Human dopamine transporter gene: coding region ... - Nature

Molecular Psychiatry (2000) 5, 283–292  2000 Macmillan Publishers Ltd All rights reserved 1359-4184/00 $15.00 www.nature.com/mp

ORIGINAL RESEARCH ARTICLE

Human dopamine transporter gene: coding region conservation among normal, Tourette’s disorder, alcohol dependence and attention-deficit hyperactivity disorder populations DJ Vandenbergh1,2, MD Thompson3, EH Cook4, E Bendahhou1, T Nguyen3, MD Krasowski4, D Zarrabian3, D Comings5, EM Sellers6,7, RF Tyndale6, SR George6, BF O’Dowd3 and GR Uhl1 1

Molecular Neurobiology Branch, National Institute on Drug Abuse, NIH; 3Department of Pharmacology, University of Toronto, Toronto, Ontario M5S 2S1, Canada, 4Laboratory of Developmental Neuroscience, Department of Psychiatry, University of Chicago, Chicago; 5Department of Medical Genetics, City of Hope Medical Center, Duarte, California; 6 Centre for Addiction and Mental Health, and Departments of Pharmacology, Psychiatry and Medicine; 7Sunnybrook and Women’s College Health Science Centre, University of Toronto, Toronto, Ontario, Canada The dopamine transporter (DAT) provides major regulation of the synaptic levels of dopamine and is a principal target of psychostimulant drugs. Associations between DAT gene polymorphisms and human disorders with possible links to dopaminergic neurotransmission, including attention-deficit/hyperactivity disorder (ADHD) and consequences of cocaine and alcohol administration, have been reported. We now report approximately 60 000 bp of genomic sequence containing the entire DAT gene. This sequence was used to amplify each of the 15 DAT gene exons and several introns and analyze these amplification products by singlestranded sequence conformation (SSCP) and/or direct sequencing. These results define silent allelic single nucleotide sequence variants in DAT gene exons 2, 6, 9 and 15. Rare conservative mutations are identified in amino acids encoded by DAT exons 2 and 8. Analyses of the common nucleotide variants and the previously reported VNTR in the non-coding region of exon 15 define the pattern of linkage disequilibrium across the DAT locus. These comprehensive analyses, however, fail to identify any common protein coding DAT sequence variant in more than 150 unrelated individuals free of neuropsychiatric disease, 109 individuals meeting City of Hope criteria for Tourette’s syndrome, 64 individuals with DSM-IV diagnoses of ethanol dependence, or 15 individuals with ADHD. These data are consistent with substantial evolutionary conservation of the DAT protein sequence. They suggest that gene variants that alter levels of DAT expression provide the best current candidate mechanism for reported associations between DAT gene markers, ADHD and other more tentatively associated neuropsychiatric disorders. Molecular Psychiatry (2000) 5, 283–292. Keywords: polymorphism; chromosome 5p15.3; sequence; transmission disequilibrium test; psychiatric disorder

Introduction The human dopamine transporter (DAT) gene (SLC6A3) encodes the member of the neurotransmitter transporter gene family1 that reaccumulates the neurotransmitter dopamine into presynaptic terminals. This

Correspondence: Dr GR Uhl, Molecular Neurobiology, NIDA-IRP, 5500 Nathan Shock Dr, Baltimore, MD 21224, USA. E-mail: guhl얀intra.nida.nih.gov Current NIDA policy prevents Dr Uhl from listing his nonNIDA affiliations. 2 Present address: Center for Development and Health Genetics and Department of Biobehavioral Health, The Pennsylvania State University, 101 Amy Gardner House, University Park, PA 16802, USA Received 21 June 1999; revised 17 August 1999 and 3 September 1999; accepted 3 September 1999

transporter is the primary regulator of the time course and synaptic concentration of released dopamine, which is a key neurotransmitter for regulation of mood and movement. Several lines of evidence suggest that variants of the dopamine transporter gene could play important roles in a number of neuropsychiatric disorders. Cocaine and other psychostimulants block DAT function; DAT has been postulated to be a key site for psychostimulant reward.2 The ability of virtually all abused substances to enhance dopamine release makes DAT a candidate contributor to vulnerability to many classes of abused substances. Other disorders with documented dopaminergic involvement in pathogenesis and/or treatment include Parkinson’s disease, schizophrenia, attention deficit hyperactivity disorder (ADHD) and Tourette’s syndrome.3–5 Dopamine trans-

DAT polymorphisms DJ Vandenbergh et al

284

porter inhibitors, including psychostimulants and bupropion, are currently among the most efficacious treatments in ADHD. In vitro studies of DAT site-directed mutants document that many single amino acid DAT substitutions selectively alter aspects of DAT function likely to be important for its selective properties.6 Transgenic mice with altered DAT expression, both knockouts and transgenic over-expressors, are differentially vulnerable to Parkinsonism-inducing neurotoxins,7 display different locomotor habituation patterns, and reveal differing locomotor responses to psychostimulants.8,9 DAT gene sequence variants are thus attractive candidates for contributing to several human disorders with significant morbidity and mortality. Previously-described DAT sequence variants have been used to analyze the potential genetic contribution of this gene to several of the disorders mentioned above. An allelic variant marked by a 10-copy variable number tandem repeat (VNTR) marker at the 3⬘ end of the DAT gene locus has been associated with ADHD in three independent family-based controlled studies,10–13 athough it could not be found in one association study.14 The 9-copy repeat has been found more frequently in unrelated cocaine abusers who report paranoid ideation with cocaine use.15 Suggestive linkage has been reported between DAT and bipolar disorder.16 More recently, alcohol withdrawal symptoms were found to be more pronounced in chronically intoxicated patients who had the 9-copy DAT allele.17 Association and/or linkage studies of VNTR marker frequencies have also been reported in drug abuse,18 alcohol abuse,19,20 schizophrenia,21,22 ADHD23 and Parkinson’s disease.24–26 These marker studies, however, do not provide maximal sensitivity for detecting polymorphisms across the entire DAT locus. More adequate evaluation of the possibility that DAT gene variants could contribute differences in protein coding requires additional DAT genomic sequence information as well as information about individual variants in the additional sequences. Initial work in elucidating human DAT genomic sequences revealed that the first 12 human DAT gene exons were distributed over at least 50 kb of genomic DNA located at chromosome 5p15.3.27 Alignment of these partial genomic clones with human DAT cDNA sequences indicated the presence of additional 3⬘ exons, including an exon containing the VNTR polymorphism that lies in the DAT cDNAs 3⬘ untranslated Table 1

Materials and methods DAT exons 13, 14 and 15. Isolation and complete sequence Genomic clones were isolated by standard hybridization screening of phage libraries (Clontech, Palo Alto, CA, USA) using probes from the 3⬘-end of the hDAT cDNA.28 Phage DNA was isolated from plate lysates using a phage DNA isolation kit (Stratagene, La Jolla, CA, USA) and subcloned into pBluescript II for subsequent analysis. Regions of the gene that were not found in these plasmids were cloned by long PCR using the LA PCR kit (TaKaRa, Panvera, Madison, WI, USA). Clones from the 5⬘-flank through exon 12, described in Donovan et al,27 have now been sequenced in their entirety. Automated sequencing of introns (single stranded) and exons (double stranded) was performed using ABI sequencers (Applied Biosystems, Foster City, CA, USA) at the Johns Hopkins Core Facility. Research volunteers Individuals volunteered for inclusion in study groups under appropriate informed consent provisions. Racial and ethnic classifications were determined by selfreport. Table 1 provides a brief summary of the volunteers from the three institutions that participated in this work. No research volunteer from the National Institute of Drug Abuse Intramural Research Program had any prominent current psychiatric symptomatology. None had a Symptomatology Check List (SCL90) t score more than 70, and high values in any single category excluded potential subjects from participation. Control individuals from Toronto were free from psychiatric disorders as determined by the Pharmaco Dependence Health Questionnaire.29 A total of 128 Caucasian controls of western and northern European descent were recruited in a study

Research volunteers and DAT sequence variation detection

Institution NIDA U. Chicago U. Toronto U. Toronto/ City of Hope a

region. We now report complete elucidation of the primary sequence of the entire DAT gene and more than 8 kb of 5⬘-flanking sequence. Variants in these sequences have been identified by single-stranded conformational polymorphism and direct sequencing of DNA amplified from each DAT genomic exon and from several introns. We have examined both disease populations and individuals free of neuropsychiatric disorders.

na

Study

DNA variant detection

20 47 128 174

Addiction ADHD Alcoholism Tourette’s syndrome

Direct sequencing of PCR products SSCPb and direct sequencing of PCR products SSCP and sequencing of cloned PCR productsc SSCP and sequencing of cloned PCR products

Number of individuals including controls for each group. SSCP – Single Strand Conformation Polymorphism. c Multiple isolates of PCR products were sequenced independently to minimize cloning artifacts. b

Molecular Psychiatry


of drug abuse at the National Institute on Drug Abuse Intramural Research Program. Additional control volunteers, free from diagnoses of psychiatric disorders, were recruited from an adjacent hemodialysis unit and a public health facility studying HIV infection in Baltimore. For exon sequencing to detect new mutations, individuals were selected on the basis of DAT VNTR allele status (described below under direct sequence screening for variants) and included some AfricanAmericans who attended a Baltimore area sickle-cell anemia clinic.30 The families of 47 child or adolescent probands with DSM-III-R ADHD31 (Am. Psych. Assoc.) diagnoses made at the University of Chicago Hyperactivity, Attention, and Learning Problems (HALP) clinic between April 1993 and October 1994 formed the ADHD sample tested previously for linkage disequilibrium with the 3⬘-DAT VNTR.10 Fifteen of these individuals were chosen based on their having received the 3⬘-VNTR 10-copy allele from at least one heterozygous parent. These individuals were screened for polymorphisms in the DAT gene by both SSCP and bidirectional sequencing. Unrelated Caucasian individuals of non-Hispanic, northern or western European descent were sampled at the Centre for Addiction and Mental Health (CAMH), Toronto, Canada. Sixty-four individuals meeting DSMIII-R diagnoses of alcohol dependence were compared to 64 matched controls free from alcohol dependence selected from the CAMH. Tourette’s clinic patients consisted of consecutive, unrelated individuals of non-Hispanic, northern or western European descent. There were 109 probands treated at the TS clinic of the City of Hope National Medical Center (COH). Eighty-two percent met DSM diagnosis of TS and 18% had other chronic motor or vocal tic disorders. Thirty-five of these volunteers responded positively to DIS/DSM-III-R questions about ADHD and 22 to questions about obsessive compulsive disorder. These results were compared to those of a control group consisting of 67 individuals from the CAMH. All comparisons of unrelated individuals by allele status and disorder phenotype were made by ␹2 analyses, with the exception of the ADHD families. ADHD families, who were analyzed by the Transmission Disequilibrium Test (TDT)32 were not separated by race since the TDT provides an internal control for racial stratification, all other subjects were of northern and western European descent.

Research volunteer DNA Blood samples were obtained by venipuncture following informed consent. Genomic DNA was isolated by phenol extraction and ethanol precipitation of DNA from most blood samples as previously described.30 DNA samples from the University of Chicago were isolated without phenol, as previously described.10

DAT VNTR and TaqA polymorphism detection by PCR and PCR-RFLP A previously described polymorphism initially detected by Southern analyses of TaqI digests28 was detected by PCR amplification using the oligonucleotide primers HDATTaqAFor (5⬘-CCGTGCCAGCTCC TGCTG-3⬘) and HDATTaqARev (5⬘-GACCTCAGT GGTGTCTGTTGATACGG-3⬘) for 35 cycles of 98°C for 10 s, 67°C for 60 s, 72°C for 60 s followed by TaqI digestion and polyacrylamide gel electrophoresis. The expected band sizes are 623 bp for the A1 allele, and 423 plus 200 bp for the A2 allele. The exon 15 VNTR was amplified using the oligonucleotide primers T3-5Long (5⬘-TGTGGTGTA GGGAACGGCCTGAG-3⬘) and T7-3aLong (5⬘CTTCCTGGAGGTCACGGCTCAAGG-3⬘) under conditions previously described.33

285

Intron polymorphisms Alleles of an intron 8 VNTR were detected by PCR amplification of 40 ng of genomic DNA from 21 Caucasian and 24 African-American control individuals using the primers Int8RepFor (5⬘-GCACAAAT GAGTGTTCGTGCATGTG-3⬘) and Int8RepRev (5⬘AGCAGGAGGGGCTTCCAGGC-3) and 35 cycles of 98°C for 10 s and 67°C for 60 s, which was initiated by the addition of Taq polymerase in the first cycle at 82°C (Hot Start). Fragment sizes are 260 bp and 290 bp for the five- and six-copy alleles respectively, determined using 5% polyacrylamide gel electrophoresis. SSCP analyses Sequences of the oligonucleotides used as PCR primers to amplify each DAT exon and intron 14 are listed in Table 2. PCR reactions used 200 ng genomic DNA, 50 pmol of each oligonucleotide primer, 300 ␮M dNTP, 1.5 mM MgCl2, 0.5 U Taq DNA polymerase (Life Technologies, Gaithersburg, MD, USA) and 40 cycles of 95°C for 30 s, 60–68°C for 40 s, and 72°C for 40 s in a Perkin Elmer GeneAmp 9600. For SSCP analyses conducted at the University of Toronto on samples from the COH and CAMH, PCR products were diluted 1:4 in SSCP loading buffer (0.04% SDS, 16 mM EDTA, 57% formamide, 0.03% bromophenol blue and 0.03% xylene cyanol) heated at 95°C for 5 min, and rapidly cooled to 0°C for 5 min before electrophoresis using Novex Xcell II minicells.34,35 Five sets of condition variants were used: (a) 400 volts, 10 mA at 2.5 W; (b) 100 V-h; (c) 6°C in loading buffer without glycerol; (d) 15°C in loading buffer containing glycerol; and (e) 100 volts for 18 h at 4°C on 4–20% TBE gradient gels. DNA was visualized by silver staining. Samples in which variants were detected by SSCP were cloned (pBluescript), and multiple isolates were sequenced manually [USB Sequenase PCR Product Sequencing (Cleveland, OH, USA), or Pharmacia-Biotech T7 sequencing (Uppsala, Sweden)] to identify the nucleotides responsible for the variations. SSCP electrophoresis at the University of Chicago was performed using Phast System 20% polyacrylamide gels at 6°C without glycerol in the loading buffer, Molecular Psychiatry


286

Table 2

(a) Human DAT exon primers for SSCP analysis

Namea

Sequence (5⬘–3⬘)

Ex2ForBd 2Cld (Ex2) DAT122sd (Ex 2) Ex2RevBd Ex3ForA Ex3RevA Ex4For Ex4Rev Ex5ForA Ex5RevA Ex6ForA Ex6RevA Ex7ForA Ex7RevA Ex8ForA Ex8RevA Ex9ForA Ex9RevA Ex10ForA Ex10RevA Ex11ForA Ex11RevA Ex12ForA Ex12RevA Ex13ForA Ex13RevA Ex14ForB Ex14RevB Ex15ForA HDAT2110a

Table 2

TGCCCTCCGCACCAGGTATG CAAAGCCAATGACGGACAG CGTGGGACTCATGTCTTCCGTGG CCCCGGCTGCACCTACGAC ACGAGGAGAGATGGGCCCTTCC GTCACCACCATGATCCGCGC GTTGCTGATGGTGGCTCTGTGCT GCTGCGCCATCTCTCCCG TTCCAGGTGGGTTGACAGCCAC TTGGTGGCCCCATGTCTACAGG CCCACCAAGGGCCCTGCC TGGGAATGCCAGAGCCCCTG CTCAGGTCCTTTGCCTGTGGC GACCTCTCCCTAGTATTGATGAGGCC ATTGCAGCTGCTGCAGCTCAGC CGGCGCTGGTGCTACACGG CGGGGTGGGGCAGGATG CGGGTGGAAGGAACCCAACTG GGCCCAGGCTGCGGTCAG CCTGACAGTCCCAGCCAGGGC CCCCAGGCTGGGTTTACCTCTGG GAAGGGGAGTGGCACAGCCACC TGTCCAGCATCGGGGGAATG GTGCCAGAGTGGGGGCAGTG CCTGCTTTGTCCTGGCACCG GACACCCACGGAGCCTTTCTGG GGTCCTGACAGTGTGAGTCAGTGGTG GGGCTAAGAACACTGAGCTTGGGATC TGCTCTTAGCCACCTTCAGCTGCTC GGAGTCTTCTGCTTTGTTGTTTGTGTTTTCAGT

Positionb

10 138 10 496 10 228 10 616 11 924 12 167 20 727 21 067 31 300 31 540 32 614 32 852 36 467 36 688 37 864 38 093 41 242 41 479 42 757 43 029 43 477 43 705 46 327 46 547 49 384 49 676 51 467 51 692 57 706 57 951

(85) (–) (–) (63) (58) (54) (62) (44) (54) (48) (51) (53) (66) (52) (55) (50) (70) (55) (61) (83) (65) (64) (61) (59) (61) (74) (82) (72) (76) (–)

Size (bp)

Annealing temp.

M13 primerc

359

60

329

68

244

68

240

68

– Rev Rev – – For –

241

66

–

239

68

222

63

230

68

237

66

240

66

229

68

220

67

233

66

144

64

246

67

– For – – – – – – – For – Rev For – Rev For Rev For – –

(b) Additional hDAT primers for sequencing

Name

Ex3ForB Ex4ForA Ex4RevA Ex5ForB Ex5RevB Ex6ForB Ex7RevB Ex8ForC Ex9RevA Ex9RevA Ex10ForB Ex12RevB

Sequence (5⬘–3⬘)

TGGGGTAGCCGCCCAAGCTC GGAAGGGACACGTTGCTGAT GCGCCATCTCTCCCGTTC GCTCAGCCGTCCAGTTCCAGG CGGCCACATGTCCACTTGGTG TGTGCCAGTGTCTGCTCCCACC TGGAAGTCAGCGACCTCTCCCTAG GCCCCCTTCCCCAGACACAG CGGGGTGGGGCAGGATG CGGGTGGAAGGAACCCAACTG GTGTGCGTCCACTGGGTGACAAG GTGCCAGAGTGGGGGCAGTG

Fragment size 266 349 182 187 233 180 238 304 220

Positionb (nt) 11902 20716 21064 31286 31555 32598 36699 37820 41242 41479 42726 46547

(80) (77) (41) (68) (63) (67) (63) (99) (70) (55) (92) (59)

Annealing temp

60 67 68 64 66 67 67

M13 primerc – For Rev Rev For Rev For – – – Rev –

a Abbreviations for primer names are Ex for exon, For or Rev to indicate the forward and reverse orientation of each primer, and followed by a letter to indicate the number of primers tried in order to find one generating sufficient amplified product. b Nucleotide number of the primer’s 5⬘-end from GenBank accession No. AF119117 (distance of the 5⬘-end of the primer to the exon). c Primers used for sequence analysis with M13 Universal forward (for), or reverse (rev), primer tails on the 5⬘-end. Some primers (–) could not be tailed due to hairpin formation. d Exon 2 was amplified in two parts due to its size. The primers are listed sequentially in the pairs as used.



or at 15°C with glycerol. All samples from the University of Chicago were sequenced bidirectionally from PCR products, regardless of whether a variant was detected by SSCP or not. Direct sequencing failed to identify any variants not detected by SSCP screening under at least one set of conditions (see below). Direct sequence screening for variants Ten of the individuals from the NIDA samples were selected for direct sequence analysis without preceding SSCP analysis, based on the occurrence of exon 15 VNTR alleles containing at least one copy of the less common 3, 5, 7, 8 or 11 repeat variants. Ten additional individuals were selected based on their expression of the more common 9- or 10-copy variants to maximize the opportunities for finding novel alleles. Fifteen children from the University of Chicago, who had ADHD and evidence of transmission of the 10-copy allele from a heterozygous parent, were directly sequenced from both strands using primers that flanked each of the exons using an ABI 310 sequencer. DAT exons from DNA from NIDA and the University of Chicago, were amplified by PCR using the primers described in Table 2 and sequenced using universal M13 forward or reverse sequences (footnote and Table 2b), which had been included at the 3⬘ and 5⬘ ends of the primer sequences. For those exon primers that formed hairpins with an M13 tail, one of the two PCR primers was used for sequencing. Sequences generated have been submitted to GenBank (Accession No. AF119117).

287

Results Gene structure A total of 59747 bp of sequence comprising the complete DAT gene has been determined, including 8.6 kb of 5⬘-flanking sequence (Figure 1a) (GenBank accession No. AF119117). The sequences substantially supplement the 5622 bp of sequence previously reported,27 which described the immediate 5⬘ flank of the first exon, the first 12 exons, and minimal intron sequence. Exons 13 and 14, which could not be detected in genomic DNA libraries, were cloned by long PCR amplification using primer pairs specific to exons 13 and 14, and 14 and 15, followed by subcloning the PCR products (Figure 1c). Exon 15 of the DAT gene was identified in genomic clones by hybridization to DAT cDNA sequences. One of these clones, cosmid M77-1, was a generous gift from John Wasmuth and Deanna Church (University of California at Irvine) and also contains the anonymous marker D5S678 approximately 25 kb downstream of DAT exon 15 (data not shown). This independently determined DAT gene structure and sequence also completes the structure recently presented by Kawarai et al.36 The positions of exon/intron boundaries, shown in Table 3, are completely conserved with those of the norepinephrine,37 serotonin,38 and GABA transporters.39 Exon 13 encodes a small part of putative transmembrane domain 11 and all of transmembrane domain 12 of the DAT protein. Exon 14 is the smallest

Figure 1 (a) Map of the relative positions of the 15 DAT exons. Below the line are the single nucleotide polymorphisms found by direct sequencing and by SSCP. The two polymorphisms changing codons are shown by single letter code for the amino acids (V/A under exon 2 and A/V under exon 8; see text for nucleotide changes). The frequency of the less common allele (the second in each pair) is included. The TaqI polymorphism in intron 4,28 the VNTR in exon 15,33 and the anonymous marker D5S678 are also shown. (b) Linkage disequilibrium with corresponding D⬘ values between polymorphic sites in exons 2 (nt 215), 9 (nt 1316) and 15 (nt 1999, and VNTR). Significance values are shown by #P ⬍ 0.05; ##P ⬍ 0.001. (c) ␭ clones and PCR fragments containing DAT gene sequences are shown in position relative to the gene. Clones containing the first 12 exons were described in Donovan et al,27 and have been included here for a complete description of the gene. Molecular Psychiatry


288

Table 3 Exon 12 13 14

Exon intron boundaries of exons 12–15 of the human DAT gene EXON/intron junction

Intron No. (length)

TCCTGgtaag GAGAGgtggg TCACGgtgag

12 (2918) 13 (1946) 14 (6162)

Intron/EXON junction tgcagTTCGT (exon 13) ttcagAAACT (exon 14) tccagCTCCG (exon 15)

Exon positiona 49 445–49 602 51 549–51 620 57 782–57 747

a

Boundaries of the first 11 exons and the 5⬘ end of exon 12 were reported in Donovan et al,27 the nucleotide positions of these exons are: 1 (8034–8116), 2 (10 223–10 553), 3 (11 982–12113), 4 (20 789–21 023), 5 (31 354–31 492), 6 (32 665–32799), 7 (36 533– 36636), 8 (37 919–38043), 9 (41 312–41424), 10 (42 818–42 946), 11 (43 542–43 641), and 12 (46 388–46 488).

of the exons (71 nucleotides). Exon 15 encodes the last seven amino acids of DAT and all 1946 nucleotides of the 3⬘-untranslated region of the mRNA, and thus is as large as all of the other exons combined. The combined size of the exons (4 kb) agrees with the size of mRNA detected by Northern analysis.27 Sequences in intron 14 proved to be particularly unstable in bacterial vectors. Comparisons of the sequences of an intact intron 14 clone with those of several clones with deletions appeared to indicate that two copies of an Alu repetitive element contributed to this instability. These data add to previously reported observations to form the map of the human DAT gene (Figure 1). Repetitive element in intron 8 Studies of DAT genomic sequences revealed several markers for DAT variants. Intron 8 contained a VNTR polymorphism approximately 2.6 kb 3⬘ to exon 8 and 390 bp 5⬘ to exon 9. This VNTR consisted of either five or six copies of a 30-bp repetitive element. The 6-copy allele was found in 38% of Caucasian chromosomes, but was found in 79% of chromosomes from AfricanAmericans. An imperfect GT dinucleotide repeat was identified in intron 13, but was not polymorphic in more than 20 individuals studied (data not shown). Variants in exon sequences SSCP was used to analyze amplified products of the 15 DAT exons and exon-intron junctions from 109 Caucasian individuals with City of Hope criteria for Tourette’s syndrome and 67 Caucasian controls free of psychiatric diagnoses. DNA of exons 1, 3, 4, 5, 10 and 14 from these individuals revealed no evidence for polymorphisms by SSCP. Individuals from the University of Chicago (n = 15) also failed to reveal polymorphisms in these exons by SSCP analysis. Sequencing exon amplification products from unrelated individuals sampled at the NIDA-IRP also failed to identify any variants in exons 1, 3, 4, 5, 10 and 14. These results included data from individuals included in this sample based on their possession of the more uncommon 3, 5, 7, 8 or 11-copy VNTR alleles from exon 15. Three exons did reveal evidence for common sequence variants. Five additional less common sequence variants were also identified (Table 4). No common sequence variant altered the DAT protein sequence. Two of the rarer mutations do produce conservative amino acid changes. The exon 15 sequence Molecular Psychiatry

Table 4

DAT exon variantsa

Exon

cDNA Codon nt No.

2 2 2 2 6 7d 8 8 8 9 12 13 15

215 251 265 272 911 1079 1151 1169 1246 1316 1628 1832 1999

38 50 55 57 270 326 350 356 382 405 509 577 UTRc

wt codon (aa)

Variant (aa)b

Freq of variant (%)

AAC (Asn) CCG (Pro) GTG (Val) GCC (Ala) GCC (Ala) TTC (Phe) ACC (Thr) ACG (Thr) GTG (Val) TCA (Ser) CAG (Gln) GCC (Ala) C

AAT CCT GCG (Ala) GCT GCT TTT ACA ACA GCG (Ala) TCG CAA GCT T

12 18 ⬍1 5 14 6 5 34 ⬍1 33 ⬍1 5 26

a Abbreviations; nt, nucleotide; wt, wild type; aa, amino acid (using standard three letter abbreviation); freq, frequency; SSCP, Single Stranded Conformation Polymorphism; Seq., sequencing; UTR, untranslated region (GenBank M95167 GI: 181655). b Only non-conservative changes are indicated. c Frequency is based on 329, the total number of individuals screened. d Only detected by sequencing, all others detected by both SSCP and sequencing.

variant listed in Table 4 resulted from a T substituted for the more common C at base pair 1999, which lies at the beginning of the 3⬘ untranslated region of the DAT mRNA and 715 nucleotides 5⬘ to the previouslyreported VNTR in exon 15. However, only the first 200 nucleotides of the exon, containing the last 21 nucleotides of coding region, were tested for variants. Other variants might be present in the remainder of the 3⬘ untranslated region. Relationship of polymorphisms to disease When all of the ADHD subjects (n = 47) from the earlier study of the exon 15 VNTR10 were considered with the exon 15 VNTR, strong preferential transmission of the 10-copy form was again detected as previously reported using HHRR analyses (TDT ␹2 = 7.00, 1 df, P = 0.008). Transmission disequilibrium was also detected by the exon 15 nucleotide 1999 polymorphism, (TDT ␹2 = 4.48, 1 df, P = 0.034), but was weaker


289

Figure 2 Frequency of transmission vs nontransmission of the 10-copy VNTR allele in children with ADHD (␹2 = 4.48, 1 df, P = 0.034). No evidence was found for distortion of transmission for exons 2 and 9.

than the finding with the VNTR in the same sample (Figure 2). There was no evidence of transmission disequilibrium of either the exon 2 or the exon 9 polymorphisms in individuals with ADHD. Values for the exon 2 TDT ␹2 was 0.5, 1 df, P = 0.480, and the exon 9 TDT ␹2 was 0.18, 1 df, P = 0.671. There were no striking differences in the frequencies of any of these single nucleotide sequence variants in any of the populations studied by case-controlled association tests (Figure 3), although the low number of rarer mutations identified here provides us with less opportunity to assess their possible impact. The exon 15 nucleotide 1999 allelic variant was present in 26% of 148 unrelated parental chromosomes examined at the University of Chicago and 45% of the chromosomes from unrelated NIDA volunteers. SSCP analysis of the exon 15 single-nucleotide polymorphism showed that it was present at similar frequencies in Caucasian alcoholics (27%), and individuals with Tourette’s syndrome (20%). Frequencies in individuals with Tourette’s syndrome comorbid with ADHD were 21%, and in Tourette’s syndrome with features of obsessive/ compulsive disorder the frequency was 22%.

Discussion For simple genetic disorders, assessment of the coinheritance of an informative candidate gene locus

marker along with the trait can allow straightforward confirmation or exclusion of the hypothesis that genetic variation at the locus causes the disease with high statistical certainty.40 Although it would be desirable to approach this degree of certainty for the many common disorders that display complex genetic bases, these disorders often display evidence for genetic heterogeneity, substantial environmental influences and other features that make classical genetic analyses more difficult. Virtually all of the disorders for which DAT is a plausible candidate locus fall into this more complex genetic category.41 Thus, any relationship between the DAT gene and neuropsychiatric disorders will be likely to be complex even though DAT remains a strong candidate to contribute, along with other genes, to these traits. As Falconer notes, ‘Quantitative differences, in so far as they are inherited, (may) depend on genes whose effects are small in relation to the variation arising from other causes.’42 Understanding of the inheritance of such differences nevertheless may lead to greater understanding of both genetic and non-genetic contributions to these disorders that, collectively, provide substantial morbidity and mortality. To be able to include or exclude roles for DAT gene variants in dopamine-related disorders with increasing confidence, we need to develop more detailed knowledge of the locus, and the genetic variability that the Molecular Psychiatry


290

Figure 3 Allele frequencies of Tourette’s clinic and alcohol-dependent volunteers from the City of Hope and the Toronto populations, respectively for exon 2 C/T (a), exon 9 G/A (b), exon 15 C/T (c), and exon 15 VNTR (d). The data are presented for the more common allele at each site, expressed as % of controls for each group except in the case of the exon 2 polymorphism, for which DNA from controls without alcohol dependence was not available. No differences were statistically significant (P values ranged from 0.16 to 0.93). *For exon 2, the C/T polymorphism detected is at nucleotide 272.

locus displays in different populations. This information will allow more and more of the locus to be excluded as making significant contribution to these disorders with increasing confidence. The exact sites responsible for positive associations can also be established with increasing precision. Because association and affected-sib-pair model studies have provisionally implicated DAT gene alleles in several such disorders, closer examination of this gene’s sequences sufficient to define human variation at this locus and to allow near ‘exclusion’ of variation at this gene in these disorders is of particular importance. Since the DAT marker tentatively implicated in several disorders lies in the gene’s 3⬘ region, improving definition of the last three DAT exons and close examination of each protein-coding sequence in normal and disease populations is an important step in this process. Exclusion of allelic variations in unselected population samples or in disease sub-populations requires examination of relatively large numbers of individuals, made practical with use of SSCP or related methods such as denaturing gradient gel electrophoresis (DGGE).43 Examination with direct sequencing also improves our confidence in Molecular Psychiatry

the sensitivity with which we can detect any common allelic variations or mutations. Our analyses have defined the structures of each of the DAT gene’s exons, and have identified three common silent third-position polymorphisms that allow improved sensitivity for association studies of neuropsychiatric disorders. Although the frequency of the exon 15 polymorphism in the 20 Canadian individuals with selfreported African ancestry described here appears higher than that in other control and disease populations, previous work in substantially larger African American samples failed to reveal significant differences in the frequencies of these markers. We thus cannot now conclude that dramatic racial differences exist for this marker. The current results should be extended to larger African Canadian samples. Sub-Saharan African populations can display substantial genetic diversity,44 highlighting the need for larger studies in African Canadian and African American populations. No individual in any of the disease sub-populations selected displayed any polymorphism that was totally absent in control disease-free individuals (Figure 3).


The higher frequencies of the more common exon 2 and exon 9 polymorphisms allow us to relatively confidently exclude any robust association between variants at these portions of the DAT gene locus and the disorders for which significant numbers of individuals were sampled. No contribution to either Tourette’s syndrome spectrum or alcohol dependence is supported from this work. These marker frequencies are also similar in polysubstance abuser and control clinical populations.18 Single studies have also suggested that 9copy VNTR frequencies are elevated in the cocaine abuser subpopulation that experience paranoia with cocaine use,15 alcoholics who are habitually violent45 and alcoholics who display more pronounced alcohol withdrawal.17 In the ADHD samples in which the exon 15 VNTR association was initially described,10,46 the single nucleotide 1999 exon 15 C allelic variant was also preferentially transmitted to children with ADHD. There was no evidence of preferential transmission of either DAT exon 2 or 9 markers to the ADHD children, however. This comprehensive evaluation of 2053 bp of DAT gene exons and about 700 bp of flanking sequence has identified 16 sequence variants, 12 in exon sequences. Only two of the rarer variants result in amino acid substitution, none of the others change the DAT protein coding sequence. This substantial conservation is consistent with the idea that normal DAT function is evolutionarily important. These data are also consistent with the conservation of this transporter gene’s structure with those of other transporter gene family members, even those located on other chromosomes.37–39 Such data, as well as other work mentioned above, provide increasing interest in the possibility that level-ofexpression variation, rather than protein sequence variants, may provide the common individual differences at the human DAT gene locus. Mutations in promoter/enhancer regions of this gene could even provide a significant impact on the dopaminergic brain function and dysfunction.

4

5

6

7

8

9

10

11

12

13

14

15

16

17

Acknowledgements The authors would like to thank Dr Carlo Contoreggi, Ms Judith Hess, Ms Brenda Campbell, and Dr Mark Stein for assistance in clinical characterization sample collection from NIDA-IRP subjects. We would also like to thank Shuya Yan and Roxann Ingersoll for expert technical assistance. This work was supported financially by NIDA’s Intramural Research Program, and grants from CAMH, the Medical Research Council of Canada, and NIDA.

References 1 Uhl GR, Johnson PS. Neurotransmitter transporter: three important gene families for neuronal function. J Exp Biol 1994; 196: 229–236. 2 Ritz MC, Lamb RJ, Goldberg SR, Kukor MJ. Cocaine receptors on dopamine transporters are related to self-administration of cocaine. Science 1987; 237: 1219–1223. 3 Singer HS, Hahn I-H, Moran T. Abnormal dopamine uptake sites

18

19

20

21

22

23

in postmortem striatum from patients with Tourette’s syndrome. Ann Neurol 1991; 30: 558–562. Wong DF, Harris JC, Naidu S, Yokoi F, Marenco S, Dannals RF et al. Dopamine transporters are markedly reduced in Lesch-Nyhan disease in vivo. Proc Natl Acad Sci 1996; 93: 5539–5543. Wong DF, Ricaurte G, Grunder G, Rothman R, Naidu S, Singer H et al. Dopamine transporter changes in neuropsychiatric disorders. Adv Pharm 1998; 42: 219–223. Uhl GR, Lin Z, Metzger T, Dar D. Dopamine transporter mutants, small molecules, and approaches to cocaine antagonist/dopamine transporter disinhibiter development. Met Enz 1998; 296: 456–465. Gainetdinov RR, Fumagalli F, Jones SR, Caron MG. Dopamine transporter is required for in vivo MPTP neurotoxicity: evidence from mice lacking the transporter. J Neurochem 1997; 69: 1322– 1325. Giros B, Jaber M, Jones SR, Wightman RM, Caron MG. Hyperlocomotion and indifference to cocaine and amphetamine in mice lacking the dopamine transporter. Nature 1996; 379: 606–612. Sora I, Wichems C, Takahashi N, Li X-F, Zeng Z, Revay R et al. Cocaine reward models: conditioned place preference can be established in dopamine- and in serotonin-transporter knockout mice. Proc Natl Acad Sci 1998; 95: 7699–7704. Cook EHJ, Stein MA, Krasowski MD, Cox NJ, Olkon DM, Kieffer JE et al. Association of attention-defect disorder and the dopamine transporter gene. Am J Hum Genet 1995; 56: 993–998. Waldman ID, Rowe DC, Abramowitz A, Kozel S, Mohr J, Sherman SL et al. Association and linkage of the dopamine transporter gene and attention-deficit hyperactivity disorder in children: heterogeneity owing to diagnostic subtype and severity. Am J Hum Genet 1998; 63: 1767–1776. Gill M, Daly G, Heron S, Hawi Z, Fitzgerald M. Confirmation of association between attention deficit hyperactivity disorder and a dopamine transporter polymorphism. Mol Psychiatry 1997; 2: 311–313. Daly G, Hawi Z, Fitzgerald M, Gill M. Mapping susceptibility loci in attention deficit hyperactivity disorder: preferential transmission of parental alleles at DAT1, DBH and DRD5 to affected children. Mol Psychiatry 1999; 4: 192–196. LaHoste GJ, Swanson JM, Wigal SB, Glabe C, Wigal T, King N et al. Dopamine D4 receptor gene polymorphism is associated with attention deficit-hyperactivity disorder. Mol Psychiatry 1996; 1: 121–124. Gelernter J, Kranzler HR, Satel SL, Rao PA. Genetic association between dopamine transporter protein alleles and cocaine-induced paranoia. Neuropsychoparmacology 1994; 11: 195–200. Kelsoe J, Sadovnick AD, Kristbjarnarson H, Bergesch P, Mroczkowski-Parker Z, Drennan M et al. Possible locus for bipolar disorder near the dopamine transporter on chromosome 5. Am J Med Genet 1996; 67: 533–540. Schmidt LG, Harms H, Kuhn S, Rommelspacher H, Sander T. Modification of alcohol withdrawal by the A9 allele of the dopamine transporter gene. Am J Psychiatry 1998; 155: 474–478. Persico AM, Vandenbergh DJ, Smith SS, Uhl GR. Dopamine transporter gene markers are not associated with polysubstance abuse. Biol Psychiatry 1993; 34: 265–267. Muramatsu T, Higuchi S. Dopamine transporter gene polymorphism and alcoholism. Biochem Biophys Res Com 1995; 211: 28– 32. Sander T, Harms H, Podschus J, Finckh U, Nickel B, Rolfs A et al. Allelic association of a dopamine transporter gene polymorphism in alcohol dependence with withdrawal seizures or delirium. Biol Psychiatry 1997; 41: 299–304. Daniels J, Williams JD, Asherton P, McGuffin P, Owen M. No association between schizophrenia and polymorphisms within the genes for debrisoquine 4-hydroxylase (CYP2D6) and the dopamine transporter (DAT). Am J Med Gen 1995; 60: 85–87. Persico AM, Wang ZW, Black DW, Andreasen NC, Uhl GR, Crowe RR. Exclusion of close linkage of the dopamine transporter gene with schizophrenia spectrum disorders. Am J Psychiatry 1995; 152: 134–136. Comings DE, Wu S, Chui C, Ring RH, Gade R, Ahn C et al. Polygenetic inheritance of Tourette’s syndrome, stuttering, attention defect hyperactivity, conduct and oppositional defiant disorder: the addi-

291



292 24

25

26

27

28

29

30

31

32

33

34

tive and subtractive effect of the three dopaminergic genes—DRD2, DBH, and DAT1. Am J Med Genet 1996; 67: 264–288. Higuchi S, Muramatsu T, Arai H, Hayashida M, Sasaki H, Trojanowski JQ. Polymorphisms of dopamine receptor and transporter genes and Parkinson’s disease. J Neural Transm 1995; 10: 107–113. LeCouteur DG, Leighton PW, McCann SJ, Pond SM. Association of a polymorphism in the dopamine transporter gene with Parkinson’s disease. Mov Disord 1997; 12: 760–763. Leighton PW, LeCouteur DG, Pang CC, McCann SJ, Chan D, Law LK et al. The dopamine transporter gene and Parkinson’s disease in a Chinese population. Neurology 1997; 49: 1577–1579. Donovan DM, Vandenbergh DJ, Perry MP, Bird GS, Ingersoll R, Nanthakumar E et al. Human and mouse dopamine transporter genes: conservation of 5⬘-flanking sequence elements and gene structures. Am J Med Genet 1995; 3: 327–335. Vandenbergh DJ, Persico AM, Uhl GR. A human dopamine transporter cDNA predicts reduced glycosylation, displays a novel repetitive element and provides racially-dimorphic Taq I RFLPs. Mol Brain Res 1992; 15: 161–166. Tyndale RM, Droll KP, Sellers EM. Genetically defined CYP2D6 metabolism provides protection against oral opiate dependence. Pharmacogenetics 1997; 7: 375–379. Smith SS, O’Hara BF, Persico AM, Gorelick DA, Newlin DB, Vlahov D et al. Genetic vulnerability to drug abuse: the dopamine D2 receptor TaqI B1 RFLP appears more frequently in polysubstance abusers. Arch Gen Psychiatry 1992; 49: 723–727. American Psychiatric Association. Diagnostic and Statistical Manual of Mental Disorders. American Psychiatric Association: Washington DC, 1987. Spielman RS, McGinnis RE, Ewens WJ. Transmission test for linkage disequilibrium: the insulin gene region and insulin-dependent diabetes mellitus (IDDM). Am J Hum Genet 1993; 52: 506–516. Vandenbergh DJ, Persico AM, Hawkins AL, Griffin CA, Li X, Jabs EW et al. Human dopamine transporter gene (DAT1) maps to chromosome 5p15.3 and displays a VNTR. Genomics 1992; 14: 1104– 1106. Bardeesy N, Pelletier J. Mutational detection by single stranded conformational polymorphism. Meth Neurosci 1995; 26: 163–183.

35 Thompson M, Comings DE, Feder L, George SR, O’Dowd BF. Mutation screening of the dopamine D1 receptor gene in Tourette’s syndrome and alcohol dependent patients. Am J Med Genet 1998; 81: 241–244. 36 Kawarai T, Kawakami H, Yamamura Y, Nakamura S. Structure and organization of the gene encoding human dopamine transporter. Gene 1997; 195: 11–18. 37 Porzgen P, Bonisch H, Bruss M. Molecular cloning and organization of the coding region of the human norepinephrine transporter gene. Biochem Biophys Res Com 1995; 215: 1145–1150. 38 Lesch KP, Balling U, Gross J, Strauss K, Wolozin BL, Murphy DL et al. Organization of the human serotonin transporter gene. J Neural Transm 1994; 95: 157–162. 39 Liu QR, Mandiyan S, Nelson H, Nelson N. A family of genes encoding neurotransmitter transporters. Proc Natl Acad Sci 1992; 89: 6639–6643. 40 Lander ES, Schork NJ. Genetic dissection of complex traits. Science 1994; 265: 2037–2048. 41 Uhl GR, Gold LH, Risch N. Genetic analyses of complex behavioral disorders. Proc Natl Acad Sci 1997; 94: 2785–2786. 42 Falconer DS. Introduction to Quantitative Genetics, 3rd edn. John Wiley & Sons: New York, 1989, p 1. 43 Abrams ES, Murdaugh SE, Lerman LS. Comprehensive detection of single base changes in human genomic DNA using denaturing gradient gel electrophoresis and a GC clamp. Genomics 1990; 7: 463–475. 44 Tishkoff SA, Dietzsch E, Speed W, Pakstis AJ, Kidd JR, Cheung K et al. Global patterns of linkage disequilibrium at the CD4 locus and modern human origins. Science 1996; 271: 1380–1387. 45 Tiihonen J, Kuikka J, Bergstrom K, Hakola P, Karhu J, Ryynanen O-P et al. Altered striatal dopamine re-uptake site densities in habitually violent and non-violent alcoholics. Nature Med 1995; 1: 654–657. 46 Cook EJ, Stein MA, Leventhal BL. Family-based association of the dopamine transport gene in attention deficit disorder. In: Blum K, Nobel EP (eds). Handbook of Psychiatric Genetics. CRC Press: New York, 1997, pp 297–310.

This article is a ‘United States Government Work’ paper as defined by the US Copyright Act.
