaged tissues. The highly accumulation of secondary metabolites indicate response to oleocellosis damage. Taken together, our results provide insight into the mechanism of oleocellosis occurrence in citrus fruits. Keywords: Oleocellosis, Metabolomics, Citrus, Phenylpropanoid

169

NOTE

Three Paralogous R2R3-MYB Genes Contribute to Anthocyanin Synthesis in Petunia hybrid Hechen Zhang, Zhenzhu Fu, Xiaoyu Dong, Hui Jiang, Limin Wang, Xin Yuan, Naixi Feng, Jing Zhang (Horticulture Research Institute, Henan Academy of Agricultural Sciences) Abstract: Three ANTHOCYANIN SYNTHESIS REGULATOR (ASR1-3) genes that encode R2R3-MYB type proteins were identified from the Petunia inflate S6 genome. Two of these, ASR1 and ASR2, are inactivated by a base pair mutation in their coding sequence and all three of them do not exist in P. axillarisN, P. parodii, P. exserta, or the Petunia hybrid lines R27 and W115; these genes do exist and encode normal amino acids in the Petunia lines, M1 and V30. Comparative and phylogenic analysis of anthocyanin synthesis (AS)-related R2R3-MYB members showed that the ASR genes cluster is located in a highly active genome region and may have been separated from the same genomic fragment with ANTHOCYANIN4-DEEP PURPLE-PURPLE HAZE (AN4-DPL-PHZ) cluster. ASRs have both overlapping functions with AN4-DPL-PHZ genes in the regulation of anthocyanin synthesis but also their own specific regulatory function. Over-expression of ASR1/2/3 in petunia hybrid lines indicated that they can specifically induce the synthesis of anthocyanin delphinidin-related products by regulating AS structural genes, including EBGs of PALa, CHSaI, CHSj, F3H, F3’5’H, DFR, and ANS and LBGs of RT, MT, AT, and 5GT. ASR1 and ASR2 had plant-wide expression in petunia and could be induced under high light conditions, whereas ASR3 only expressed with low levels in only anthers and ovaries. ASRs were involved in the MBW regulatory network by interacting with AN1 and AN11; they also up-regulated the expression of MYBx and MYB27, thereby providing feedback repression of AS. An updated model of ASRs regulatory network is presented here outlining the mechanisms underlying AS in petunia. Key words: anthocyanin, petunia, transcription factor, R2R3-MYB

170

NOTE

Isolation and characterization of Fusarium oxysporum f.sp. passiflorae from passion fruit in China Rui Bin Kuang, Yue Rong Wei, Hu Yang (Key Laboratory of South Subtropical Fruit Biology and Genetic Resource Utilization, Ministry of Agriculture; Institute of Fruit Tree Research, Guangdong Academy of Agricultural Sciences)

Abstract: Passion fruit belongs to the family passifloraceae, widely distributed around the tropics, mostly native from tropical America and Brazil. In recent years, Passion fruit production developed rapidly in China, with a cultivation area around 50,000 hectares in 2017. However, passion fruit wilt, caused by the fungus Fusarium oxysporum f.sp. passiflorae, is one of the most severe diseases for this fruit tree. Isolation and characterization of Fusarium oxysporum spp. is most important work for further rootstock screening and resistant breeding of passion fruit. Thus, in this study five Fusarium isolates from Passiflora edulis in South China were achieved and cultivated in PDA and CLA media to observe the mycelial growth and sporulation with the aid of microscope. Fusarium isolates were then used to inoculate Passiflora edulis (Susceptible) to check their pathogenicity with a method of root immersion in the inoculum suspensions. DNA of these Fusarium pathogens was also collected for further PCR-based diagnostic test for pathogens diversity. This study is first report for isolation and characterization of Fusarium oxysporum f.sp. passiflorae from passion fruit in China, which may benefit for further wilt disease resistant breeding, and reduce the loss of wilt disease in passion fruit production. Key words: passion fruit, wilt disease, Fusarium

171

NOTE

Biosyntheses of Floral Aroma Compounds in Tea (Camellia sinensis) Leaves and Their Formations in Response to Multiple Stresses Lanting Zeng, Ying Zhou, Ziyin Yang Key Laboratory of South China Agricultural Plant Molecular Analysis and Genetic Improvement & Guangdong Provincial Key Laboratory of Applied Botany, South China Botanical Garden, Chinese Academy of Sciences. Abstract: The formation of plant metabolites is biochemical and physiological features of plants in response to environment during the evolutionary process. These metabolites contribute to the defense of plants against environmental stresses. On the other hand, they can be regarded as important quality components in crops. The idea of utilization of stress-response to improve the natural quality components of plants has recently attracted increased levels of interest. Tea (Camellia sinensis) is the most popular beverage next to water throughout the world. Aroma is an important factor affecting the character and quality of tea. Many studies have shown that different manufacturing processes influence the formation of tea aroma. Aroma formation in tea leaves during the oolong tea manufacturing process may result from the defense responses of tea leaves against the various stresses, including plucking (wounding), solar withering (drought, temperature, and UV radiation), indoor withering (drought), and turn over (wounding). However, the underlying formation mechanism of the characteristic aroma compounds remains unknown. In our studies, jasmine lactone, (E)-nerolidol, and indole were characteristic aroma compounds prevalent in oolong teas and contributed to tea floral properties. We elucidated the biosyntheses of jasmine lactone, (E)-nerolidol, and indole, which were derived from volatile fatty acid derivatives, volatile terpenes, volatile phenylpropanoids/benzenoids, respectively. The key synthetic genes from tea leaves were isolated, cloned, sequenced, and functionally characterized. Furthermore, our studies showed that the abiotic stresses, such as continuous mechanical damage, and mechanical damaged combined with low temperature, could enhanced the expression levels of the key genes, thus resulting in abundant accumulation of the characteristic aroma compounds in tea leaves. Our results shed light on concerning formation mechanisms of jasmine lactone, (E)-nerolidol, and indole in tea leaves for the first time, and showed a characteristic example of plant volatile formation in response to dual stresses. The knowledge of the specific relationships between the quality-related metabolites and stresses is a key element necessary to achieve the safe and effective improvement of tea quality. Keywords: aroma, Camellia sinensis, biosynthesis, stress, tea leaves, volatile

172

NOTE

A comprehensive proteomic analysis of elaioplasts from citrus fruits reveals insights into elaioplast biogenesis and function Zhu Man (Huazhong Agricultural University) Abstract: Elaioplasts of citrus peel are colorless plastids which accumulate significant amounts of terpenes. However, other functions of elaioplasts have not been fully characterized to date. Here, a LC–MS/MS shotgun technology was applied to identify the proteins from elaioplasts that were highly purified from young fruit peel of kumquat. A total of 655 putative plastid proteins were identified from elaioplasts according to sequence homology in silico and manual curation. Based on functional classification via Mapman, ~50% of the identified proteins fall into six categories, including protein metabolism, transport, and lipid metabolism. Of note, elaioplasts contained ATP synthase and ADP, ATP carrier proteins at high abundance, indicating important roles for ATP generation and transport in elaioplast biogenesis. Additionally, a comparison of proteins between citrus chromoplast and elaioplast proteomes suggest a high level of functional conservation. However, some distinctive protein profiles were also observed in both types of plastids notably for isoprene biosynthesis in elaioplasts, and carotenoid metabolism in chromoplasts. In conclusion, this comprehensive proteomic study provides new insights into the major metabolic pathways and unique characteristics of elaioplasts and chromoplasts in citrus fruit. Keywords: elaioplast, citrus peel, proteomic analysis, terpene

173

NOTE

Genes Mining and Function Identification of Rosa multiflora under Cold Stress Jie Dong, Daidi Che ( Northeast Agricultural University) Abstract: Millions of Rosa are used in landscaping, fresh cut flowers and potting flowers as ornamental plants. However, few of them could adapted to the average annual temperature which is between -5°C and 5°C in Heilongjiang Province, China. Therefore, it is significant and necessary to study cold resistance mechanism of native roses and cultivate ornamental Rosa with cold tolerance, which is also meaningful to introduction, propagation and breeding of new varieties. In this study, Rosa multiflora was identified after cold resistance evaluation of 187 species (including varieties, strains) Rosa by the membership function method. With transcriptome sequencing technology and molecular biology techniques, we detected transcription levels and differentially expressed genes in R. multiflora under cold or frozen conditions to research functions of MYB and NAC TFs. The results showed that the chilling resistance of XY2014-37 was the strongest in 187 Rosa, which subordinate value was 0.5584. XY2013-55 was the weakest with subordinate value 0.3511. The transcriptome data showed that 13 MYB TFs contained SANT domain and 12 conservative NAC TFs were involved in the low temperature response of R. multiflora. The relative expression levels of RmMYB44-like, RmMYB108, RmNAC4 and RmNAC18 under low temperature treatment showed tissue and space-time specificity. RmMYB44-like, RmMYB108 and RmNAC4 were cloned and overexpressed in Arabidopsis and tobacco, but their stress resistance function needs further investigation. Key word: Rosa, Cold resistance, Transcription factors, Genes function

174

NOTE

Mapping of QTLs Controlling Seed Size by Whole-genome sequencing and Bulk Segregation Analysis in Watermelon Meiling Gao (Qiqihar University) Abstract: Seed size controlled by QTLs dispersed in watermelon genome is a quantitative trait that influences both the quality and yield of watermelon. QTL-seq a rapid high-resolution genome-wide strategy , combining bulked segregation analysis (BSA) with whole genome sequencing , is the first steps for further research, such as cloning and function analysis . In this study, an F2 population derived from a cross between a inbred line K1 which the seed length was 5.8 mm and a inbred line L1 which the seed length was 9.8 mm, was used for excavation of controlling seed size traits genes by BSA-seq. The “L-Bulk” and “S-Bulk” DNA bulks were constructed using 20 plants selected from the F2 population. Next-generation sequencing (NGS) was applied for the resequencing of the parental bulks and two bulks . The result of the BSA showed a major region on chromosome 6 was identified about 2.82 Mb. Biparental QTL was conducted in the candidate region. A F2 genetic linkage map which included 21 CAPS markers and 1 dCAPS markers was constructed. The map contained 1 linkage groups which corresponded with the chromosome and spanned 60.03 cM with a mean marker interval of 2.73 cM, A major-effect QTL named SS6.1 was detected between the markers WSS-18 and CAPS-29 which was tightly linked to the seed length and 100 seed weight. The QTL analysis indicated the presence of one quantitative trait loci , SS6.1 was found in about 460 kb region WSS-18 and CAPS-29, which mapped on chromosome 6 of watermelon genome. There were 39 candidate genes were predicted in this region. Base on the watermelon genome and function analysis, five genes including Cla009263, Cla009266, Cla009289, Cla009292, Cla009303 were predicted as candidate genes related to the seed size. The results of candidate gene analysis provided some potential target for further cloning and functional identification of the seed size for breeding. Key words: “ Watermelon” “Seed size ” “Whole-genome sequencing ” “ BSA-seq” “Gene mapping ”

175

NOTE

Structural and compositional remodeling of Camellia sinensis leaf cuticle in response to draught stress Mingjie Chen1, Xiaofang Zhu1, Yi Zhang1, Zhenghua Du1, Xoaobin Chen1, Xiangrui Kong2, Changsong Chen2 （1 Fujian Agriculture and Forestry University, 2Tea Research Institute） Abstract: Cuticle is the major transpiration barrier to reduce non-stomata water loss, thus, plays critical roles for plant draught tolerance. So far, it remains unclear how cuticle make structural adjustments in response to draught stress in Camellia sinensis, a perennial woody crop species. In this study, we used one-year- old vegetatively propagated Camellia sinensis cv Jinguanyin as material, they subjected to water deprivation, at variable degree of draught stress the second leaf and the fifth leaf from the twigs were harvested, different parameters of cuticle were observed and quantified, including leaf surface wax crystal, cuticle thickness and ultrastructure, wax content and composition. Several genes in the very long chain fatty acid biosynthesis pathway were clones and their expression patterns were compared during the process of draught treatment. We found that the wax crystal number on the second and the fifth leaf was dramatically increased after draught treatment for 8 and 15 days, respectively. Compared to the abaxial surface, more wax crystal was accumulated at the adaxial surface. The cuticle thickness from both surface was increased with draught progress, and this were contributed mostly by the thickening of intracuticular wax layer, while the thickness of epicuticular wax layer remained constant. The cuticle ultrastructure also were altered with draught progress, ridge and channel structure started to appear on the intracuticular wax layer facing the cell wall side. The wax coverage increased with draught progress, the tender leaf showed more significant increase wax coverage compared with mature leaves. Cuticle wax compositional analysis revealed that alkane content was significantly increased. Besides alkane, hydroxyethyl esters, phenethyl esters, phthalate esters and sterols also increased. However, the contents of 1-alkanols esters, benzyl esters and triterpenoids maintained constant. The chain length distribution analysis revealed that the longer alkane chains (C37 and C39) appeared with draught progress. Two new triterpenoids (β-amyrone and canophyllol) were only detected under draught stress conditions. Gene expression analysis demonstrated that three genes in the VLCFA biosynthesis pathway were highly induced after 8-day draught treatment but was down-regulated after 15-day draught treatment. These findings indicated that plant actively remodel its cuticle ultrastructure and composition in response to draught stress by differentially regulation of VLCFAs biosynthesis. Key words: Camellia sinensis, cuticle, structure, wax, draught stress, Q-PCR

176

NOTE

Functional analysis of PalCLas, a pathogenicity-related genes from destructive pathogen Candidatus Liberibacter asiaticus Yanjie Qian, Min Liu, Lili Ouyang, Shiling Wang, Jin Jia, Fang Ding College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, Hubei, P.R. China Abstract: Candidatus Liberibacter asiaticus (CLas), the causal agent of Huanglongbing, is a non-culturable phloem-limited bacteria which causes the most dangerous disease threatening the whole citrus industry worldwide. Due to its resistance of in vitro culture, very little is known about the molecular mechanism on the pathogenicity of the bacteria and the host- pathogen interactions. In the present study, we selected 20 putative pathogenicity-related genes from the genomic sequence of CLas_Psy62 (NC_012985.1) by bioinformatics analysis and transiently expressed in Nicotiana benthamiana. One gene named PalCLas induced cell death and strong callose deposition in plant cells showing symptoms of hypersensitive response when transiently expressed with its signal peptide. Mutant of ΔPalCLas lacking a signal peptide failed to induce cell death in N. benthamiana. Subcellular localization indicated that PalCLas mainly distributed in the cytoplasm and nucleus. Analysis of secretion and subcellular localization in Escherichia coli showed: PalCLas gene with its signal peptide was hard to be expressed in E. coli. Yet the mutant ΔPalCLas without signal peptide can be expressed but not secreted outside the cell. Intriguingly, wild type PalCLas was polar localized in E. coli, with the comparison ΔPalCLas was even distributed throughout the whole cell. This study provides new insights into the pathogenicity of CLas in planta, which may play potential important role in the further research on the molecular mechanism of CLas-citrus interactions. Key Words: Citrus, Huanglongbing, pathogen-host interaction, PalCLas, function analysis

177

NOTE

Investigation of Alpha-Glucosidase Inhibitory Activity in Different Pepper Cultivars (Capsicum annuum L.) Sanghyeob Lee, Youngcheon Kim, Da-Eun Choi. Sejong UIniversity Abstract: Plant-based food have been used to treat diabetes mellitus recently, becausethe number of type II diabetic patient has increased dramatically in worldwide. The effective diabetes prevention is the controlling of postprandial hyperglycemia by α-glucosidase inhibition. This study present data of α-glucosidase inhibitory activity in extracts of 14 pepper fruits (Capsicum annuum L.) highly consumed as vegetable in Korea. The pepper fruit extracts were prepared with 70% ethanol and water, subjected to dilution (50 and 25%) prior to α-glucosidase inhibitory assay. Significant differences of α-glucosidase inhibitory activity were not shown between two different aqueous extract. Mee-In and Dda-Go-Ddo-Dda-Go cultivars possessed highest and sustainable inhibitory activity (almost 100%) against α-glucosidase. Whereas, the extracts from Soon-Han-Gil-Sang, Gil-Sang, Sweety, Hyul-Jo K, Shin-Hong, and Ai-Mat showed sharp decreasing pattern between 100 and 50% extract concentration. These results suggest the possibility that existence of unknown inhibitors at different concentration in the different pepper cultivars. Hence, further studies may needed to identify the unknown key α-glucosidase inhibitors in pepper fruits. Key words: Capsicum, AGI, Pepper

178

NOTE

Investigation of the in vitro effects of total extracts from pepper on amyloid production and aggregation Sanghyeob Lee, Youngcheon Kim, Joo-Young Lee Sejong UIniversity Abstract: Alzheimer’s disease (AD) involves accumulation, oxidative damage and inflammation and there is currently no clinically accepted treatment to stop its progression. Its risk is known to reduce with increased consumption of antioxidant and anti-inflammatory agents. Fibrillar aggregates of A are major constituents of the senile plaques found in the brains of AD patients and have been related to AD neurotoxicity. The senile plaques are produced by the sequential cleavage of the amyloid precursor protein by secretases. Recently peppers are noted for their antiaging and cognitive enhancing properties. Thus, in this study, the effects of total extracts from pepper on amyloid production and aggregation in vitro were investigated. Our study indicate that pepper could be a possible dietary intervention into the management of AD. Key words: Alzheimer’s disease, Pepper, Capsicum

179

NOTE

Genome editing-assisted glucoraphanin-rich broccoli Sanghyeob Lee, Youngcheon Kim Sejong UIniversity Abstract: To date, over 120 kinds of glucosinolate have been found in Brassicaceae. Especially, it is known that glucosinolate is decomposed into isothiocyanate, glucose, acid sulphate and so on by enzymatic action called myrosinase when the plant is wounded. Among them, isothiocyanate is known to induce biologic defense reactions such as strong anticancer, antibacterial and insecticidal action. Broccoli (Brassica oleracea) is one of Brassicaceae that is known to have a variety of effects including anticancer, hypertension prevention, cardiovascular disease prevention, and belongs to Time magazine's top 10 global foods. Therefore, domestic consumption of Korea has been rapidly increasing since 2000. A representative functional compound of broccoli is known as sulforaphane (S-methylsulfinylbutyl isothiocyanate). Broccoli is synthesized by the synthesis of glucoraphanin, a precursor of sulforaphane, and is known to be produced by sulforaphane and sulforaphane nitrile as they are degraded by myrosinase when the tissue is mechanically wounded. Therefore, the various physiological activities of broccoli are thought to be proportional to the content of glucoraphanin, and attempts have been made to increase the content of glucoraphanin. In recent years, varieties with 2-3 times more higher levels of glucoraphanin have been appeared in market. This variety was developed by conventional breeding program with more than 15 years of consecutive repeated crossings. However, there are too many constraints to cultivate high content of glucoraphanin through traditional breeding. Therefore, we intend to breed broccoli cultivars with increased glucanapanin content in a short period of time by applying the latest gene editing technology called CRISP / Cas9 directly to the current breeding line(s). Key words: Broccoli, Genome editing, Myb28

180

NOTE

Rooting recalcitrance is caused by active responses of adult leafy cutting to IBA treatment in Malus xiaojinnesis Xu Li, Xinzhong Zhang. Institute for Horticultural Plants, College of Horticulture, China Agricultural University Abstract: Adventitious root formation crucial for vegetative propagation of forestry and horticultural plants. The loss of competence to form adventitious roots is common feature of adult phase woody perennials. Leafy cuttings of apple rootstock M. xiaojinensis (Mx) from juvenile phase (Mx-J) and adult phase (Mx-A) were sampled for RNA-seq at 0, 6, 12, 24 and 48 hours after treatment with 3000 mg/L indolebutyric acid (IBA). 6 and 12 hours after IBA treatment, AUX/IAA, G2/mitotic cyclin, and Pectate lyase genes involved in auxin transport/signaling, cell cycle and cell wall metabolism respectively decreased significantly in adult but not juvenile cuttings.On the contrary, Microtubule-associated family genes associated with Tubulin, Pectate lyase were up regulated 12 or 24 hours after IBA treatment in juvenile than adult cuttings. By using co-expression analysis, a homeobox protein gene (HB13) was focused which was much earlier down-regulated in Mx-A cuttings at 6 h -12 h after IBA treatment. In addition, a glutamate decarboxylase (GAD) gene, encoding a rate-limiting enzyme of GABA biosynthesis, was significantly up-regulated in Mx-A cuttings after IBA treatment. Application of 4.0 mM exogenous GABA could significantly reduced the formation of adventitious roots in Mx-J. These data indicated that the adult cuttings responded to IBA treatment actively at early stages through repression of dedifferentiation and reactivation. Key Words: apple rootstock, adventitious root, auxin, dedifferentiation

181

NOTE

Study on growth characteristics and fruit quality difference between tillering and grafting plants of Zizyphus jujuba Mill cv. lingwuchangzao Linyun Bai, Bing Cao. (Ningxia University) Abstract: 【Objective】Zizyphus jujuba Mill cv.lingwuchangzao is an excellent fresh-eating jujube variety in Ningxia because of its colorful fruit, thick meat, crisp quality, sweet and sour taste, rich nutrition and strong adaptability. At present, tillering and grafting are the main breeding methods in the production of Zizyphus jujuba Mill cv.lingwuchangzao, but there is a lack of comparative studies on the growth characteristics and fruit quality of these individuals. According to the farmer experience, user feedback and the investigation of industry department, the fruit between grafted seedlings and tiller seedlings of Zizyphus jujuba Mill cv. lingwuchangzao does have different taste. Therefore, it is of certain guiding significance to explore the characteristics of the growth, the quality of the fruit and the internal differences of gene transcriptome between them.【Method】In this experiment, the same park with similar environment and consistent management was selected in Lingwu garden art field, Wolf-skin girder and Daquan forest field respectively. Taken the tillering and grafting propagation plants of similar age and growth as materials, measure their growth characteristics (jujube hanging long and thick, leaf area, leaf thickness, chlorophyll) , the content of VC, soluble solids and soluble sugar, to explore the influence on the external morphology and internal quality in different reproduction modes of Zizyphus jujuba Mill cv.lingwuchangzao, in order to determine the appropriate breeding way, aimed at providing a scientific basis for improving the cultivation management and fruit quality of Zizyphus jujuba Mill cv.lingwuchangzao.【Result】The results showed that different propagation modes had different effects on the growth characteristics of Zizyphus jujuba Mill cv.lingwuchangzao, as well as the content of VC and soluble solids. In terms of growth characteristics, compared with the tillering propagating plants and grafting propagating plants, the former has good growth condition of jujube hanging and crude growth, small leaf area, thick leaf, and high content of chlorophyll. In terms of fruit quality, there was no significant difference in soluble sugar, significant difference between soluble solids, and highly significant difference in VC content. The content of all three substances was higher in the grafted propagation plants. 【Conclusion】Combined with various indicators, the growth characteristics of Zizyphus jujuba Mill cv.lingwuchangzao under tillering reproduction were generally good, however, the fruit quality (VC, soluble solids) of Zizyphus jujuba Mill cv.lingwuchangzao is better under grafting breeding, which conforms to the market demand and is more suitable for promotion and cultivation in production. Key words: Zizyphus jujuba Mill cv.lingwuchangzao; Tillering propagation; Grafting reproduction; Growth characteristics; VC content; Soluble solids

182

NOTE

Phylogenetic Relationship and Genetic Background of Blueberry (Vaccinium spp.) based on Retrotransposon-based SSAP Molecular Markers Yu Zong, Qian Fang, Haiting Kang, Weidong Guo 1 1

Zhejiang Normal University

Abstract: A total length of 98 070 bp long terminal repeat retrotransposon (LTR-RT) sequences were discovered after preliminary prediction and subsequent screening, accounting for 3.96% of the whole blueberry genome. Thirty-three members belonged to Ty1/Copia retrotransposon family and 60 members belonged to Ty3/Gypsy retrotransposon family were identified according to their sequence similarity with previously reported retrotransposons, accounting for 1.57% and 2.39% of whole sequence of blueberry genome, respectively. Nineteen sequences from Ty1/Copia family and thirty-three sequences belong to Ty3/Gypsy were used for primer design. Sixty-six pairs of primers were synthesized randomly, in which forty-two pairs of primers were screened to validate the availability and transferability on 48 blueberry cultivars. The results showed that 50,564 bands were amplified using 42 pairs of primers, of which 48,068 were polymorphic bands. Bands at each locus ranged from 457 to 2 563, with an average of 1,053. To elucidate genetic relationship among 48 blueberry cultivars, principle coordinate analysis (PCoA) based on SSAP genotyping data was carried out. The results showed that two coordinates could explain 14.11% of the total variation among all cultivars, of which first and second coordinate took charge of 8.13% and 5.98% of total variation, respectively. The third coordinate accounted for 18.84% of the total variation. In order to estimate genetic background and phylogenetic relationship of blueberry cultivars, phylogenetic tree was constructed based on neighbor-joining algorithm. The results showed that 48 cultivars could be clustered into 5 groups. Our results indicated that the genetic background of 48 blueberry cultivars used in this study was relatively simple. The genetic composition of the northern and southern highbush blueberry cultivars was similar, which consisted of a single genepool. Except for ‘Bluegem’, genetic background of other cultivars of rabbiteye blueberry presents a multiple source of genepool, which was probably related to the involvement of multiple species in the artificial selection of rabbit blueberry cultivars. ‘Bluegem’ resemble genetic composition with highbush blueberries, suggesting that possibly several cultivars involved in its breeding process. The original lineage from V. virgatum was replaced gradually with repeated hybridization during the artificial selection. The cross breeding between cultivars which showed genetically distant from each other would enrich genetic diversity of blueberry cultivars. Our conclusions provided references for parental choice of blueberry cross breeding. Key Words: Blueberry; Retrotransposon; Molecular markers; Phylogenetic relationship; Genetic background

183

NOTE

Mixed pollen pollination promotes the secretion of stigma exudate and improves the fruit quality of southern highbush blueberry Fanglei Liao1, Yujing Wang1, Wen-rong Chen1, Weidong Guo1. (1 Zhejiang Normal University) Abstract: The pollination biology was studied in 8 cultivars of southern highbush blueberry. Based on the morphological traits of the flowers, it was found that the anther tips of 8 cultivars were shorter than the stigma, indicating that the pollination by insects or artificial pollination was more beneficial for fruit setting. Four pollination methods were performed, the bagged self-pollination, the artificial self-pollination, the artificial pollination with mixed pollen, and the artificial pollination with individual cultivar pollen, to compare the metaxenia effects on fruit set and the fruit quality in 'O'neal' and 'Emerland' . Among the 8 cultivars’ pollen grains, 'Bluerain' was the largest in the pollen grains diameter, 'Misty' was the smallest. 'Misty' had the highest rate of abortion among 8 cultivars’ pollens, while 'O'neal' had the lowest. The pollen vitality of 'Bluerain' was the highest. The germination ratio and pollen tube growth in the stigma were monitored by semi-in vitro pollen tube growth with aniline blue stain. We found that the pollen germination and the pollen tube growth were the highest in the stigma pollinated with the mixed pollen. The fruit set ratio of the mixed pollination was higher than those of the bagged and the artificial self-pollen pollination in 8 cultivars, except in 'Bluerain'. In 'O'Neal', the fruit set ratio of the mixed-pollen pollination is only lower than that of the pollination with 'Bluerain'; in 'Emerland', the fruit set ratio of the mixed-pollen pollination is lower than that of the pollination with 'Bluerain' and 'Gulfcoast'. Furthermore the mixed-pollen pollination increased the transverse diameter, the hardness and the anthocyanin content of the fruit in 'O'Neal'. The mixed-pollen pollination also increased the hardness and the anthocyanin content of the fruit in 'Emerland'. Electron microscopic photographs show after pollination, the mixed pollination promoted the stigma secreting more exudate. In conclusion, the pollination with mixed pollen is helpful to increase southern highbush blueberry yields and to promote the fruit quality by enhancing the compatibility between the pollen and the stigma. Key words: southern highbush blueberry, pollination, metaxenia, fruit quality

184

NOTE

Genetic trend and InDel markers exploration of dwarfing genes from the cross of M.baccata×M9. Feng Yang 1, Fei Shen 1, Xinzhong Zhang 1, Zhenhai Han 1 (1Institute for Horticultural Plants, China Agricultural University) Abstract: Dwarfing rootstocks enable high-density planting in orchards and are highly desirable in modern apple (Malus domestica) product industry. M9 as a dwarfing rootstock that is used world-wide and also being one of the core parents in apple rootstock breeding programes, but identifying dwarfing genes in M9 is still a major goal for rootstock breeders. Many efforts have been exerted in mapping quantitative trait loci (QTLs) to facilitate practical marker-assisted selection (MAS) in M-series rootstocks in order to explain the mechanism of dwarfing habit. In the present study, we analyze the genetic trend of dwarfing character of the hybrides from the cross of M.baccata×M9, finding that is controlled by quantitative polygene and identified AG, ARF6, LBD3, COGT2, G3OX3. etal five candidate genes in major QTLs of DW1 and DW2 by parents sequencting and fine mapping. Addressed to the candidated genes five Insertion or Deletion markers were explored in upstram of the promoter respectively to the 5 candidate genes. Then 5 InDel markers had been tested in hybrides derived from M.baccata×M9 and also valid in common used rootstocks resources such as M, B and SH serious, which could explain 96% of the F1 hybrides and 85% of the resources with the dwarfing ability. GUS activity had been tested for pormoter through injection agrobacterium for instantaneous transformation in leafs of tobacco, finding that InDel polymorphism could be functional to the promoters of the dwarfing genes. InDel markers that explored in promoters including a 11bp nucleotide deletion at -438bp in upstream to the gene of LBD3, a 15bp deletion at -156bp in upstream of AG ,and a 13bp deletion at -532bp of upstream of COGT2, those are positive regulated the dwarfing ability. On the contrary, a 14bp insertion at -991bp in upstream of ARF6, and a 19bp deletion at -2807bp in upstream of G3OX3, which are negative regulated the dwarfing ability. Our findings provide an insight into the Malus domestica genome-based selection in apple rootstocks, and will aid in conducting studies to better understand the physiological fundamentals of quantitative genetics in the control of M9’s dwarfing ability.We report a novel dwarfing mechanism in pormotors mediated by insetion and deletion that involves AG, ARF6, LBD3, COGT2, G3OX3 which fit with M9 bloodlines of rootstocks for potential applications in rootstock breeding and apple high-density product industry. Key words: M9, Dwarfing, Genetic trend, InDel, MAS

185

NOTE

Melatonin delays leaf senescence of Chinese flowering cabbage through suppressing ABF transcription factors-mediated ABA biosynthesis and chlorophyll degradation Zhong-qi Fan, Xiao-Li Tan, Jian-fei Kuang, Wei Shan, Wang-jin Lu and Jian-ye Chen* State Key Laboratory for Conservation and Utilization of Subtropical Agro-bioresources/Guangdong Provincial Key Laboratory of Postharvest Science of Fruits and Vegetables/Guangdong Vegetables Engineering Research Center, College of Horticulture, South China Agricultural University, Guangzhou 510642, China Correspondence: Jian-ye Chen ([email protected]) Abstract: Melatonin and abscisic acid (ABA) are known to play opposite roles in regulating leaf senescence. However, the molecular mechanism underlying the direct link between melatonin and ABA involving in leaf senescence remains poorly defined. In this study, we found that exogenous application of melatonin delayed postharvest leaf senescence of Chinese flowering cabbage, with melatonin-treated cabbages maintaining higher level of maximum quantum yield (Fv/Fm) and total chlorophyll content. Melatonin treatment also led to lower expression level of a series of chlorophyll catabolic genes including BrPPH, BrPAO, BrNYC1, BrNOL, BrRCCR, BrSGR1 and BrSGR2. Lower endogenous ABA level and expression of ABA biosynthetic genes BrNCED, BrABA2 and BrAAO3 were also found after melatonin treatment. Significantly, three ABA-responsive element (ABRE)-binding transcription factors BrABF1, BrABF4 and BrABI5 were identified. BrABF1, BrABF4 and BrABI5 localized in nucleus and their expressions were repressed by melatonin. Through electrophoretic mobility shift assay and transactivation analysis, we further revealed that BrABF1, BrABF4 and BrABI5 activated the expression of BrNCED, BrAAO3, BrNYC1, BrNOL, BrPPH, BrPAO, BrRCCR and BrSGR1, by directly binding to their promoters. Moreover, transient over-expression of BrABF1, BrABF4 and BrABI5 in tobacco leaves induced ABA accumulation and promoted chlorophyll degradation via the up-regulation of tobacco ABA biosynthetic and chlorophyll catabolic genes, resulting in the accelerated leaf senescence, whereas these effects were significantly antagonized by melatonin treatment. Our data reveal that BrABF1, BrABF4, and BrABI5 are activators of leaf senescence of Chinese flowering cabbage, and melatonin delays leaf senescence through suppressing ABFs-mediated ABA biosynthesis and chlorophyll degradation. Keywords: Chinese flowering cabbage, leaf senescence, melatonin, ABA, ABF

186

NOTE