Lipids (2014) 49:1181–1192 DOI 10.1007/s11745-014-3954-z
ORIGINAL ARTICLE
Hydroxyoctadecadienoic Acids Regulate Apoptosis in Human THP-1 Cells in a PPARc-Dependent Manner Venkat N. Vangaveti • Venkatesh M. Shashidhar • Catherine Rush • Usman H. Malabu • Roy R. Rasalam • Fiona Collier • Bernhard T. Baune Richard L. Kennedy
•
Received: 31 March 2014 / Accepted: 11 September 2014 / Published online: 21 October 2014 Ó AOCS 2014
Abstract Macrophage apoptosis, a key process in atherogenesis, is regulated by oxidation products, including hydroxyoctadecadienoic acids (HODEs). These stable oxidation products of linoleic acid (LA) are abundant in atherosclerotic plaque and activate PPARc and GPR132. We investigated the mechanisms through which HODEs regulate apoptosis. The effect of HODEs on THP-1 monocytes and adherent THP-1 cells were compared with other C18 fatty acids, LA and a-linolenic acid (ALA). The number of cells was reduced within 24 hours following treatment with 9-HODE (p \ 0.01, 30 lM) and 13 HODE (p \ 0.01, 30 lM), and the equivalent cell viability was also decreased (p \ 0.001). Both 9-HODE and 13-HODE (but not LA or ALA) markedly increased caspase-3/7 activity (p \ 0.001) in both monocytes and adherent THP1 cells, with 9-HODE the more potent. In addition, 9-HODE and 13-HODE both increased Annexin-V labelling of cells (p \ 0.001). There was no effect of LA, ALA, or the PPARc agonist rosiglitazone (1lM), but the effect of
V. N. Vangaveti V. M. Shashidhar U. H. Malabu R. R. Rasalam School of Medicine and Dentistry, James Cook University, Townsville, QLD, Australia
HODEs was replicated with apoptosis-inducer camptothecin (10lM). Only 9-HODE increased DNA fragmentation. The pro-apoptotic effect of HODEs was blocked by the caspase inhibitor DEVD-CHO. The PPARc antagonist T0070907 further increased apoptosis, suggestive of the PPARc-regulated apoptotic effects induced by 9-HODE. The use of siRNA for GPR132 showed no evidence that the effect of HODEs was mediated through this receptor. 9-HODE and 13-HODE are potent—and specific—regulators of apoptosis in THP-1 cells. Their action is PPARcdependent and independent of GPR132. Further studies to identify the signalling pathways through which HODEs increase apoptosis in macrophages may reveal novel therapeutic targets for atherosclerosis. Keywords Monocytes Macrophages Apoptosis Oxidized lipids Abbreviations HODEs Hydroxyoctadecadienoic acids PPARc Peroxisome proliferator-activated receptor gamma GPR132 G protein-coupled receptor-132 15-LOX-1 15-Lipoxygenase-1 oxLDL Oxidised low-density lipoprotein
C. Rush School of Veterinary and Biomedical Sciences, James Cook University, Townsville, QLD, Australia F. Collier R. L. Kennedy (&) Department of Medicine, Faculty of Health, Deakin University, Waurn Ponds Campus, Geelong, VIC 3220, Australia e-mail:
[email protected] B. T. Baune Department of Psychiatry, University of Adelaide, Adelaide, SA, Australia
Introduction Linoleic acid (LA; C18:2), an omega-6 fatty acid, is the most abundant polyunsaturated fatty acid in atherosclerotic plaque, and its stable oxidation products, hydroxyoctadecadienoic acids (HODEs), accumulate in the low-density
123
1182
lipoprotein (LDL) of plaque [1–3]. The two major HODE isomers are 9-HODE and 13-HODE. The latter, an omega7 fatty acid, is the major product of 15-lipoxygenase-1 (15LOX-1) when LA is the substrate [4, 5], and accumulates in early atherosclerosis [4, 6, 7]. In more advanced lesions, non-enzymatic oxidation is the predominant process leading to HODE formation [4, 8], and this generates an equal mixture of 13-HODE and the omega-6 fatty acid 9-HODE [9]. There is growing evidence that HODEs are not simply markers for lipid accumulation and oxidative stress, but that they also have signalling functions in macrophages. Oxidised low-density lipoprotein (oxLDL) has long been recognised as a regulator of macrophage functions, including lipid accumulation and foam cell formation, as well as chemokine and cytokine expression [10–14]. These effects are mediated through activation of the peroxisome proliferator-activated receptor-gamma (PPARc) nuclear transcription factors, which are generally understood to have a protective role in relation to atherosclerosis [15]. Activation of circulating monocytes, their adhesion to endothelial cells, and subsequent migration into the subendothelial space, followed by differentiation into macrophages and then foam cells, is a central process in atherogenesis. The macrophage content of the subendothelial space is a balance between monocyte accumulation and monocyte apoptosis, followed by clearance of dead and dying cells by phagocytes. [16] In early atherosclerosis, where clearance of damaged cells is efficient, the overall effect of macrophage apoptosis appears to be protective, with decreased cellularity of lesions and decreased lesion progression [17, 18]. In contrast, in later lesions, increased apoptosis coupled with decreased clearance of damaged cells leads to acellular necrotic lesions prone to rupture and thrombosis formation [19–21]. Apoptosis is a complex process, and much remains to be discovered with regard to how it is regulated in atherosclerotic lesions. It is a dynamic process, and therefore is difficult to study in human pathological specimens. Animal models yield important information, but lesion progression involves multiple cell types; oxLDL is clearly an important regulator, but contains numerous molecular species, and its effects may depend on the degree of oxidation [22]. While oxysterols—the major component of oxLDL—have been known to induce apoptosis [23, 24], HODEs are attractive candidates as regulators of macrophage apoptosis since they have established signalling functions through molecules known to be involved in atherogenesis. To date, there are only two studies [5, 25] that have focused on HODEs as potential regulators of macrophage apoptosis. In the first study [5], 13-HODE was reported to increase apoptosis through a mechanism distinctly involved in the increased expression of the scavenger receptor CD36. The effect of
123
Lipids (2014) 49:1181–1192
9-HODE was not investigated. In the second study, [25] 9-HODE (but not 13-HODE) was reported to increase apoptosis via a mechanism that was independent of PPARc. Furthermore, the cell-surface G protein-coupled receptor 132 (GPR132, also known as G2A) has recently been identified as a receptor for oxidised fatty acids, with 9-HODE the most potent ligand [26–28]. GPR132 is expressed in the macrophages of atherosclerotic plaques both in animal models and in humans [29]. From studies with genetically modified mouse models, GPR132 is thought to be involved in the pathogenesis of atherosclerosis [30–34], although it is not clear at present whether effects mediated through GPR132 are generally protective or harmful in relation to human atherosclerosis [26, 27]. Our objective was to investigate the apoptotic effects of 9-HODE and 13-HODE on monocytes and macrophages. We used the human monocytic leukaemia cell line THP-1 (monocytes) and PMA-differentiated adherent THP-1 cells that exhibit macrophage-like characteristics [35] and caspase activity [36], and therefore considered it appropriate to investigate the effects of two isomers of HODE on apoptosis. We aimed to determine whether the effects of HODEs were mediated by PPARc, GPR132, or both. Apart from gaining further insight into the pathogenesis of atherosclerosis, this study offers the potential for novel therapeutic strategies to diminish the burden of macrovascular disorders.
Materials and Methods Materials Reagents were purchased as follows: THP-1 cell line, PMA, ALA, LA, and camptothecin (Sigma-Aldrich); 9and 13- HODE and rosiglitazone (Cayman Chemical Company/Sapphire Bioscience Pty Ltd; NSW, Australia); RPMI medium, fetal bovine serum (FBS), L-glutamine, penicillin/streptomycin, Dulbecco’s phosphate-buffered saline (DPBS), and trypsin/0.38-g/L EDTA (Invitrogen; VIC, Australia); CellTiter-Glo luminescent cell viability assay for measuring the ATP released from viable cells, Apo-ONE homogeneous caspase-3/7 assay, CytoTox-Glo luminogenic cytotoxicity assay for measuring the dead-cell protease activity, and ApoTox-Glo Triplex Assay for measuring live- and dead-cell protease activity using fluorescence and caspase-3/7 activity using luminescence); Ac-DEVD-CHO (Promega; NSW, Australia); Annexin V and 7-AAD (BD Biosciences; North Ryde, NSW, Australia); RNeasy extraction kit and QuantiTect SYBR Green RT-PCR kit (Qiagen Pty Ltd; Vic, Australia); SAbiosciences RT2 qPCR primer sets for human GPR132,
Lipids (2014) 49:1181–1192
PPARc, FABP4, and PPIA (Jomar Diagnostics Pty Ltd; SA, Australia). Cell Culture THP-1 cells were maintained in RPMI with 10 % FBS, Lglutamine and penicillin/streptomycin at 37 °C in 5 % CO2. Monocytes (106 in triplicate) were treated with 9-HODE, 13-HODE, ALA, or LA for 24 hours in a sixwell plate in low-serum medium (0.4 % FBS). To induce conversion of these cells into macrophage-like cells, THP1 cells were treated with 100-nM PMA for 36 hours, converting them into adherent THP-1 cells. PMA and C18 fatty acids (FAs)were dissolved in ethanol and were added to the cells as an ethanol solution. The maximum percentage of ethanol n the media was 0.9 % (v/v), and this level did not harm the cells. Cells were counted on a haemocytometer after trypan blue staining. Viability, Apoptosis, and Cytotoxicity THP-1 (2.4 9 104) cells were treated with C18 FAs, camptothecin, or rosiglitazone, with or without 1–100-nM PMA, in 50-lL RPMI low-serum medium in a 96-well plate for 24 hours. For experiments with adherent THP-1 cells, cells were pretreated with 100-M PMA for 36 hours and rested for 24 hours in low-serum medium before fatty acid treatment for 24 hours. Viability, apoptosis, and cytotoxicity were measured according to kit manufacturer instructions. Assay reagent was briefly added to cells after FA treatment and incubated for 30 minutes at room temperature on an orbital shaker (500 rpm). The plate was preequilibrated to room temperature for 30 minutes for the viability assay, after which the reaction reagent was added and incubated. Luminescence (viability and cytotoxicity) and fluorescence (499EX/521EM, apoptosis) was then measured using Wallac 1420 VICTOR2 multi-label reader (Perkin Elmer, Australia). Measurements were taken using the default settings for luminescence and fluorescence for a 96-well plate. For the triplex assay, after FA treatment, an equal volume of viability/cytotoxicity reagent was added, and the reaction plate was incubated at 37 °C for 30 minutes and fluorescence measured at 400EX/505EM for viability and 485EX/520EM for cytotoxicity. Antagonist Blocking of PPARc THP-1 (2.4 9 104) cells were cultured for 36 hours in 50-lL RPMI medium containing 10 % serum, antibiotics, 100-nM PMA, and L-glutamine in a 96-well plate. Cells were then washed three times with DPBS and rested for 24 hours in RPMI medium. Cells were then incubated with PPARc antagonist T0070907 (10 lM) for 2 hours. After
1183
PBS washing, cells were treated with 9-HODE/13-HODE (100 lM), rosiglitazone (1 lM), or camptothecin (5 lM), with or without DEVD-CHO (10 lM), for 24 hours. Fattyacid binding-protein 4 (FABP4) is regulated by PPARc, and hence was used as a readout to determine the effect of antagonist blocking for these experiments. Apoptosis was measured after FA treatment according to manufacturer’s instructions, followed by luminescence measurements for determining caspase-3 and caspase-7 activity (referred to as caspase-3/7). A similar treatment plan was followed for gene expression studies with (5.0 9 105 THP-1 cells used for the experiment. The cells were stored at -80 °C for gene expression studies. siRNA Transfection of GPR132 THP-1 cells (2.0 9 104) were treated with 100-nM PMA for 36 hours in 50 lL of RPMI medium, containing 10 % serum and L-glutamine but devoid of antibiotics, in a 96-well plate. Cells were then washed three times with DPBS and rested for 24 hours in RPMI medium containing 0.4 % serum without antibiotics. Cells were then transfected with oligonucleotides. A mixture of 10-nM siRNA specific for GPR132 or 20 nM of provided positive-control MAPK siRNA, along with 0.15 lL of Lipofectamine per well in 50 lL of medium with no additives, was prepared and incubated at room temperature for 15 minutes. This transfection mixture was then added to cells and incubated for 6 hours, after which the medium was replaced with RPMI with 10 % serum but without antibiotics, and incubated for 18 hours. This was followed by treatment with 9-HODE/13-HODE (100 lM), rosiglitazone (1 lM), or camptothecin (5 lM), with or without DEVD-CHO (10 lM), in 50-lL RPMI medium (0.4 % FBS, no antibiotics) for 24 hours. The following oligonucleotide combinations were used for GPR132 silencing (supplied by Qiagen Pty Ltd, Doncaster, VIC, Australia): CAGGATTGCCGGGTACTACTA, ACGGACCATTCCCGCCAAGAA, CTGGGTCACCATCGAGATCAA, and TACCAATTTCTCGTTCCTGAA Apoptosis was measured after FA treatment according to the manufacturer’s instructions, followed by luminescence measurements for determining caspase-3/7 activity. A similar treatment plan was followed for gene expression studies with (5.0 9 105 THP-1 cells used for the experiment. The cells were stored at -80 °C for gene expression studies. Annexin-V Staining THP-1 cells (2.0 9 104) were treated in triplicate with ALA, LA, 9-HODE/13-HODE (100 lM), rosiglitazone
123
1184
(1 lM), or camptothecin (5 lM) for 24 hours in 50-lL RPMI medium in a 96-well plate. Cells were washed with DPBS and centrifuged at 300g for 2 minutes. Cells were then washed twice in Annexin-binding buffer. Staining was performed using Annexin PE (1:10 dilution) and 7-AAD (7-aminoactinomycin, 1:15 dilution) for 15 minutes at room temperature. 150 lL of Annexin buffer was added, and cells were examined immediately using a flow cytometer (BD FACSCalibur). A minimum of 10 9 104 were acquired. Quadrant analysis was used to determine viable cells (7-AAD-negative, Annexin-V-negative) and early apoptotic cells (Annexin-V-positive, 7-AADnegative).
Lipids (2014) 49:1181–1192
normalized and quantified against the reference gene peptidylprolyl isomerase A (PPIA). Non-template and no-RT controls were used in each experiment to check for contamination. The concentration Ct standard curve method was used to determine the expression of gene of interest relative to reference gene using RotorGene Q version 2.02 (Build 4) software. RT2 primer assays for GPR132, PPARc, and PPIA were purchased from SABiosciences (Jomar Diagnostics Pty Ltd), with the exception of the ACGAGATGAGACGGAACTG sense and CTGCCTCTG TGCCTTAGC anti-sense primers for GPR132, purchased from Sigma-Aldrich. Statistical Analysis
DNA Ladder Assay THP-1 monocytes (5 9 104) were treated with 9-HODE/ 13-HODE (100 lM), rosiglitazone (1 lM), or camptothecin (5 lM) in 50 lL of low-serum RPMI medium with additives for 24 hours in a 96-well plate. Cells were centrifuged and the medium discarded. A DNA digestion buffer (Tris-EDTA, pH 8.0, NaCl 5 M, EDTA 0.5 M), along with Proteinase K (0.5 lL/sample), was added. Samples were incubated for 2 hours at 56 °C, after which NaCl (5 M) was added and samples centrifuged at 16,000g for 1 minute. Supernatant was transferred to a new tube. 100 % EtOH was added and incubated at 4 °C for DNA precipitation overnight. The tubes were then centrifuged at 16,000g for 5 minutes and the supernatant discarded. The DNA pellet was washed twice with 70 % ethanol and dried at 65 °C n a heat block for 1 hour. 50 lL of DNAse-free water was added to each sample. The DNA was quantified using a spectrophotometer (NanoDrop). A 2 % agarose gel was prepared using sodium borate buffer. GelRed (1:10,000, DNA stain) was added to the mixture, and 200 ng of DNA was loaded to each well. The samples were run at 120 V for 40 minutes before the gel was visualized and pictures captured using the Bio-Rad Gel Doc system. Real-Time (RT) PCR RNA was extracted from frozen cells (-80 °C) using RNeasy (Qiagen Pty Ltd) extraction kits. RNA was quantified using a NanoDrop spectrophotometer (Thermo Scientific, Australia). Samples were checked for DNA contamination by running a no-RT (reverse transcriptase) control. Real-time (RT) PCR was performed on a Corbett Rotor-Gene 6000 (Qiagen) with signal acquired at the SYBR Green channel. Reactions were performed in duplicate in a 15-lL solution containing 40–100 ng/lL RNA, 7.5 lL SYBR Green master mix, 0.15 lL RT mix, and 0.6 lL of primer. Samples, in duplicate, were
123
Results are expressed as mean ± standard deviation of triplicate incubations unless otherwise stated. Representative data from three independent experiments have been presented. Data were analyzed using GraphPad Prism 5 (GraphPad Software, San Diego, California). Comparisons between treatments were made using one-way or two-way analysis of variance (ANOVA), followed by either Dennett’s or Tukey’s post hoc test, corrected for multiple comparisons. A value of p \ 0.05 was deemed to be statistically significant.
Results 9-HODE Decreases Cell Number and RNA Yield In monocyte cultures, neither ALA nor LA affected cell number at 24 hours, but both ALA and LA decreased the number of cells at 48 hours (Fig. 1a, p \ 0.01 for LA and p \ 0.05 for ALA). In 24-hour incubations, both 9-HODE and 13-HODE decreased the number of cells 40–60 % of baseline (Fig. 1b, p \ 0.05 for 13-HODE and p \ 0.01 for 9-HODE). RNA yield following exposure to HODEs was significantly lower compared to controls (Fig. 1b, both ps \ 0.01); however, ALA and LA had no effect. Following exposure to PMA (100 nM), cells became adherent and differentiated into macrophage-like adherent THP-1 cells. Cell count data (after trypsinization) varied in these cultures. Neither ALA nor LA affected RNA yield in these cultures after 24 hours (Fig. 1c). In contrast, both 9-HODE and 13-HODE decreased RNA yield after 24 hours (Fig. 1d, p \ 0.01). HODEs Decrease Cell Viability In monocytes, ALA and LA did not affect viability, while both 9-HODE and 13-HODE markedly decreased cell viability in a dose-dependent manner, with effects apparent at 30 lM (Fig. 2a, both ps \ 0.001). There were similar
Lipids (2014) 49:1181–1192
1185
Fig. 1 9-HODE decreases cell number and RNA yield. THP-1 monocytes were incubated with C18 FAs for 24 or 48 hours. Trypan blue-exclusion cell counts were performed using a haemocytometer. RNA yield was quantified using a NanoDrop spectrophotometer. a Decrease in cell number observed in monocytes (p \ 0.05, one-way ANOVA; LA 30 lM, p \ 0.01 after 48 hours; and b no changes were observed with RNA yield. c–d Cell count and RNA yield after 24 hours with 9-HODE or 13-HODE; both cell count and RNA (p \ 0.001, one-way ANOVA) were significantly decreased. e No
changes were observed with macrophage RNA yield after 48-hour treatment with ALA (30 lM) or LA (30 lM). f Macrophage RNA yield decreased significantly after 24 hours with 9-HODE or 13-HODE (30 lM) (p \ 0.01, one-way ANOVA). Data represent mean ± SEM of pooled triplicates from three independent experiments, normalized as a percentage of control for cell counts and n = 3 replicates per group for RNA yield. One-way ANOVA was followed by Tukey post hoc test, corrected for multiple comparisons. *p \ 0.05, **p \ 0.01 and p \ 0.01
effects in adherent THP-1 cells (Fig. 2b), with ALA and LA having no effect and HODEs decreasing cell viability (both ps \ 0.001). In both monocytes and adherent THP-1 cells, 9-HODE was more potent than 13-HODE at 30 lM. Viability was unaffected in monocytes when exposed to 1-nM PMA (Fig. 2c). The decrease in viability with 30 lM 9-HODE was increased when 1-nM PMA was also present (Fig. 2c, p \ 0.001). In this set of experiments, 30-lM
13-HODE had no effect on its own, but decreased viability when added concurrently with 1-nM PMA (Fig. 2c, p \ 0.001). HODEs Increase Annexin-V-Positive Cells Flow cytometry quadrant analysis was used to identify viable cells (7-AAD-negative, Annexin-V-negative),
123
1186
Lipids (2014) 49:1181–1192
Fig. 2 HODEs decrease cell viability. THP-1 (2.4 9 104) cells were treated with C18 FAs (30–100 lM), with or without 1–100-nM PMA, in 50-lL RPMI low-serum medium in a 96-well plate for 24 hour. Viability (luminescence) was measured according to kit manufacturer instructions using Wallac 1420 multi-label reader. a In monocytes, no changes were observed in cell viability when treated with ALA and LA, while 9- and13-HODE significantly decreased cell viability (p \ 0.05, two-way ANOVA). b Adherent THP-1 cells were exposed to 9-HODE or 13-HODE for 24 hours or to ALA or LA for 48 hours (p \ 0.05, two-way ANOVA). A significant decrease in cell viability
was observed only with 9- and 13-HODE treatment. c THP-1 monocytes plus FA (30 lM), with or without PMA, for 24 hours, with HODEs decreasing viability, while the activation of monocytes was induced using 1-nM PMA (p \ 0.05, two-way ANOVA). Results are expressed as a percentage of control, mean ± SEM (n = 3 separate experiments). Data shown are mean ± SEM from triplicates normalised as a percentage of control. (Two-way ANOVA, followed by Dunnett’s post hoc test corrected for multiple comparisons). *p \ 0.05, **p \ 0.01, ***p \ 0.001. #p \ 0.05, ###p \ 0.001 compared with 1-nM PMA
early apoptotic cells (Annexin-V-positive, 7-AAD-negative), and apoptotic dying cells (positive for both 7-AAD and Annexin-V) (Fig. 3a). THP-1 monocytes were incubated with C18 fatty acids (100 lM), PPAR agonist, rosiglitazone (1 lM), or known inducer of apoptosis, camptothecin, (10 lM) for 6, 12, or 24 hours prior to FACS analysis. Camptothecin decreased the number of viable cells within 6 hours (p \ 0.001). 9-HODE and 13-HODE decreased the number of viable cells within 12 hours (both ps \ 0.001), with 9-HODE the more potent (Fig. 3b). ALA, LA, and rosiglitazone had no effect on the number of viable cells during the 24-hour period (Fig. 3b). As expected, camptothecin increased the number of apoptotic cells, as did 9-HODE and 13-HODE (both ps \ 0.001, Fig. 3c). Again, 9-HODE was more potent than 13-HODE. ALA, LA, and rosiglitazone did not affect the number of apoptotic cells (Fig. 3c).
9-HODE Increases DNA Fragmentation
123
The effects of FA, rosiglitazone, and camptothecin following 24-hour incubation are shown in Fig. 3d. Camptothecin shows clear evidence of DNA fragmentation. Of the other agents, only with 9-HODE was there evidence of DNA fragmentation. HODEs Increase Caspase-3/7 Activity Neither ALA nor LA had any effect on caspase-3/7 activity in monocytes (Fig. 4a). By contrast, both 9-HODE and 13-HODE markedly increased caspase-3/7 activity (both ps \ 0.001), with 9-HODE increasing activity at 30 lM (p \ 0.001), while the effect of 13-HODE was only apparent at 70 lM (Fig. 4a, p \ 0.001). In adherent THP-1 cells, ALA and LA were again without effect (Fig. 4b). 9-HODE and 13-HODE both increased caspase-3/7
Lipids (2014) 49:1181–1192
1187
Fig. 3 HODEs increased Annexin-V-positive cells and DNA fragmentation. THP-1 monocytes (2.0 9 104) in triplicate for Annexin-V staining and 5 9 104 (for DNA ladder assay) were treated with 9-HODE and 13-HODE (100 lM), rosiglitazone (1 lM), or camptothecin (5 lM) in 50 lL of low-serum RPMI medium for 24 hours in a 96-well plate. Annexin-V staining was performed using Annexin PE and 7-AAD, and examined using a flow cytometer (BD FACSCalibur). For DNA ladder assay, extracted DNA was quantified using a spectrophotometer (NanoDrop). A 2 % agarose gel was used to load 200 ng of DNA, and samples were run at 120 V for 40 minutes and captured using the BioRad Gel Doc system. a Annexin-V staining: cells were gated to identify viable cells (7-AAD and Annexin-Vnegative), apoptotic live cells (7-AAD-negative, Annexin-V-positive), dead cells (7-AAD-positive), and dead apoptotic cells (7-AADand Annexin-V-positive); representative gating shown for ALA at
12 hours. b Percentage of viable cells was decreased by HODEs (30 lM) and camptothecin (10 lM) only (p \ 0.05, two-way repeatedmeasures ANOVA). c HODEs and camptothecin increased the percentage of dead apoptotic cells (p \ 0.05, two-way repeatedmeasures ANOVA). Data shown are mean ± SEM of triplicate incubations from a representative experiment. Two-way ANOVA, followed by Dunnett’s post hoc test corrected for multiple comparisons **p \ 0.01, ***p \ 0.001. d DNA fragmentation assay. Monocytes were treated with 9-HODE/13-HODE (100 lM), rosiglitazone (1 lM), or camptothecin (5 lM). Tracks 1 and 9 show sample DNA ladders. Track 8 (camptothecin) shows marked DNA fragmentation. Of the remainder, only 9-HODE (Track 5) shows evidence of DNA fragmentation. Track 2 control, 3 ALA, 4 LA, 6 13-HODE, 7 rosiglitazone)
activity, with effects apparent at 70 lM in each case (Fig. 4b, p \ 0.001). 1-nM PMA had no effect on caspase3/7 activity (Fig. 4c, p \ 0.05). Exposure to 1-nM PMA augmented the increase in caspase-3/7 activity seen with 30-lM 9-HODE (Fig. 4c, p \ 0.001). When 30-lM 13-HODE was added along with 1-nM PMA, an increase in caspase-3/7 activity was apparent (Fig. 4c, p \ 0.05).
Expression of GPR132, PPARc, and FABP4 GPR132, PPARc, and FABP4 were expressed in both monocytes and adherent THP-1 cells, with higher expression of all three genes in latter (Table 1). Monocytes stimulated with HODEs (30 lM for 24 hours) showed increased expression of GPR132 (both ps \ 0.001), with 9-HODE more potent
123
1188
Lipids (2014) 49:1181–1192
Fig. 4 HODEs increase caspase-3/7 activity. THP-1 (2.4 9 104) cells were treated with C18 FAs (30–100 lM), camptothecin, or rosiglitazone, with or without 1–100-nM PMA, in 50-ll RPMI lowserum medium in a 96-well plate for 24 hours. Cytotoxicity was measured according to kit manufacturer instructions. Fluorescence (499EX/521EM) was then measured using Wallac 1420 multi-label reader (Perkin Elmer, Australia). a In monocytes, no changes were observed in caspase activity when treated with ALA and LA, while 9and13-HODE significantly increased caspase activity (p \ 0.05, twoway ANOVA). b Adherent THP-1 cells were exposed to 9-HODE or
13-HODE for 24 hours or to ALA or LA for 48 hours. A significant increase in caspase activity was observed only with 9- and 13-HODE treatment (p \ 0.05, two-way ANOVA) c THP-1 monocytes were treated with FA (30 lM), with or without 1-nM PMA, for 24 hours. HODEs increased caspase activity in activated monocytes (induced by addition of 1-nM PMA) (p \ 0.05, two-way ANOVA). Data shown are mean ± SEM from triplicates, normalized as a percentage of control (two-way ANOVA, followed by Dunnett’s post hoc test, corrected for multiple comparisons). *p \ 0.05, ***p \ 0.001, ## p \ 0.01, ###p \ 0.001 compared with 1-nM PMA
Table 1 Expression of GPR132, PPARc, and FABP4
observed that FABP4 expression was markedly increased with HODEs in monocytes and adherent THP-1 cells (p \ 0.001), an effect that has been previously reported [14].
Gene expression
Control
9-HODE
13-HODE
Monocytes GPR132
1.04 ± 0.06
4.64 ± 0.27***
PPARc
1.14 ± 0.11
12.96 ± 1.96***
8.44 ± 0.67***
FABP4
0.89 ± 0.07
5.06 ± 0.51***
4.74 ± 0.41***
Macrophages GPR132
2.1 ± 0.21***
1.22 ± 0.10
1.23 ± 0.13
1.08 ± 0.09
PPARc
1.25 ± 0.15
1.57 ± 0.16*
1.11 ± 0.23
FABP4
1.33 ± 0.08
8.90 ± 0.25***
11.08 ± 1.70***
Data shown represent expression relative to control gene (triplicate incubations ± SEM). Cells were incubated with control medium or 30-lM HODEs for 24 hours * = p \ 0.05, *** = p \ 0.001
(p \ 0.001). PPARc expression was markedly increased by HODEs in monocytes (both ps \ 0.001), again with 9-HODE the more potent (p \ 0.01). In adherent THP-1 cells, 9-HODE increased PPARc, but only to a modest degree (p \ 0.05). We
123
PPARc Regulate the Pro-Apoptotic Effect of HODEs The PPARc antagonist T0070907 alone had no effect on caspase-3/7 activity (Fig. 5). Unexpectedly, the pro-apoptotic effect of 9-HODE was actually increased when T0070907 was added concurrently (Fig. 5, p \ 0.001). As expected, the caspase inhibitor DEVD-CHO abolished caspase-3/7 activity. The effect of 13-HODE was similar to that of 9-HODE, and there was a modest increase in caspase-3/7 activity when T0070907 was added along with 13-HODE (p \ 0.005). Effect of Transfection with siRNA for GPR132 Treatment with siRNA decreased GPR132 gene expression in monocytes by 70 %. Lipofectamine alone increased
Lipids (2014) 49:1181–1192
Fig. 5 PPARc regulates the pro-apoptotic effect of HODEs. THP-1 (2.4 9 104) cells were treated with C18 FAs, camptothecin, or rosiglitazone, with or without 1–100-nM PMA, in 50-lL RPMI lowserum medium in a 96-well plate for 24 hours, with T0070907 used to block PPARc. Apoptosis was measured according to kit manufacturer instructions. Post FA treatment, with caspase activity measured using luminescence. When PPARc was blocked, it resulted in increased caspase activity, and was effectively reduced when HODES were added along with caspase inhibitor (CI) DEVD-CHO (p \ 0.05, twoway ANOVA). Cells were incubated in triplicate for 24 hours. Data shown are mean ± SEM. **p \ 0.01, ***p \ 0.001; compared with control. ###p \ 0.001, compared with T0070907, ^^^p \ 0.001; compared with corresponding FA with T0070907 (two-way ANOVA, followed by Tukey post hoc test, corrected for multiple comparisons)
caspase-3/7 activity (Fig. 6, p \ 0.01). This effect was decreased when silencing oligonucleotides were added with lipofectamine. However, there was no stimulatory effect of either HODE on caspase-3/7 activity in these experiments. We further investigated the possible involvement of GPR132 in mediating the actions of HODEs using fatty-acid-binding protein 4 (FABP4 expression). FABP4 is known to increase when THP-1 cells are exposed to HODEs. 13Rosiglitazone (1 lM), 9-HODE (30 lM), and 13-HODE (30 lM) increased FABP4 expression (all ps \ 0.001), with no decrease in FABP4 when GPR132 was silenced (Table 1).
Discussion In this study, we aimed to determine the apoptotic effects of HODEs in macrophages. From the data presented here, we show involvement of PPARc in mediating the proapoptotic effects of HODEs, while no evidence of regulatory effect for GPR132 was identified. Given the central role of macrophage apoptosis in atherosclerosis [16], and the known signaling actions of HODEs, we investigated the effects of 9-HODE or 13-HODE on apoptosis in THP-1 cells. Both HODEs increased caspase-3/7 activity, although 9-HODE was more potent. Only 9-HODE increased DNA fragmentation, and 9-HODE was also more potent than
1189
Fig. 6 Effect of transfection with siRNA for GPR132. THP-1 cells (2.0 9 104) were treated with 100-nM PMA for 36 hours in 50 lL of RPMI medium containing 10 % serum and L-glutamine but devoid of antibiotics in a 96-well plate. siRNA specific for GPR132 was then added, transfecting the cells, and then treated with FAs, with or without DEVD-CHO (10 lM). Apoptosis was measured according to kit manufacturer instructions. Cells were incubated for 24 hours with 100-lM HODEs. Transfection control showed increased caspase-3/7 activity compared with control cells (p \ 0.001), but there was no further increase with either 9-HODE or 13-HODE. Caspase was effectively reduced when HODES were added along with caspase inhibitor (CI) DEVD-CHO. Data shown are mean ± SEM. *p \ 0.01, ***p \ 0.001, compared with corresponding siGPR132?FA (one-way ANOVA followed by Tukey post hoc test, corrected for multiple comparisons)
13-HODE in decreasing cell numbers in cultures. Neither ALA nor LA increased measures of apoptosis. LA is the major polyunsaturated fatty acid in the cholesteryl ester and triglyceride components of oxLDL. HODEs are the major oxidation products of LA, and are abundant in plaque lesions [1–3]. Previous studies have confirmed that oxLDL promotes atherosclerosis through actions on endothelial cells, vascular smooth muscle cells (VSMC), and macrophages. In macrophages, oxLDL promotes foam cell formation and apoptosis. Oxysterols, which are also abundantly present in atherosclerotic plaque, have been shown to be non-cytotoxic when incorporated into acetylated LDL, thereby leading to differing effects on atherogenesis [37]. Induction of scavenger receptors, including CD36, leads to uptake of oxLDL into macrophages, following which lipid components of oxLDL may activate signaling mechanisms, including the sphingomyelin–ceramide pathway, intracellular calcium accumulation, protein kinases, caspases, and other proteases, and PPARs [38, 39]. Under some circumstances, oxLDL appears to protect macrophages against apoptosis [40–42]. More differentiated cells of the monocyte/macrophage lineage may be resistant to apoptosis induction by oxLDL [43], and the effect of oxLDL may depend on the degree of oxidation [22, 44]. The pro- and anti-apoptotic effects of oxLDL may be apparent at different concentrations [40]. It
123
1190
is necessary to understand how individual components of oxLDL affect atherogenic processes such as macrophage apoptosis. An optimum therapeutic strategy may be to increase macrophage apoptosis in early lesions, while inhibiting the process in later lesions [16]. As has been shown in prior studies [5, 25], we showed that HODEs have a direct and specific effect in promoting macrophage apoptosis. One previous study [25] reported that 9-HODE, but not 13-HODE, increased apoptosis and that the mechanism was independent of PPARc. This study used U937 cells, which actually express very little PPARc in the basal state [13]. In contrast, another study [5] using Mono Mac 6 (MM6) cells reported that 13-HODE increased apoptosis. The authors did not investigate the effects of 9-HODE. Both studies agreed that regulation of apoptosis by HODEs involved a regulatory mechanism distinct from those involved in monocyte differentiation and scavenger receptor expression. In the present study, we show that 9-HODE and 13-HODE have broadly similar effects in regulating apoptosis, and that the effects of HODEs in monocytes and adherent THP-1 cells are similar. Both previous studies [5, 25] included only undifferentiated (monocytic) cells. Our data clearly shows the involvement of transcription factor PPARc in regulating the pro-apoptotic effects of HODEs. Both 9- and 13-HODE increased caspase activity in adherent THP-1 cells when added along with the PPARc antagonist T0070907 [45]. This is in agreement with previous studies [5, 25]. HODEs are well-documented as ligands for PPARc in macrophages, and this may be important in the regulation of lipid accumulation [10, 13, 46], as it is in adipocytes. HODEs markedly increased PPARc expression in monocytes, and this is consistent with a role in differentiation of these cells into mature macrophages. Lipid mediators are often promiscuous—i.e., they interact with multiple receptors and transcription factors. Actions of other known PPARc agonists that are independent of PPARc have been documented [47–50]. PPARc-dependent effects of 13-HODE may be relevant in early atherosclerosis, where its actions are protective [51], and may include regulating differentiation of macrophages into the anti-inflammatory M2 phenotype [43]. We confirm here that GPR132 is expressed in monocytes, and expression is increased on exposure to HODEs, particularly 9-HODE. The latter is a ligand for GPR132, while 13-HODE is not [26, 27]. As both HODEs had similar effects in promoting apoptosis, it is unlikely that GPR132 has a major regulatory role in this process. However, we are unable to categorically confirm this from our siRNA experiments, since the transfecting agent (lipofectamine) alone increased apoptosis, masking the effects of HODEs. Similar effects were found when transfection was carried out using HiPerFect (data not
123
Lipids (2014) 49:1181–1192
shown). The cationic detergent agents used in transfection protocols have been shown to increase apoptosis [52] and to have cytotoxic effects [53, 54]. It appears that other transfection methods may be required for apoptosis experiments with THP-1 cells. As has been previously documented [14], both HODEs increased FABP4 expression in THP-1 cells. In the present study, silencing of the GPR132 gene did not influence the stimulatory effect of either HODE. Therefore, we find no evidence from our study that GPR132 is involved in mediating the effects of HODEs on monocyte/macrophage apoptosis. In studies using GPR132 (G2A) knockout mice [30, 31], a protective effect of GPR132 has been reported. with lack of the gene associated with vascular inflammation and atherogenesis. By contrast, other authors have reported a pro-atherogenic effect of GPR132 [32–34], and this is in keeping with the pro-inflammatory effect of GPR132 in keratinocytes [55]. Given the controversy regarding the role of GPR132 in atherogenesis from animal studies, and the lack of human data, there is an urgent need to define how GPR132 modulates activities in the cells involved in plaque formation. The receptor has been reported to be involved is signaling the pro-apoptotic effect of lysophosphatidylcholine [56]. In conclusion, it appears that HODEs are potent activators of apoptosis in THP-1 cells in comparison to ALA and LA, with their pro-apoptotic effects regulated by PPARc, with no involvement of GPR132. Other candidate signaling molecules for the effects of HODEs include the transcription factors testicular orphan receptor 4 (TR4) [57] and the capsaicin receptor TRPV1 [58, 59]. Further studies will help to define the mechanism through which HODEs increase apoptosis in cells of monocytic lineage. There is a potential to diminish the burden of cardiovascular disorders thorough therapeutic targeting of the15-LOX1 receptor [60]. An increase of this receptor would lead to increase in cellular uptake of 13-HODE. This, in turn, would increase reverse cholesterol transport via stimulation of PPARa. Further study of HODEs may illuminate therapeutic targets. Acknowledgments James Cook University and the Private Practice Fund of the Townsville Hospital generously supported this work. We are grateful to Linda Thomas, Jason Hodge, and Stephen Garland for their technical assistance in the early stages of this work. Conflict of interest None of the authors has a conflict of interest to declare in relation to this work.
References 1. Kuhn H, Belkner J, Wiesner R, Schewe T, Lankin VZ, Tikhaze AK (1992) Structure elucidation of oxygenated lipids in human atherosclerotic lesions. Eicosanoids 5:17–22 2. Jira W, Spiteller G, Carson W, Schramm A (1998) Strong increase in hydroxy fatty acids derived from linoleic acid in
Lipids (2014) 49:1181–1192
3.
4.
5.
6.
7. 8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
human low density lipoproteins of atherosclerotic patients. Chem Phys Lipids 91:1–11 Waddington E, Sienuarine K, Puddey I, Croft K (2001) Identification and quantitation of unique fatty acid oxidation products in human atherosclerotic plaque using high-performance liquid chromatography. Anal Biochem 292:234–244 Kuhn H, Belkner J, Zaiss S, Fahrenklemper T, Wohlfeil S (1994) Involvement of 15-lipoxygenase in early stages of atherogenesis. J Exp Med 179:1903–1911 Jostarndt K, Gellert N, Rubic T, Weber C, Kuhn H, Johansen B, Hrboticky N, Neuzil J (2002) Dissociation of apoptosis induction and CD36 upregulation by enzymatically modified low-density lipoprotein in monocytic cells. Biochem Biophys Res Commun 290:988–993 Vangaveti V, Baune BT, Kennedy RL (2010) Hydroxyoctadecadienoic acids: novel regulators of macrophage differentiation and atherogenesis. Ther Adv Endocrinol Metab 1:51–60 Brinckmann R, Kuhn H (1997) Regulation of 15-lipoxygenase expression by cytokines. Adv Exp Med Biol 400B:599–604 Waddington EI, Croft KD, Sienuarine K, Latham B, Puddey IB (2003) Fatty acid oxidation products in human atherosclerotic plaque: an analysis of clinical and histopathological correlates. Atherosclerosis 167:111–120 Upston JM, Neuzil J, Witting PK, Alleva R, Stocker R (1997) Oxidation of free fatty acids in low density lipoprotein by 15-lipoxygenase stimulates nonenzymic, alpha-tocopherolmediated peroxidation of cholesteryl esters. J Biol Chem 272:30067–30074 Nagy L, Tontonoz P, Alvarez JG, Chen H, Evans RM (1998) Oxidized LDL regulates macrophage gene expression through ligand activation of PPARgamma. Cell 93:229–240 Han KH, Chang MK, Boullier A, Green SR, Li A, Glass CK, Quehenberger O (2000) Oxidized LDL reduces monocyte CCR2 expression through pathways involving peroxisome proliferatoractivated receptor gamma. J Clin Invest 106:793–802 Ricote M, Welch JS, Glass CK (2000) Regulation of macrophage gene expression by the peroxisome proliferator-activated receptor-gamma. Horm Res 54:275–280 Inoue M, Itoh H, Tanaka T, Chun TH, Doi K, Fukunaga Y, Sawada N, Yamshita J, Masatsugu K, Saito T, Sakaguchi S, Sone M, Yamahara K, Yurugi T, Nakao K (2001) Oxidized LDL regulates vascular endothelial growth factor expression in human macrophages and endothelial cells through activation of peroxisome proliferator-activated receptor-gamma. Arterioscler Thromb Vasc Biol 21:560–566 Fu Y, Luo N, Lopes-Virella MF, Garvey WT (2002) The adipocyte lipid binding protein (ALBP/aP2) gene facilitates foam cell formation in human THP-1 macrophages. Atherosclerosis 165:259–269 Barbier O, Torra IP, Duguay Y, Blanquart C, Fruchart JC, Glineur C, Staels B (2002) Pleiotropic actions of peroxisome proliferator-activated receptors in lipid metabolism and atherosclerosis. Arterioscler Thromb Vasc Biol 22:717–726 Tabas I (2005) Consequences and therapeutic implications of macrophage apoptosis in atherosclerosis: the importance of lesion stage and phagocytic efficiency. Arterioscler Thromb Vasc Biol 25:2255–2264 Secchiero P, Corallini F, Pandolfi A, Consoli A, Candido R, Fabris B, Celeghini C, Capitani S, Zauli G (2006) An increased osteoprotegerin serum release characterizes the early onset of diabetes mellitus and may contribute to endothelial cell dysfunction. Am J Pathol 169:2236–2244 Stoneman V, Braganza D, Figg N, Mercer J, Lang R, Goddard M, Bennett M (2007) Monocyte/macrophage suppression in CD11b diphtheria toxin receptor transgenic mice differentially affects atherogenesis and established plaques. Circ Res 100:884–893
1191 19. Ait-Oufella H, Pouresmail V, Simon T, Blanc-Brude O, Kinugawa K, Merval R, Offenstadt G, Leseche G, Cohen PL, Tedgui A, Mallat Z (2008) Defective mer receptor tyrosine kinase signaling in bone marrow cells promotes apoptotic cell accumulation and accelerates atherosclerosis. Arterioscler Thromb Vasc Biol 28:1429–1431 20. Thorp E, Cui D, Schrijvers DM, Kuriakose G, Tabas I (2008) Mertk receptor mutation reduces efferocytosis efficiency and promotes apoptotic cell accumulation and plaque necrosis in atherosclerotic lesions of apoe-/- mice. Arterioscler Thromb Vasc Biol 28:1421–1428 21. Thorp E, Li Y, Bao L, Yao PM, Kuriakose G, Rong J, Fisher EA, Tabas I, Thorp E, Li Y, Bao L, Yao PM, Kuriakose G, Rong J, Fisher EA, Tabas I (2009) Brief report: increased apoptosis in advanced atherosclerotic lesions of Apoe-/- mice lacking macrophage Bcl-2. Arterioscler Thromb Vasc Biol 29:169–172 22. Carpenter KLH, Challis IR, Arends MJ (2003) Mildly oxidised LDL induces more macrophage death than moderately oxidised LDL: roles of peroxidation, lipoprotein-associated phospholipase A2 and PPARgamma. FEBS Lett 553:145–150 23. Lizard G, Lemaire S, Monier S, Gueldry S, Ne´el D, Gambert P (1997) Induction of apoptosis and of interleukin-1b secretion by 7b-hydroxycholesterol and 7-ketocholesterol: partial inhibition by Bcl-2 overexpression. FEBS Lett 419:276–280 24. Rusinol AE, Thewke D, Liu J, Freeman N, Panini SR, Sinensky MS (2004) AKT/protein kinase B regulation of BCL family members during oxysterol-induced apoptosis. J Biol Chem 279:1392–1399 25. Hampel JKA, Brownrigg LM, Vignarajah D, Croft KD, Dharmarajan AM, Bentel JM, Puddey IB, Yeap BB (2006) Differential modulation of cell cycle, apoptosis and PPARgamma2 gene expression by PPARgamma agonists ciglitazone and 9-hydroxyoctadecadienoic acid in monocytic cells. Prostaglandins Leukot Essent Fatty Acids 74:283–293 26. Obinata H, Izumi T, Obinata H, Izumi T (2009) G2A as a receptor for oxidized free fatty acids. Prostaglandins Other Lipid Mediat 89:66–72 27. Yin H, Chu A, Li W, Wang B, Shelton F, Otero F, Nguyen DG, Caldwell JS, Chen YA, Yin H, Chu A, Li W, Wang B, Shelton F, Otero F, Nguyen DG, Caldwell JS, Chen YA (2009) Lipid G protein-coupled receptor ligand identification using beta-arrestin PathHunter assay. J Biol Chem 284:12328–12338 28. Vangaveti V, Shashidhar V, Jarrod G, Baune BT, Kennedy RL (2010) Free fatty acid receptors: emerging targets for treatment of diabetes and its complications. Ther Adv Endocrinol Metab 1:165–175 29. Rikitake Y, K-i Hirata, Yamashita T, Iwai K, Kobayashi S, Itoh H, Ozaki M, Ejiri J, Shiomi M, Inoue N, Kawashima S, Yokoyama M (2002) Expression of G2A, a receptor for lysophosphatidylcholine, by macrophages in murine, rabbit, and human atherosclerotic plaques. Arterioscler Thromb Vasc Biol 22:2049–2053 30. Bolick DT, Whetzel AM, Skaflen M, Deem TL, Lee J, Hedrick CC (2007) Absence of the G protein-coupled receptor G2A in mice promotes monocyte/endothelial interactions in aorta. Circ Res 100:572–580 (see comment) 31. Bolick DT, Skaflen MD, Johnson LE, Kwon SC, Howatt D, Daugherty A, Ravichandran KS, Hedrick CC, Bolick DT, Skaflen MD, Johnson LE, Kwon S-C, Howatt D, Daugherty A, Ravichandran KS, Hedrick CC (2009) G2A deficiency in mice promotes macrophage activation and atherosclerosis. Circ Res 104:318–327 32. Parks BW, Gambill GP, Lusis AJ, Kabarowski JHS (2005) Loss of G2A promotes macrophage accumulation in atherosclerotic lesions of low density lipoprotein receptor-deficient mice. J Lipid Res 46:1405–1415
123
1192 33. Parks BW, Lusis AJ, Kabarowski JHS (2006) Loss of the lysophosphatidylcholine effector, G2A, ameliorates aortic atherosclerosis in low-density lipoprotein receptor knockout mice. Arterioscler Thromb Vasc Biol 26:2703–2709 34. Parks BW, Srivastava R, Yu S, Kabarowski JH, Parks BW, Srivastava R, Yu S, Kabarowski JHS (2009) ApoE-dependent modulation of HDL and atherosclerosis by G2A in LDL receptordeficient mice independent of bone marrow-derived cells. Arterioscler Thromb Vasc Biol 29:539–547 35. Tsuchiya S, Kobayashi Y, Goto Y, Okumura H, Nakae S, Konno T, Tada K (1982) Induction of maturation in cultured human monocytic leukemia cells by a phorbol diester. Cancer Res 42:1530–1536 36. Baird SK, Hampton MB, Gieseg SP (2004) Oxidized LDL triggers phosphatidylserine exposure in human monocyte cell lines by both caspase-dependent and -independent mechanisms. FEBS Lett 578:169–174 37. Rutherford LD, Gieseg SP (2012) 7-ketocholesterol is not cytotoxic to U937 cells when incorporated into acetylated low density lipoprotein. Lipids 47:239–247 38. Wintergerst ES, Jelk J, Rahner C, Asmis R (2000) Apoptosis induced by oxidized low density lipoprotein in human monocytederived macrophages involves CD36 and activation of caspase-3. Eur J biochem/FEBS 267:6050–6059 39. Salvayre R, Auge N, Benoist H, Negre-Salvayre A, Salvayre R, Auge N, Benoist H, Negre-Salvayre A (2002) Oxidized lowdensity lipoprotein-induced apoptosis. Biochim Biophys Acta 1585:213–221 40. Hundal RS, Gomez-Munoz A, Kong JY, Salh BS, Marotta A, Duronio V, Steinbrecher UP, Hundal RS, Gomez-Munoz A, Kong JY, Salh BS, Marotta A, Duronio V, Steinbrecher UP (2003) Oxidized low density lipoprotein inhibits macrophage apoptosis by blocking ceramide generation, thereby maintaining protein kinase B activation and Bcl-XL levels. J Biol Chem 278:24399–24408 41. Namgaladze D, Kollas A, Brune B, Namgaladze D, Kollas A, Brune B (2008) Oxidized LDL attenuates apoptosis in monocytic cells by activating ERK signaling. J Lipid Res 49:58–65 42. Chen JH, Riazy M, Smith EM, Proud CG, Steinbrecher UP, Duronio V, Chen JH, Riazy M, Smith EM, Proud CG, Steinbrecher UP, Duronio V (2009) Oxidized LDL-mediated macrophage survival involves elongation factor-2 kinase. Arterioscler Thromb Vasc Biol 29:92–98 43. Vicca S, Hennequin C, Nguyen-Khoa T, Massy ZA, DescampsLatscha B, Drueke TB, Lacour B (2000) Caspase-dependent apoptosis in THP-1 cells exposed to oxidized low-density lipoproteins. Biochem Biophys Res Commun 273:948–954 44. Boullier A, Li Y, Quehenberger O, Palinski W, Tabas I, Witztum JL, Miller YI, Boullier A, Li Y, Quehenberger O, Palinski W, Tabas I, Witztum JL, Miller YI (2006) Minimally oxidized LDL offsets the apoptotic effects of extensively oxidized LDL and free cholesterol in macrophages. Arterioscler Thromb Vasc Biol 26:1169–1176 45. Lee G, Elwood F, McNally J, Weiszmann J, Lindstrom M, Amaral K, Nakamura M, Miao S, Cao P, Learned RM (2002) T0070907, a selective ligand for peroxisome proliferator-activated receptor c, functions as an antagonist of biochemical and cellular activities. J Biol Chem 277:19649–19657 46. Itoh T, Fairall L, Amin K, Inaba Y, Szanto A, Balint BL, Nagy L, Yamamoto K, Schwabe JWR (2008) Structural basis for the
123
Lipids (2014) 49:1181–1192
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
activation of PPARgamma by oxidized fatty acids. Nat Struct Mol Biol 15:924–931 Straus DS, Pascual G, Li M, Welch JS, Ricote M, Hsiang CH, Sengchanthalangsy LL, Ghosh G, Glass CK (2000) 15-deoxydelta 12,14-prostaglandin J2 inhibits multiple steps in the NF-kappa B signaling pathway. Proc Natl Acad Sci USA 97:4844–4849 Castrillo A, Mojena M, Hortelano S, Bosca L (2001) Peroxisome proliferator-activated receptor-gamma-independent inhibition of macrophage activation by the non-thiazolidinedione agonist L-796,449. Comparison with the effects of 15-deoxydelta(12,14)-prostaglandin J(2). J Biol Chem 276:34082–34088 Clay CE, Monjazeb A, Thorburn J, Chilton FH, High KP (2002) 15-Deoxy-delta12,14-prostaglandin J2-induced apoptosis does not require PPARgamma in breast cancer cells. J Lipid Res 43:1818–1828 Azuma Y, Watanabe K, Date M, Daito M, Ohura K, Azuma Y, Watanabe K, Date M, Daito M, Ohura K (2004) Induction of proliferation by 15-deoxy-delta12,14-prostaglandin J2 and the precursors in monocytic leukemia U937. Pharmacology 71:181–191 Wittwer J, Hersberger M (2007) The two faces of the 15-lipoxygenase in atherosclerosis. Prostaglandins Leukot Essent Fatty Acids 77:67–77 Kongkaneramit L, Sarisuta N, Azad N, Lu Y, Iyer AK, Wang L, Rojanasakul Y (2008) Dependence of reactive oxygen species and FLICE inhibitory protein on lipofectamine-induced apoptosis in human lung epithelial cells. J Pharmacol Exp Ther 325:969–977 Kiefer K, Clement J, Garidel P, Peschka-Suss R (2004) Transfection efficiency and cytotoxicity of nonviral gene transfer reagents in human smooth muscle and endothelial cells. Pharm Res 21:1009–1017 Yamano S, Dai J, Moursi AM (2010) Comparison of transfection efficiency of nonviral gene transfer reagents. Mol Biotechnol 46:287–300 Hattori T, Obinata H, Ogawa A, Kishi M, Tatei K, Ishikawa O, Izumi T, Hattori T, Obinata H, Ogawa A, Kishi M, Tatei K, Ishikawa O, Izumi T (2008) G2A plays proinflammatory roles in human keratinocytes under oxidative stress as a receptor for 9-hydroxyoctadecadienoic acid. J Invest Dermatol 128:1123–1133 Lin P, Ye RD (2003) The lysophospholipid receptor G2A activates a specific combination of G proteins and promotes apoptosis. J Biol Chem 278:14379–14386 Xie S, Lee YF, Kim E, Chen LM, Ni J, Fang LY, Liu S, Lin SJ, Abe J, Berk B, Ho FM, Chang C, Xie S, Lee Y-F, Kim E, Chen L-M, Ni J, Fang L-Y, Liu S, Lin S-J, Abe J-I, Berk B, Ho F-M, Chang C (2009) TR4 nuclear receptor functions as a fatty acid sensor to modulate CD36 expression and foam cell formation. Proc Natl Acad Sci USA 106:13353–13358 Patwardhan AM, Scotland PE, Akopian AN, Hargreaves KM (2009) Activation of TRPV1 in the spinal cord by oxidized linoleic acid metabolites contributes to inflammatory hyperalgesia. Proc Natl Acad Sci USA 106:18820–18824 Patwardhan AM, Akopian AN, Ruparel NB, Diogenes A, Weintraub ST, Uhlson C, Murphy RC, Hargreaves KM (2010) Heat generates oxidized linoleic acid metabolites that activate TRPV1 and produce pain in rodents. J Clin Invest 120:1617–1626 Zhao L, Funk CD (2004) Lipoxygenase pathways in atherogenesis. Trends Cardiovasc Med 14:191–195
