Hostrange studies, genetic diversity and ... - Wiley Online Library

Plant Pathology (2014) 63, 63–71

Doi: 10.1111/ppa.12058

Host-range studies, genetic diversity and evolutionary relationships of ACLSV isolates from ornamental, wild and cultivated Rosaceous species A. T. Katsiania, V. I. Maliogkaa, T. Candressebc and N. I. Katisa* a

Plant Pathology Laboratory, School of Agriculture, Aristotle University of Thessaloniki, 54124, Thessaloniki, Greece; bINRA, UMR 1332 Biologie du Fruit et Pathologie; and cUniversite de Bordeaux, UMR 1332 Biologie du Fruit et Pathologie, F-33140, Villenave d’Ornon, France

A large-scale survey was carried out to study the host range and genetic diversity of Apple chlorotic leaf spot virus (ACLSV) in various Rosaceae species, with a special emphasis on ornamentals and wild shrubs. Samples were tested by DAS-ELISA using two different antisera, and RT-PCR amplification of part of the CP gene. There was generally a poor correlation between the results obtained with the two sets of serological reagents and between serological and molecular detection assays. Using a nested RT-PCR assay developed here, ACLSV was found to be widespread among cultivated, ornamental and wild species of the Rosaceae. The virus was detected for the first time in plum, wild cherry, Crataegus monogyna, Prunus spinosa and Prunus cerasifera in Greece. Sequences of a part of the CP encoding gene and the 3′ untranslated region from ACLSV isolates originating from various wild species and ornamentals were compared to those of isolates from cultivated hosts, showing similar divergence levels. Further phylogenetic analysis using the sequenced region indicated that the isolates from wild or ornamental hosts were not more closely related to each other than to isolates from cultivated hosts. The possible role of different factors in the spread of ACLSV on cultivated, ornamental and wild species is discussed. Keywords: evolution, genetic diversity, host range, Rosaceae, serological diversity, wild and ornamental species

Introduction Apple chlorotic leaf spot virus (ACLSV), the type member of the genus Trichovirus, is an important plant pathogen due to its worldwide distribution and broad host range, which includes cultivated, ornamental and wild species within the family Rosaceae (Al Rwahnih et al., 2004). Even though it is often latent in cultivated pome fruit species, ACLSV causes serious diseases in stone fruit trees, while its presence has also been established in several wild and ornamental species (Pe~ na-Iglesias & Ayuso, 1975; Sweet, 1976, 1980a,b; Rana et al., 2007). The complete genome sequence of several ACLSV isolates has been determined (German-Retana et al., 1997; Marini et al., 2008). The genome of ACLSV contains three open reading frames (ORFs): ORF 1 encodes the large replication-associated protein, ORF 2 encodes the movement protein (MP), and ORF 3 encodes the viral coat protein (CP; Martelli et al., 1994). DAS-ELISA and RT-PCR are among the most commonly used assays for routine detection of ACLSV (Myrta et al., 2011; Yaegashi et al., 2011). Although ELISA testing is rapid, cheap and easy, it can often be problem*E-mail: [email protected]

Published online 4 April 2013 ª 2013 British Society for Plant Pathology

atic because of the uneven distribution of the virus in the trees and the very low virus titres sometimes observed, which may be below the detection limit of the method (Detienne et al., 1981). Different RT-PCR assays using various primer pairs have been developed for the specific detection of ACLSV (Candresse, 1995; Menzel et al., 2002; Mathioudakis et al., 2010). However, the high molecular variability of the virus may limit the ability to efficiently detect all ACLSV isolates (Al Rwahnih et al., 2004; Malinowski, 2005; Yaegashi et al., 2007). Nevertheless, PCR-based assays have been demonstrated to prevail over other detection techniques in terms of polyvalence and sensitivity (Spiegel et al., 2006). Several studies have dealt with the molecular variability of ACLSV (Candresse et al., 1995; Al Rwahnih et al., 2004; Yaegashi et al., 2007; Mathioudakis et al., 2010) and focused mainly on the characterization of the CP gene, the C-terminal part of the CP being rather conserved between virus isolates (Candresse et al., 1995; German-Retana et al., 1997; Yaegashi et al., 2007; Mathioudakis et al., 2010). Phylogenetic relationships between ACLSV isolates originating mainly from different pome and stone fruit trees have also been studied (Candresse et al., 1995; Al Rwahnih et al., 2004). However, knowledge of the genetic diversity of ACLSV from ornamental and wild hosts and of the evolutionary relationships between these isolates with those infecting cultivated fruit tree species is rather limited.

63

64

A. T. Katsiani et al.

So far no natural vector has been identified for ACLSV (Yoshikawa, 2001) and, in addition, the virus is not known to be seed- or pollen-transmitted in any of its hosts (Yoshikawa, 2001). It is thus thought to spread mainly through the vegetative propagation or grafting of infected plants (Nemeth, 1986). Therefore, knowledge of the virus host range is necessary for effective pathogen management. In Greece, ACLSV has so far been detected in apple, peach, pear, apricot, sweet cherry, almond and quince, and also in Pyrus amygdaliformis, Cydonia japonica and Pyrus calleryana (Varveri & Bem, 1995; Mathioudakis et al., 2007, 2008; Charou et al., 2008; Mathioudakis & Katis, 2008). The objective of the present study was to improve knowledge about the natural host range of ACLSV through the survey of a number of rosaceous species, with a special emphasis on ornamentals and wild shrubs, which could represent unidentified natural virus reservoirs. As the virus variability in these hosts has not been well established so far, and may affect the outcome of the techniques, both serological and molecular assays were used and compared. The sequence of a large part of the capsid protein gene and of the 3′ untranslated region (3′ UTR) was determined for isolates from different ornamental and wild species and used for comparison with isolates from cultivated hosts and for phylogenetic analyses, to gain further insight into the fac-

tors influencing the evolutionary history and the epidemiology of ACLSV.

Materials and methods Surveys for ACLSV prevalence and sample preparation Surveys were carried out in June and July of 2007 and from April to June of 2008 in several provinces of central and northern Greece. In total, 723 samples were randomly collected from cultivated, ornamental and wild plants of the Rosaceae family, the majority of which were symptomless (Table 1). For ELISA tests, each sample consisted of mixed tissues (leaves, blossoms and/or fruits). For the molecular detection, bark tissue from annual shoots was also included in the mixture. For ACLSV serological detection, 02 g samples were ground in 2 mL PBS-Tween buffer (27 mM KCl, 14 mM KH2PO4, 43 mM Na2HPO4.12H2O, 137 mM NaCl, 05% Tween 20) containing 2% PVP (polyvinypyrrolidone, mol. wt. 58 000, Acros Organics). For ACLSV PCR detection, extraction of total RNA was carried out according to the in-house (method A) protocol of Chatzinasiou et al. (2010), which is based on selective binding of nucleic acids on a silica membrane.

Serological and molecular ACLSV detection Apple chlorotic leaf spot virus was detected in DAS-ELISA assays using reagents obtained from two different ACLSV-specific polyclonal antisera, one from INRA Bordeaux (France) and

Table 1 Plant species of the family Rosaceae collected and tested for the presence of Apple chlorotic leaf spot virus Genus

Species

Common name

Sampling provinces

Samples tested

Prunus

amygdalus webbii myrobalana maliformis persica spinosa cerasifera armeniaca mahaleb domestica avium cerasus nigra oblonga japonica canina acicularis domestica silvestris sp. amygdaliformis communis pyraster pindicola reptans monogyna coccinea chamaedryfolia sp. sp.

Almond Wild almond Myrobalan plum Peach Blackthorn Ornamental plum Apricot St Lucie cherry Plum Sweet cherry Sour cherry Wild cherry Quince Japanese quince Rose Wild rose Apple Wild apple Ornamental apple

Kozani, Fthiotida, Ioannina Chalkidiki Grevena, Kilkis Grevena, Thessaloniki, Thesprotia, Arta, Preveza, Ioannina Kozani, Pella Kozani, Kilkis, Ioannina Ioannina, Thessaloniki, Grevena, Chalkidiki Ioannina, Chalkidiki Ioannina Kozani, Komotini, Ioannina, Thesprotia Kozani, Grevena, Pella, Komotini, Kilkis, Pieria, Ioannina Kozani, Grevena, Ioannina Grevena, Ioannina, Kilkis, Komotini Komotini, Ioannina Ioannina, Komotini, Thessaloniki, Fthiotida, Larisa Kilkis, Chalkidiki, Thessaloniki Grevena Komotini, Kozani, Grevena, Ioannina, Thessaloniki Grevena, Ioannina Ioannina Kozani, Grevena, Kilkis, Chalkidiki, Fthiotida, Thesprotia, Preveza Kozani, Grevena, Komotini, Chalkidiki, Ioannina Arta, Ioannina, Grevena Kilkis Kilkis Kilkis, Ioannina, Preveza Larisa Kilkis Kilkis Chalkidiki, Ioannina

17 8 5 50 21 14 38 16 5 29 100 1 36 7 62 26 9 22 12 1 81 16 43 7 2 40 29 1 2 23

Cerasus Cydonia Rosa Malus

Pyrus

Potentilla Crataegus Pyracantha Spiraea Rubus Sorbus

Pear Wild pear

Hawthorn Firethorn


ACLSV in wild, ornamental and cultivated hosts

the second from BIOREBA, using the protocol recommended by the manufacturer. Each sample was tested in a single ELISA well and the assay was not repeated. One healthy sweet cherry sample was used as a negative control for all assays. Samples showing an optical density (OD) three times the average of negative controls were considered as positive. For the molecular diagnosis, a nested RT-PCR was developed and applied. The primer pair reported by Menzel et al. (2002) and amplifying part of the CP gene and the 3′ UTR (Table 2) was used as previously reported, in a one-tube RT-PCR format with a final concentration of 04 lM of each primer. After optimization, the thermocycling conditions used were: 46°C for 20 min, 48°C for 20 min, 50°C for 20 min, 52°C for 5 min, and 95°C for 5 min followed by 40 cycles of 95°C for 30 s, 56°C for 30 s and 72°C for 30 s, finally followed by a last elongation step of 72°C for 2 min. One microlitre of the RT-PCR reaction was used as a template for the nested PCR using primer pair CLSup and CLSdo (Mathioudakis et al., 2010; Table 2). The thermocycling scheme used was 94°C for 4 min, followed by 40 cycles of 94°C for 30 s, 51°C for 30 s and 72°C for 20 s, followed by a final extension step at 72°C for 2 min.

Sequencing of the partial CP gene and 3′ UTR of selected ACLSV isolates In general, two isolates from every plant species found to be infected with ACLSV were selected to determine their partial CP gene and 3′ UTR sequences. Because the original RT-PCR procedure of Menzel et al. (2002) was not able to amplify the majority of these isolates, a PCR scheme using the Menzel reverse primer and a new forward primer (ACLSV CP UP1; Table 2), followed by a semi-nested PCR with the Menzel et al. (2002) primer pair was used. For the reverse transcription (RT), 2 lL of the total RNA extracts were used as a template. The reaction mixture contained: 50 mM Tris-HCl (pH 83), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 05 mM each dNTP, 1 lM oligo d(T)18, 15 Units ribonuclease inhibitor (HT Biotechnology), 60 Units Moloney murine leukemia virus reverse transcriptase (Invitrogen) and DEPC-treated water to a final volume of 20 lL. The reaction was carried out in a thermocycler (Mastercycler-gradient, Eppendorf) for 1 h at 42°C followed by 15 min at 75°C. For the PCR, 1 lL of the cDNA was used. The reaction mixture contained 10 mM Tris-HCl (pH 88), 50 mM KCl, 15 mM MgCl2, 5% DMSO, 02 mM each dNTP, 04 lM reverse primer (Menzel et al., 2002) and 05 lM primer ACLSV CP UP 1, 1 Unit Dynazyme II DNA polymerase (Finnzymes) and DEPC-treated water to a final volume of 20 lL. The thermal profile was: 95°C for 5 min, 40 cycles of 95°C for 30 s, 57°C for 30 s and 72°C for 30 s, followed by a final step of 72°C for 2 min. For the seminested PCR, 01 lL of the PCR product was used. The reaction mixture contained 10 mM Tris-HCl (pH 88), 50 mM KCl,

65

15 mM MgCl2, 3% DMSO, 02 mM each dNTP, 04 lM each primer (Menzel et al., 2002), 1 Unit Dynazyme II DNA polymerase (Finnzymes) and DEPC-treated water to a final volume of 20 lL. The cycling scheme was the same as the first PCR with the exception of the 56°C annealing temperature used. The amplicons were sequenced directly on both strands by the LARK Company.

Sequence analysis and phylogenetic reconstructions The sequences of the isolates obtained in the present study were compared with the homologous ones already present in GenBank. Pairwise divergence values were calculated using MEGA v. 4 (Tamura et al., 2007). The CP–3′ UTR sequences were aligned with the CLUSTALW algorithm available in MEGA. Two known reference strains (A4, B6; Yaegashi et al., 2007) were also included. Appropriate nucleotide substitution models were determined using FINDMODEL (http://www.hiv.lanl.gov/content/sequence/findmodel/findmodel. html). For the phylogenetic analysis, the GTR+G nucleotide substitution model was chosen. The estimation of the phylogenetic relationships was carried out with the maximum likelihood (ML) method using the PHYML algorithm (Guindon & Gascuel, 2003). The reliability of the phylogenetic hypothesis was evaluated using the non-parametric bootstrap analysis (NPB).

Results Serological diversity of ACLSV Three different groups of samples could be identified based on DAS-ELISA results: samples giving a positive reaction only with the polyclonal antibodies of BIOREBA (42/723 samples), samples positive only with the reagents from INRA Bordeaux (78/723 samples), and samples reacting positively with both sets of antibodies (43/723; Table 3). It should be stressed that in the majority of cases, the positive reactions recorded here involved strong OD signals well above the detection threshold, so that the differences observed in reactions do not merely reflect small differences close to the significance threshold (results not shown). In most cases, samples originating from the same plant species displayed diverse serological reactions but in some cases all samples from the same plant species reacted only with one of the antisera (Table 3). More specifically, samples from C. japonica (Japanese quince), Prunus persica (peach), Malus silvestris (wild apple), Crataegus monogyna (hawthorn), Sorbus sp. and Pyracantha coccinea (firethorn) reacted positively only with the INRA antibodies,

Table 2 Primers used for the detection of Apple chlorotic leaf spot virus (ACLSV) and amplification of genome fragments for sequencing

Primer name

Sequence (5′–3′)

Primer position with respect to accession no. D14996

Sense Antisense ACLSV CP UP1 CLSup CLSdo

TTCATGGAAAGACAGGGGCAA AAGTCTACAGGCTATTTATTATAAGTCTAA CRGAARRCAGACCYCTTCATG CTGGAACAGATACTGGAGTC GCCTTGTTCATGATRAACAT

6860–6880 7507–7536 6845–6865 6883–6902 7237–7257


Product size (bp) 677 692 374

Assay

Reference

One tube RT-PCR or semi-nested PCR Two step RT-PCR Nested PCR

Menzel et al. (2002) This study Mathioudakis et al. (2010)

66


Table 3 Prevalence of Apple chlorotic leaf spot virus (ACLSV) in Rosaceae species based on serological and molecular assays Detection methods (number of ACLSV infected plants/total number of tested plants) DAS-ELISA

Species Cultivated

Wild species/ ornamentals

Total

Prunus domestica Prunus amygdalus Prunus avium Prunus persica Prunus maliformis Prunus armeniaca Prunus cerasus Malus domestica Pyrus communis Cydonia oblonga Cerasus nigra Prunus myrobalana Prunus spinosa Prunus cerasifera Prunus mahaleb Prunus webbii Malus silvestris Μalus sp. Pyrus amygdaliformis Pyrus pyraster Cydonia japonica Rosa canina Rosa acicularis Crataegus monogyna Sorbus sp. Pyracantha coccinea Rubus sp. Potentilla pindicola Potentilla reptans Spiraea chamaedryfolia

BIOREBA polyclonal antibodies

INRA polyclonal antibodies

Detection with both antibodies

1/29 0/17 15/100 0/21 0/50 0/16 0/1 5/22 6/16 0/7 13/36 0/5 0/14 5/38 0/5 0/8 0/12 0/1 27/81 4/43 0/62 4/26 1/9 0/40 0/23 0/29 2/2 1/7 1/2 0/1 85/723

1/29 0/17 11/100 2/21 1/50 0/16 0/1 8/22 5/16 0/7 3/36 0/5 0/14 15/38 0/5 0/8 3/12 0/1 13/81 4/43 20/62 0/26 9/9 4/40 1/23 18/29 1/2 0/7 1/2 0/1 121/723

0/29 0/17 8/100 0/21 0/50 0/16 0/1 5/22 5/16 0/7 3/36 0/5 0/14 5/38 0/5 0/8 0/12 0/1 12/81 2/43 0/62 0/26 1/9 0/40 0/23 0/29 1/2 0/7 1/2 0/1 43/723

whereas those from Rosa canina and Potentilla pindicola reacted only with the commercial antiserum of BIOREBA.

Nested RT-PCR

No. plants detected only by nested RT-PCR

No. plants detected only by DAS-ELISA

No. plants detected by RT-PCR and DAS-ELISA

9/29 9/17 21/100 7/21 1/50 0/16 0/1 16/22 8/16 2/7 6/36 0/5 5/14 28/38 0/5 0/8 0/12 1/1 10/81 1/43 24/62 2/26 1/9 1/40 0/23 0/29 1/2 1/7 0/2 0/1 154/723

7/29 9/17 14/100 5/21 1/50 0/16 0/1 9/22 7/16 2/7 5/36 0/5 5/14 13/38 0/5 0/8 0/12 1/1 5/81 1/43 17/62 1/26 0/9 0/40 0/23 0/29 0/2 0/7 0/2 0/1 101/723

0/29 0/17 11/100 0/21 1/50 0/16 0/1 1/22 4/16 0/7 12/36 0/5 0/14 0/38 0/5 0/8 3/12 0/1 21/81 6/43 12/62 3/26 8/9 3/40 1/23 18/29 1/2 0/7 1/2 0/1 106/723

2/29 0/17 7/100 2/21 0/50 0/16 0/1 7/22 1/16 0/7 1/36 0/5 0/14 15/38 0/5 0/8 0/12 0/1 5/81 0/43 7/62 1/26 1/9 1/40 0/23 0/29 1/2 1/7 0/2 0/1 50/723

(a)

Nested RT-PCR assay and comparison with the DAS-ELISA

(b)

The application of a single pair of primers, targeting either a 374 bp part of the CP (CLSup/CLSdo; Mathioudakis et al., 2010) or the partial CP and 3′ UTR regions (677 bp; Menzel et al., 2002) on a number of plant species proved to be insufficient for the effective molecular detection of ACLSV (Fig. 1a,b). For this reason a nested RT-PCR assay, more sensitive and reproducible than the single RT-PCR, was implemented (Fig. 1c). With this assay, ACLSV was detected in a total of 154 samples from cultivated, ornamental and wild species of the Rosaceae family, demonstrating its higher detection sensitivity compared to the DAS-ELISA assays (Table 3).

(c)

Figure 1 Agarose gel electrophoresis analysis of PCR products amplified using (a) primers CLSup/CLSdo (Mathioudakis et al., 2010) targeting a 374 bp part of the CP of Apple chlorotic leaf spot virus, (b) primers targeting a 677 bp part of the CP and 3′ UTR regions (Menzel et al., 2002) and (c) both primer pairs in the nested PCR assay developed in the present work. Lanes 1–3: pear samples; lanes 4–5: quince samples; lanes 6–8: apple samples; lanes 9–10: Prunus cerasifera samples; lane 11: positive control; lane 12: negative control; lane L: 100 bp DNA marker.



ACLSV presence among cultivated, ornamental and wild species of the Rosaceae family Using the nested RT-PCR, the virus was detected in most of the cultivated fruit species assayed, such as apple (16/ 22), almond (9/17), pear (8/16), peach (7/21), plum (9/ 29), quince (2/7) and sweet cherry (21/100), while it was not detected in apricot (0/16) and in the single sour cherry sample tested. The ornamental species, ornamental plum (P. cerasifera) and ornamental (Japanese) quince (C. japonica) showed high ACLSV prevalence (28/38 and 24/62, respectively). In rose (R. canina) and C. monogyna the virus was less frequent (2/26 and 1/40, respectively) while ACLSV was not detected in P. coccinea (firethorn; 0/29). ACLSV was also detected in wild Rosaceae species such as Rubus sp. (1/2), wild cherry (Cerasus nigra, 6/ 36), Prunus spinosa (5/14), P. pindicola (1/7), P. amygdaliformis (10/81), wild rose (R. acicularis, 1/9) and wild pear (P. pyraster, 1/43). Finally, the virus was not detected in wild apple, Sorbus sp., wild almonds, wild plum (P. myrobalana), St Lucie cherry (P. mahaleb), Prunus webbii, and in the few samples of Potentilla reptans and Spirea chamaedryfolia tested. ACLSV was also detected both by ELISA and RT-PCR assays in rose (R. canina), Rubus sp. and P. pindicola and therefore these species may represent newly recorded natural hosts (Table 3). In addition, one plant, P. reptans, collected from the Balkan Botanic Garden of Kroussia (Kilkis), was ACLSV-positive by both ELISA tests, but no amplification product could be obtained.

Molecular variability of ACLSV isolates The sequences of 14 virus isolates from eight plant species (apple, sweet cherry, pear, quince, P. amygdaliformis,

67

P. spinosa, C. japonica, Prunus cerasifera) were amplified with the semi-nested RT-PCR assay developed here. These sequences have been deposited in the EMBL-EBI database under the accession numbers indicated in Table 4. Partial sequences from Crateagus monogyna and wild cherry samples were also generated. These partial sequences have been deposited in GenBank (accession numbers HF558396 and HF558397, respectively) but they were not included in the analysis because, despite sequencing twice on both strands of each product, it was not feasible to confirm the sequence near the primer binding regions. Despite the efforts at optimization, amplification of the homologous region for ACLSV isolates from the other 10 species tested (plum, almond, peach, wild plum (P. maliformis), wild pear, Rubus sp., P. pindicola, ornamental Malus sp., wild rose and rose) was not successful (Table 4). Direct sequencing of the amplicons showed length variability, with sizes ranging between 619 and 655 bp. The amplicons from isolates CLS10 (C. japonica) and 260Kom (C. japonica) are characterized by the existence of a unique insertion in the 3′ UTR (Fig. 2a). Interestingly, database searches indicated that an almost identical insertion (having a single nucleotide substitution compared with 260-Kom) is observed in another ACLSV isolate from apple in Japan (AB326225). All sequences obtained in this study were compared, after the removal of the primer-binding regions, against the homologous genomic regions of other ACLSV isolates already available in GenBank. They showed nucleotide sequence identity rates ranging between 87 and 99% (Table 4), confirming the viral origin of the sequences obtained. Comparative analysis among the sequences obtained highlighted the existence of high genetic diversity in the CP gene (average pairwise nucleotide divergence of 135 09%) and, surprisingly, of an even higher one in

Table 4 Geographic origin, host, accession numbers in EMBL-EBI and nucleotide similarity with homologous genomic regions of the Apple chlorotic leafspot virus isolates sequenced in this study Highest nucleotide similarity with database sequence Isolate

Origin

Host

Accession number

%

Accession in EMBL-EBI/host

CLS5 CLS10 236-Io 239-Io CLS11 260-Kom 274-Chal 156-Ki ACLSV-KOMa ACLSV-METa 321-Io 571-Kom 534-Kom 146-Pe

Pella Komotini Ioannina Ioannina Komotini Komotini Chalkidiki Kilkis Komotini Metsovo Ioannina Komotini Komotini Pella

Prunus avium Cydonia japonica Prunus cerasifera Pr. cerasifera Pyrus communis C. japonica Pyrus amygdaliformis Prunus spinosa Py. communis Malus domestica M. domestica Cydonia oblonga C. oblonga Pr. avium

HF558393 HF558394 FN391014 FN391015 HF558395 FN391010 FN391009 FN391008 FN386788 FN386786 FN391011 FN391013 FN391012 FN391006

99 94

AJ586640/apple AB326225/apple

87

GQ334188/apple

92 95 92 91 92 94 93 91 91 97

AJ586624/apple AB326225/apple DQ329161/peach DQ834688/apple DQ834688/apple AJ586624/apple GQ334204/pear AB326224/apple AJ586638/apple DQ329160/sweet cherry

a

Reported by Mathioudakis et al., 2010.


68


(a)

(b)

Figure 2 Alignments of sequences from various Apple chlorotic leaf spot virus isolates analysed in the present work. (a) Nucleotide alignment of a part of the 3′ UTR showing high polymorphism. (b) Alignment of the partial amino acid sequence of the CP showing co-variation of five positions (indicated by arrows).

the 3′ UTR (average pairwise divergence of 173 18%). Interestingly, diversity of ACLSV isolate sequences from cultivated species (128 08% when computed for CP + 3′ UTR nucleotide sequence) was slightly lower but did not markedly differ from that of isolates from wild shrubs and ornamentals (148 09%, see also Table 5 for details). The average nucleotide diversity between groups (cultivated species versus wild/ornamentals) was also found to be in the same range (159 09%). A similar result was obtained when independently computing diversities for the CP gene or for the 3′ UTR region. Computed amino acid diversity values for the CP protein were similar, being 46 11% and 6 13% for isolates from cultivated and wild/ornamental species, respectively and 55 11% between groups (Table 5). Previous reports indicated that ACLSV isolates from cultivated hosts are separated into two major groups (P205 and B6 types) in which the combinations of five specific covarying amino acids of the CP are highly conserved within each cluster (Yaegashi et al., 2007). The Greek isolates may be similarly divided into those previously reported groups, namely the P205 type which includes the isolate 146-Pe (sweet cherry) and CLS5

Table 5 Intra- and intergroup average pairwise divergence values estimated for the partial CP and 3′ UTR genomic region of Apple chlorotic leaf spot virus between isolates from wild/ornamental or cultivated host species. Sequences from the virus isolates reported in Table 3 were included in the analysis. Standard deviations computed on nucleotide or amino acid sequences are given Intragroup diversities

Viral region

Isolates from cultivated species (% SD)

Whole sequence CP gene 3′ UTR CP protein

128 119 157 46

08 09 19 11

Isolates from wild/ornamental species (% SD) 148 136 184 60

09 10 20 13

Intergroup diversities (% SD) 159 143 178 55

09 10 19 11

(sweet cherry), and the B6 type which includes all other analysed Greek isolates (Figs 2b & 3).

ACLSV phylogeny A phylogenetic analysis performed using the sequenced region (partial CP gene and 3′ UTR regions) grouped the Plant Pathology (2014) 63, 63–71


69

Figure 3 Maximum likelihood phylogenetic tree inferred from the partial CP gene and 3′ UTR nucleotide sequences of Apple chlorotic leaf spot virus determined in this study. Isolates are reported with their code number. Two known reference isolates of the P205 (AB326223) and B6 (AB326224) subgroups were also included. The tree is midpoint-rooted. The numbers at the nodes are the non-parametric bootstrap (NPB) probabilities given as percentages of 1000 replicates. Only NPB values with P > 07 are shown.

isolates under study into two different clusters with high bootstrap support (Fig. 3). In both of these clusters, isolates from cultivated hosts were regrouped with isolates from wild species/ornamentals. However, very closely related isolate pairs (534-Kom/571-Kom; 236-Io/239 Io; 146-Pe/CLS5; 260-Kom/CLS10) were always isolated from the same host species. From the topology of the phylogenetic tree it is obvious that in addition to the non-host-specific clustering, there is also no geographical classification of ACLSV isolates. It should be mentioned that in a phylogenetic analysis where the partial sequences from C. monogyna, wild cherry and C. japonica were used, the first two isolates grouped together with the sweet cherry isolate 146-PE, while the C. japonica one was more closely related to other C. japonica isolates (data not shown).

Discussion In this work, the natural host range and genetic diversity of ACLSV were studied by surveying a large number of rosaceous species. As limited information existed on virus variability on different non-cultivated hosts, the study was especially interested in the detection and characterization of isolates from these species. Virus detection, which was based on both serological (DAS-ELISA) and molecular (RT-PCR) assays provided a complex picture. Unexpectedly, DAS-ELISA assays using two different sets of ACLSV-specific immunological reagents, including a commercial one, gave widely different results, with only limited correlation between the two assays (Table 3). This may reflect the variability in the viral CP, which may complicate its reliable detection using a single polyclonal reagent. It is also possible that false positive results were obtained because of the presence of another trichovirus, such as Apricot pseudochlorotic leaf spot virus (APCLSV), which has been shown to cross react with ACLSV (Liberti et al., 2005), or because of non-specific recognition of normal proteins Plant Pathology (2014) 63, 63–71

of some of the unusual host plants assayed here. Indeed, the presence of the virus could not be confirmed by RTPCR in many samples that gave positive ELISA reactions with one or even sometimes with both serological reagents (Table 3). For the molecular detection of the virus, two RT-PCR assays (Menzel et al., 2002; Mathioudakis et al., 2010) were initially evaluated. These two methods performed poorly on many of the samples analysed and were unable to detect the majority of viral isolates, probably because of low viral concentration or possible mismatches between the primers and the diverse viral templates. The combined use of both primer sets in a nested RT-PCR achieved efficient amplification of the virus (Fig. 1) and resulted in ACLSV detection in 154 samples from ornamental, wild and cultivated species of the Rosaceae family. It should be noted that most of the isolates detected by molecular methods did not react positively with the ELISA assays, probably due to low viral titres (Candresse et al., 1995; Menzel et al., 2002; Salmon et al., 2002). Therefore, for reliable ACLSV detection in certification and quarantine programmes, it is recommended that both ELISA and nested RT-PCR assays should be used. ACLSV was found not only in cultivated but also in ornamental and wild rosaceous species samples. The virus was detected in apple, quince, pear, sweet cherry, almond, peach, P. amygdaliformis and C. japonica and, for the first time in Greece, in Prunus domestica (plum), C. nigra (wild cherry), C. monogyna (hawthorn), P. spinosa (blackthorn) and Prunus cerasifera. ACLSV was also detected in rose (R. canina) and the wild species Rubus sp. and P. pindicola, which could represent previously unidentified natural hosts. Nevertheless, because no sequence data could be obtained from the amplicons, further research is needed to support these findings. ACLSV occurrence in pome (727% in apple) and stone (333% in peach) fruit species during the survey highlights the necessity for the production of certified propagated plant material (Rowhani et al., 2005). Studies to

70


evaluate ACLSV prevalence in the Mediterranean region including Greece (Varveri & Bem, 1995) were mainly based on serological methods which have been shown here and elsewhere (Myrta et al., 2003; Spiegel et al., 2006; Wang et al., 2011) to have limited reliability. In Greece, the prevalence of the virus has been recently studied by using molecular methods (RT-PCR) in pome fruits and Prunus cerasifera (Mathioudakis et al., 2008) and almonds (Charou et al., 2008). In stone fruits, ornamentals and wild species, the present work represents the first study. In order to get a better understanding of the virus evolution and epidemiology, the genetic diversity of ACLSV isolates from ornamental and wild hosts was studied and compared with that of isolates from cultivated species. A large part of the CP gene and 3′ UTR was targeted, in order to increase the chances of obtaining significant phylogenetic signals. Unfortunately, despite several attempts to improve the PCR amplification efficiency, this region could not be amplified for all isolates under study. Nevertheless, comparative analysis of the sequences obtained indicates that divergence levels between isolates from cultivated and from wild/ornamental species do not differ markedly from the divergence shown by isolates within each host plant group (Table 5). Interestingly, with the exception of two isolates from sweet cherry (146-Pe and CLS5), all Greek isolates were found to belong to the B6 type (Yaegashi et al., 2007), irrespective of their host of origin (Figs 2b & 3). This observation clearly questions whether the hypothesis that the five covarying amino acids in the CP that form the basis for the separation of the B6 and P205 types could be associated with host adaptation (Yaegashi et al., 2007). A high level of indel polymorphism was encountered in the middle of the sequenced 3′ UTR region, while the 3′ part of it was more conserved (Fig. 2a). Two of the isolates, CLS10 (C. japonica) and 260-Kom (C. japonica), are characterized by a unique sequence insertion in this region, also found in an apple isolate from Japan (AB326225). This characteristic, along with a high sequence similarity between these three isolates, points to a common origin for them. The evolutionary relationships among isolates originating from wild/ornamental hosts and from cultivated species were estimated using the CP–3′ UTR sequences. Maximum likelihood (ML) phylogenetic analysis showed a clustering of ACLSV isolates from non-cultivated hosts with those from pome and stone fruits (Fig. 3), which raises questions about the mode of dispersion of the virus between these plant species. Similar topologies were also obtained when phylogenetic analysis was conducted including homologous genomic sequences from other ACLSV isolates retrieved from public databases (data not shown). ACLSV is known to exist worldwide mainly because of the movement/trading of infected plant material. The use of Cydonia genus rootstocks in grafting procedures for pome fruits could explain the evolutionary relationship observed among the isolates from pear, quince and P. amygdaliformis (Table 5; Fig. 3).

Quince is the most commonly used rootstock of pear, while P. amygdaliformis was also used in the past (M. Vasilakakis, Aristotle University of Thessaloniki, Greece, personal communication). It is hard to explain the clustering of virus isolates from the wild species P. spinosa, and the ornamental P. cerasifera along with the pome fruit tree isolates (Fig. 3), given that these plant species are not related. Even though vegetative propagation and grafting could explain virus spread and maintenance in the cultivated and ornamental plants, they cannot account for its presence in the wild species. In these hosts ACLSV could either be transmitted by seed, pollen or by a putative vector even if it has not been reported to be spread in this way (Yoshikawa, 2001). Genetic analysis of a larger number of ACLSV isolates from diverse hosts will allow the acquisition of more information on the genetic diversity and the impact of the host species on the classification of viral populations. Moreover, the determination of more viral sequences from cultivated, ornamental and wild species of the Rosaceae family is necessary for the development of more effective and polyvalent molecular detection methods able to detect most of the viral isolates. Finally, further research on the mechanisms of ACLSV transmission must be carried out, as grafting does not explain the relationships observed among isolates from diverse hosts.

References Al Rwahnih M, Turturo C, Minafra A et al., 2004. Molecular variability of Apple chlorotic leaf spot virus in different hosts and geographical regions. Journal of Plant Pathology 86, 117–22. Candresse T, 1995. Recent developments in plant viruses detection. Acta Horticulturae 386, 601–5. Candresse T, Lanneau M, Revers F et al., 1995. An immunocapture PCR assay adapted to the detection and the analysis of the molecular variability of the Apple chlorotic leaf spot virus. Acta Horticulturae 386, 136–47. Charou AT, Maliogka VI, Mathioudakis MM, Efthimiou KE, Papayiannis LC, Katis NI, 2008. Incidence of Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV) and Apple chlorotic leafspot virus (ACLSV) in almond orchards of Greece and Cyprus. Phytopathologia Mediterranea 47, 149. Chatzinasiou E, Dovas CI, Papanastassopoulou M et al., 2010. Assessment of bluetongue viraemia in sheep by real-time PCR and correlation with viral infectivity. Journal of Virological Methods 169, 305–15. Detienne G, Delbos R, Dunez J, 1981. Use and versatility of the immunoenzymatic ELISA procedure in the detection of different strains of Apple chlorotic leaf spot virus. Acta Horticulturae 94, 39–46. German-Retana S, Bergey B, Delbos RP, Candresse T, Dunez J, 1997. Complete nucleotide sequence of the genome of a severe cherry isolate of Apple chlorotic leaf spot trichovirus (ACLSV). Archives of Virology 142, 833–41. Guindon S, Gascuel O, 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52, 696–704. Liberti D, Marais A, Svanella-Dumas L et al., 2005. Characterization of Apricot pseudo-chlorotic leaf spot virus, a novel Trichovirus isolated from stone fruit trees. Phytopathology 95, 420–6. Malinowski T, 2005. Potential problems with the reliability of PCR based diagnostic methods related to plant viruses sequence variation. Phytopathologica Polonica 35, 125–39.



Marini D, Gibson P, Scott S, 2008. The complete nucleotide sequence of an isolate of Apple chlorotic leaf spot virus from peach (Prunus persica (L.) Batch). Archives of Virology 153, 1003–5. Martelli GP, Candresse T, Namba S, 1994. Trichovirus, a new genus of plant viruses. Archives of Virology 134, 451–5. Mathioudakis MM, Katis NI, 2008. Phylogenetic analysis of Apple chlorotic leaf spot virus (ACLSV) and the host effect in the population structure of the virus. Phytopathologia Mediterranea 47, 157. Mathioudakis MM, Candresse T, Katis NI, 2007. First report of Apple chlorotic leaf spot virus in quince in Greece. Plant Disease 91, 462. Mathioudakis MM, Maliogka VI, Katis NI, 2008. Occurrence of Apple chlorotic leaf spot virus (ACLSV) and Apple stem pitting virus (ASPV) in cultivated, ornamental and wild Rosaceae species in Greece. Phytopathologia Mediterranea 47, 157. Mathioudakis MM, Maliogka VI, Katsiani AT, Katis NI, 2010. Incidence and molecular variability of Apple stem pitting and Apple chlorotic leaf spot viruses in apple and pear orchards in Greece. Journal of Plant Pathology 92, 139–47. Menzel W, Jelkmann W, Maiss E, 2002. Detection of four apple viruses by multiplex RT-PCR assays with coamplification of plant mRNA as internal control. Journal of Virological Methods 99, 81– 92. Myrta A, Di Terlizzi B, Savino V, Martelli GP, 2003. Virus diseases affecting the Mediterranean stone fruit industry: a decade of surveys. Options Mediterraneennes Serie B 45, 15–23. Myrta A, Matic S, Malinowski T, Pasquini G, Candresse T, 2011. Apple chlorotic leaf spot virus in stone fruits. In: Hadidi A, Barba M, Candresse T, Jelkmann W, eds. Virus and Virus-like Diseases of Pome and Stone Fruits. St Paul, MN, USA: APS Press, 85–90. Nemeth M, 1986. Virus, Mycoplasma and Rickettsia Diseases of Fruit Trees. Budapest, Hungary: Akademiai Kiado. Pe~ na-Iglesias A, Ayuso P, 1975. Preliminary identification of the viruses producing Spanish apricot pseudo pox “viruela” and apricot mosaic diseases. Acta Horticulturae 44, 255–65. Rana T, Chandel V, Hallan V, Zaidi AA, 2007. Molecular evidence for Apple chlorotic leaf spot virus in wild and cultivated apricot in Himachal Pradesh, India. Journal of Plant Pathology 89, S72.


71

Rowhani A, Uyemoto JK, Golino DA, Martelli GP, 2005. Pathogen testing and certification of Vitis and Prunus species. Annual Review of Phytopathology 43, 261–78. Salmon MA, Vendrame M, Kummert J, Lepoivre P, 2002. Detection of Apple chlorotic leaf spot virus using a 5′ nuclease assay with a fluorescent 3′ minor groove binder-DNA probe. Journal of Virological Methods 104, 99–106. Spiegel S, Thompson A, Varga A, Rosner A, James D, 2006. Evaluation of reverse transcription-polymerase chain reaction assays for detecting Apple chlorotic leaf spot virus in certification and quarantine programs. Canadian Journal of Plant Pathology 28, 280–8. Sweet JB, 1976. Virus diseases of some ornamental and indigenous trees and shrubs in Britain. Acta Horticulturae 59, 83–92. Sweet JB, 1980a. Hedgerow hawthorn (Crataegus spp.) and blackthorn (Prunus spinosa) as hosts of fruit tree viruses in Britain. Annals of Applied Biology 94, 83–90. Sweet JB, 1980b. Fruit tree virus infections of ornamental rosaceous trees and shrubs. Journal of Horticultural Science 55, 103–11. Tamura K, Dudley J, Nei M, Kumar S, 2007. MEGA 4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–9. Varveri C, Bem F, 1995. Viruses of stone and pome-fruit mother-tree plantations in Greece. Acta Horticulturae 386, 431–8. Wang LP, Hong N, Matic S et al., 2011. Pome fruit viruses at the Canadian Clonal Genebank and molecular characterization of Apple chlorotic leaf spot virus isolates. Scientia Horticulturae 130, 665–71. Yaegashi H, Isogai M, Tajima H, Sano T, Yoshikawa N, 2007. Combinations of two amino acids (Ala40 and Phe75 or Ser40and Tyr75) in the coat protein of Apple chlorotic leaf spot virus are crucial for infectivity. Journal of General Virology 88, 2611–8. Yaegashi H, Yoshikawa N, Candresse T, 2011. Apple chlorotic leaf spot virus in pome fruits. In: Hadidi A, Barba M, Candresse T, Jelkmann W, eds. Virus and Virus-like Diseases of Pome and Stone Fruits. St Paul, MN, USA: APS Press, 17–21. Yoshikawa N, 2001. Apple chlorotic leaf spot virus. CMI/AAB Descriptions of Plant Viruses No. 386 (No. 30 revised). [http://www. dpvweb.net/dpv/showdpv.php?dpvno=386].