JOURNAL OF VIROLOGY, Feb. 2006, p. 1807–1816 0022-538X/06/$08.00⫹0 doi:10.1128/JVI.80.4.1807–1816.2006 Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Vol. 80, No. 4
Hyperphosphorylation of the Rotavirus NSP5 Protein Is Independent of Serine 67 or NSP2, and the Intrinsic Insolubility of NSP5 Is Regulated by Cellular Phosphatases Adrish Sen,1,2 Darin Agresti,1,2,3 and Erich R. Mackow1,2,3* Department of Medicine1 and Department of Molecular Genetics and Microbiology,2 Stony Brook University, Stony Brook, New York 11794, and Northport VA Medical Center, Northport, New York 117683 Received 2 September 2005/Accepted 17 November 2005
The NSP5 protein is required for viroplasm formation during rotavirus infection and is hyperphosphorylated into 32- to 35-kDa isoforms. Earlier studies reported that NSP5 is not hyperphosphorylated without NSP2 coexpression or deleting the NSP5 N terminus and that serine 67 is essential for NSP5 hyperphosphorylation. In this report, we show that full-length NSP5 is hyperphosphorylated in the absence of NSP2 or serine 67 and demonstrate that hyperphosphorylated NSP5 is predominantly present in previously unrecognized cellular fractions that are insoluble in 0.2% sodium dodecyl sulfate. The last 68 residues of NSP5 are sufficient to direct green fluorescent protein into insoluble fractions and cause green fluorescent protein localization into viroplasm-like structures; however, NSP5 insolubility was intrinsic and did not require NSP5 hyperphosphorylation. When we mutated serine 67 to alanine we found that the NSP5 mutant was both hyperphosphorylated and insoluble, identical to unmodified NSP5, and as a result serine 67 is not required for NSP5 phosphorylation. Interestingly, treating cells with the phosphatase inhibitor calyculin A permitted the accumulation of soluble hyperphosphorylated NSP5 isoforms. This suggests that soluble NSP5 is constitutively dephosphorylated by cellular phosphatases and demonstrates that hyperphosphorylation does not direct NSP5 insolubility. Collectively these findings indicate that NSP5 hyperphosphorylation and insolubility are completely independent parameters and that analyzing insoluble NSP5 is essential for studies assessing NSP5 phosphorylation. Our results also demonstrate the involvement of cellular phosphatases in regulating NSP5 phosphorylation and indicate that in the absence of other rotavirus proteins, domains on soluble and insoluble NSP5 recruit cellular kinases and phosphatases that coordinate NSP5 hyperphosphorylation. 2, 22, 37). NSP2 is reported to interact with N- and C-terminal domains of NSP5 (18, 32) leading to the formation of viroplasm-like-structures and NSP5 hyperphosphorylation (1, 22). In contrast, it was also shown that deletion of residues 1 to 33 of NSP5 promotes NSP5 hyperphosphorylation and at the same time abolishes interactions with NSP2 (1). The N terminus of NSP5 may also be masked either by interaction with NSP2, or by the addition of N-terminal epitope tags which may mimic the role of NSP2 (32). However, it is still reported that coexpression of NSP2 is required for NSP5 hyperphosphorylation and the formation of viroplasm-like structures (18, 19, 42). Two reports have indicated that specific NSP5 residues are required for NSP5 hyperphosphorylation but these reports differ in both the residues and domains required and the cellular kinases involved. Initially it was reported that serines in the 153 to 165 domain of NSP5 were required for NSP5 phosphorylation by casein kinase II (20). In contrast, this group recently proposed a model indicating that phosphorylation of serine 67 by casein kinase I was essential for NSP5 phosphorylation (18). The model proposed further postulates that NSP5 hyperphosphorylation occurs in trans via a domain-dependent mechanism in which specific domains serve as activators or substrates for NSP5 hyperphosphorylation (18). In the present study, we show that full-length N-terminally tagged NSP5 is distributed in both soluble and previously unrecognized Triton X-100- and 0.2% sodium dodecyl sulfate (SDS)-insoluble cellular fractions. Our findings indicate that
Rotavirus is an icosahedral virus belonging to the family Reoviridae and has a genome composed of 11 double-stranded RNA segments (21). One characteristic feature of rotavirus infection is the formation of punctate perinuclear structures called viroplasms 2 to 3 h into the infectious cycle (36). Viroplasms are sites of viral RNA replication and packaging of genome segments into progeny virions. Several rotavirus proteins (VP1, VP2, VP3, VP6, NSP2, NSP5, and NSP6) have been found in viroplasms during infection (25, 47). Expression of NSP2 and NSP5 is reportedly required and sufficient for viroplasm formation (19, 22). However, it has also been shown that expression of N-terminally tagged NSP5 alone results in the formation of viroplasm-like structures (32). NSP5 contains 198 amino acids with a predicted molecular mass of approximately 21 kDa. NSP5 is highly phosphorylated in infected cells resulting in a series of posttranslationally modified isoforms that range from 26 to 35 kDa (2). The initial modification that results in the shift from 21 to 26 kDa is unknown, but the appearance of 28- and 32- to 35-kDa isoforms from a 26-kDa precursor has been ascribed to O-glycosylation and hyperphosphorylation, respectively (2, 6, 47). Hyperphosphorylation of untagged, full-length NSP5 reportedly requires the expression of the rotavirus NSP2 protein (1,
* Corresponding author. Mailing address: Department of Medicine and Department of Molecular Genetics and Microbiology, Stony Brook University, Stony Brook, NY 11794. Phone: (631) 444-2120. Fax: (631) 444-8886. E-mail:
[email protected]. 1807
1808
SEN ET AL.
J. VIROL. TABLE 1. Sequences of primers used for NSP5 constructs Primer sequencea
Construct
N-198 C-198 GFP130-198 S67A S67D a
Forward 5⬘-CCGGAATTCAGGATGCATCACCACCATCACCATCACGGTTCTCTCAGTATTGACGTGACA-3⬘ Reverse 5⬘-CCGCTCGAGCGGTTACAAATCTTCAATCAACTGCATTGC-3⬘ Forward 5⬘-CCGGAATTCAGGATGTCTCTCAGTATTGACGTGACAAG-3⬘ Reverse 5⬘-CCGCTCGAGTCAGTGGTGGTGGTGGTGGTGCAGATCCTCTTCTGAGATGAGTTTTTGTT CCAAATCTTCAATCAACTGCATTGC-3⬘ Forward 5⬘-CGGGAATTCCGTTTCCAAGAAGGAGAAATCC-3⬘ Reverse 5⬘-CGCGGATCCTCACAAATCTTCAATCAACTGC-3⬘ Forward 5⬘-GGACCATCTGATTCTGCTGCAAACGACCCACTCACCAGTTTTTCG-3⬘ Reverse 5⬘-CGAAAAACTGGTGAGTGGGTCGTTTGCAGCAGAATCAGATGGTCC-3⬘ Forward 5⬘-GGACCATCTGATTCTGCTGACAACGACCCACTCACCAGTTTTTCG-3⬘ Reverse 5⬘-CGAAAAACTGGTGAGTGGGTCGTTGTCAGCAGAATCAGATGGTCC-3⬘
Enzyme
EcoRI XhoI EcoRI XhoI EcoRI BamHI
Restriction site adapters are underlined. The bold sequence indicates a nucleotide change to give the desired amino acid via site-directed mutagenesis.
normally only insoluble NSP5 accumulates into hyperphosphorylated isoforms and that NSP5 is still hyperphosphorylated following mutagenesis of serine 67; without deleting NSP5 domains; or without coexpression of NSP2. In addition, inhibiting cellular phosphatases with calyculin A resulted in the accumulation of hyperphosphorylated NSP5 isoforms in soluble fractions. Our findings indicate that soluble NSP5 is constitutively phosphorylated and dephosphorylated and that dephosphorylation prevents the accumulation of soluble hyperphosphorylated NSP5 isoforms. Interestingly, both NSP5 insolubility and the accumulation of hyperphosphorylated NSP5 isoforms were abolished by adding a Myc tag to the NSP5C terminus, indicating the importance of an unmodified C terminus in both processes. However, soluble C-tagged NSP5 was also hyperphosphorylated when phosphatases were inhibited, indicating that C-terminal modifications alter NSP5 solubility but not the ability of NSP5 to be phosphorylated. Fusion of 68 C-terminal NSP5 residues to green fluorescent protein (GFP) conferred both insolubility and GFP localization into viroplasm-like structures, in the absence of hyperphosphorylation, indicating that the NSP5 C terminus directs protein localization into insoluble cellular fractions and viroplasms. Our findings demonstrate that NSP5 solubility is a fundamental parameter that needs to be considered when evaluating NSP5 hyperphosphorylation and that NSP5 hyperphosphorylation and solubility are independent protein properties. These studies further indicate that NSP5 domains recruit both cellular kinases and phosphatases that coordinately regulate NSP5 hyperphosphorylation. MATERIALS AND METHODS Cell culture, virus, and reagents. Fetal rhesus monkey kidney cells (MA104) and African green monkey kidney fibroblast cells (COS-7) were maintained in Dulbecco’s modified Eagle’s medium (Sigma) containing 10% fetal bovine serum (Sigma). Rhesus rotavirus (RRV) (P5B, G3) was activated using 5 g of trypsin (Sigma) per ml for 1 h at 37°C in serum-free medium and used for infection. Cytochalasin D, colchicine, forskolin (Sigma), okadaic acid (Calbiochem), and calyculin A (Calbiochem) were used at the indicated concentrations. Antibodies used for Western blotting were anti-HisG (Invitrogen), anti-GAL4 (BD Biosciences), anti-Myc (Invitrogen), antivimentin (Sigma), antitubulin (Sigma), antikeratin 8/18 L2A1 (NeoMarkers, Fremont, CA), anti-mouse horseradish peroxidase conjugate (Amersham), and anti-rabbit horseradish peroxidase conjugate (Amersham). Empigen BB was purchased from Calbiochem, and NP-40, SDS, and Triton X-100 were from Sigma. Cloning and mutagenesis of NSP5. The full-length gene encoding the RRV NSP5 protein (31) was cloned using purified RNA from RRV-infected cells. At 6 h postinfection, total RNA was extracted using RNeasy (QIAGEN). cDNA was
obtained by reverse transcription using random hexamers and 20 units avian myeloblastosis virus reverse transcriptase (Roche) in the presence of 1 mM deoxynucleoside triphosphates and 5 mM MgCl2 at 25°C for 10 min, 42°C for 1 h, and 94°C for 5 min. PCR was carried out using specific primers containing the 5⬘ and 3⬘ restriction site adaptors as well as N-terminal His6G or C-terminal His6Myc tags (Table 1). PCR products representing the entire open reading frame of RRV NSP5 were cloned into pcDNA3.1(⫹) (Invitrogen) as an N-terminally tagged 6x-His-Gly fusion protein (N-NSP5) or as a C-terminally tagged His6GMyc (C-NSP5) fusion protein into the EcoRI and XhoI sites. RRV NSP5 was also cloned into pBIND (Promega) as an N-terminally tagged GAL4 fusion protein into the BamHI and XbaI sites and grown in Escherichia coli XL1Blue cells (Stratagene). The GFP-C68 protein was constructed by PCR of the C-terminal 68 residues of RRV NSP5 and subsequent unidirectional cloning into pEGFP-CI (Clontech) using EcoRI and BamHI sites. Site-directed mutagenesis was carried out on the N-NSP5 template to change serine 67 to alanine or an aspartic acid (S67A and S67D, respectively) using the Quikchange site-directed mutagenesis kit (Stratagene). All clones were verified by automated sequencing using the BigDye terminator sequencing system (Applied Biosystems). Transfection and protein purification. Transfection and protein expression were carried out using 50% confluent COS-7 cells grown in six-well cluster plates using either a modified calcium phosphate method (33) or FuGene6 (Roche) as directed by the company. Cells were lysed 48 h posttransfection for Ni-nitrilotriacetic acid (NTA) purification under denaturing conditions (16). Denaturing NSP5 purification was carried out by lysing cells in guanidine buffer (6 M guanidine hydrochloride, 0.1 M Na2HPO4, 10 mM imidazole, pH 8.0). Cell lysates were sonicated and 50 l of Ni-NTA-agarose resin (QIAGEN) was added to the clarified supernatant. Tubes were rotated for 2 h at 20°C, resin was collected by centrifugation and washed four times in guanidine buffer, followed by two washes in wash buffer (25 mM Tris-HCl, 20 mM imidazole, pH 6.8). Residual fluid was removed using a 30-gauge needle, and beads were resuspended in 20 l of 2⫻ Laemmli sample buffer (4% SDS, 20% glycerol, 100 mM Tris-HCl, pH 6.8, 0.002% bromophenol blue, 10% 2-mercaptoethanol) and loaded on 12 or 15% SDS-PAGE gels. Analysis of NSP5 solubility. The solubility of N-NSP5 or C-NSP5 expressed protein was examined 48 h posttransfection in the buffers indicated, radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.2% SDS); TX-100 lysis buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10% glycerol, 1% Triton X-100, 1 mM dithiothreitol); NP-40 buffer (150 mM NaCl, 40 mM Tris-HCl, pH 8.0, 2 mM EDTA, 10% glycerol, 0.1% NP-40); EMP buffer (5 mM EDTA, 2% Empigen BB in phosphate-buffered saline). Whole-cell lysates were prepared in 2⫻ WCL buffer (125 mM Tris-HCl, pH 6.8, 20% glycerol, 4% SDS). In all cases, lysis was carried out on ice for 20 min, followed by centrifugation at 18,000 ⫻ g for 30 min to yield soluble and pellet fractions. Equivalent amounts of each fraction were analyzed by 15% SDS–PAGE, transferred to nitrocellulose membranes, and immunoblotting was carried out using the indicated antibodies as described earlier (28). Analysis of keratins 8 and 18. Keratins were analyzed using a previously described protocol with minor modifications (13). Briefly, COS-7 cells were transfected with His6G-NSP5 and 48 h posttransfection, approximately 1.2 ⫻ 106 cells were pelleted and resuspended in 125 l of phosphate-buffered saline (PBS) fractionation buffer (10 mM EDTA, 0.5 g of okadaic acid/ml, and protease inhibitor cocktail [Sigma]), lysed by three consecutive freeze-thaw cycles, and centrifuged at 10,000 ⫻ g for 15 min to obtain the cytosolic fraction. The pellet
VOL. 80, 2006
HYPERPHOSPHORYLATION OF ROTAVIRUS NSP5 PROTEIN
1809
FIG. 1. Solubility of N-terminally tagged His6G-NSP5 and GAL4-tagged NSP5 in 1% Triton X-100. COS-7 cells were transfected with NSP5 tagged N-terminally with His6G-NSP5- (A) or GAL4 DNA binding domain (B). Cells were lysed in buffer containing 1% Triton X-100, and proteins present in the supernatant were separated by 15% PAGE and Western blotted with HisG- or GAL4-specific antibodies. Open arrows indicate the position of N-NSP5 protein and the closed arrow indicates the GAL4 tag expressed alone. (C) His6G-NSP5 was expressed and lysed in 1% Triton X-100, and both soluble (S) and pellet (P) fractions were analyzed for the presence of NSP5 by Western blot as in A. The band detected above 66 kDa represents a nonspecific cellular protein detected by the His-G antibody used.
was resuspended in 125 l of 1% NP-40 in PBS fractionation buffer and placed on a rocker for 15 min before being respun to obtain the NP-40-soluble fraction. The pellet was resuspended in 1% Empigen BB in PBS fractionation buffer and again placed on a rocker for 15 min before being respun. The pellet was subsequently resuspended in 2% SDS in PBS fractionation buffer to obtain the SDSsoluble fraction. Equivalent volumes of the different fractions were separated on 15% SDS-PAGE and analyzed by Western blotting using anti-HisG, antivimentin, or antikeratin 8/18 antibodies. Treatment with inhibitors. For experiments using inhibitors of cytoskeletal elements, COS-7 cells expressing His6G-NSP5 at 48 h posttransfection were treated with the indicated concentrations of inhibitors for 1 h, washed twice in ice-cold PBS, and lysed using ice-cold RIPA buffer on ice for 20 min. Soluble and pellet fractions were collected after centrifugation at 18,000 ⫻ g for 20 min and equivalent amounts of each fraction were analyzed by immunoblotting using anti-HisG antibodies. Okadaic acid (1 nM for 2 h) and calyculin A (2.5 to 200 nM for 0.5 to 5 h) treatment of cells was carried out for the indicated times 40 h posttransfection After washing in PBS, cells were lysed and analyzed as described above. Fluorescence microscopy. COS-7 cells were transfected with FuGene 6 (Roche) in six-well plates using 1.5 g of the indicated construct. At 40 to 48 h posttransfection, cells were washed three times in Dulbecco’s modified Eagle’s medium and fluorescence was observed using a Nikon diaphot fluorescence microscope. In alternate experiments, cells were lysed at 48 h posttransfection using Triton X-100 lysis buffer, and equivalent amounts of soluble and pellet fractions were analyzed by Western blotting using anti-GFP rabbit polyclonal antibody (Santa Cruz). Blots were developed using an ECL kit (Amersham) and the ratio of soluble to pellet protein was calculated for each sample using the NIH Image analysis program.
NSP5 studies (5, 6, 37). Analysis of Triton X-100-soluble proteins showed that both the His6G- and GAL4-tagged NSP5 proteins were present as a single isoform (Fig. 1A and B). In order to further address the solubility of NSP5, we treated pellets from Triton X-100 lysates with 2% SDS and observed that 32- to 35-kDa NSP5 isoforms were abundantly present in the Triton X-100 pellet fraction (Fig. 1C, lane 3). In order to verify this observation, we analyzed NSP5 isoforms solubilized by 6 M guanidine hydrochloride or by 0.2 to 2.0% SDS. While 6 M guanidine and 2% SDS solubilized 32- to 35-kDa NSP5 isoforms (Fig. 2, lanes 2 and 5), treatment with 0.2% SDS yielded only a single NSP5 band (Fig. 2, lane 3). Collectively, these results reveal that the majority of NSP5 is highly insoluble and that the accumulation of high-molecular-weight NSP5
RESULTS N-tagged NSP5 is highly insoluble and hyperphosphorylated. In initial experiments designed to examine NSP5 expression, the entire ORF encoding the NSP5 gene from rhesus rotavirus (31) was cloned as an N-terminal GAL4- or His6Gtagged fusion protein (N-NSP5). COS-7 cells were transfected with these plasmids and protein expression was analyzed 48 h posttransfection. Initially, cells were lysed using a buffer containing Triton X-100, which was routinely used in previous
FIG. 2. Analysis of insoluble N-terminally tagged NSP5. His6GNSP5-transfected cells were lysed in buffer containing 2% SDS (lanes 1 and 2), 0.2% SDS (lane 3), or 6 M guanidine hydrochloride (lanes 4 and 5). In each case, supernatants were treated with guanidine hydrochloride and N-NSP5 was purified on Ni-NTA-agarose under denaturing conditions. His6G-NSP5 was detected by immunoblot using anti-His G antibody. Basal (B) and hyperphosphorylated (HP) isoforms are indicated.
1810
SEN ET AL.
J. VIROL.
FIG. 3. Analysis of NSP5 cytoskeleton association. (A) COS-7 cells expressing His6G-NSP5 were treated (48 h after transfection) with the indicated amounts of colchicine, cytochalasin D, or forskolin, for 1 h. Soluble (S) and pellet (P) fractions were prepared using 0.2% SDS RIPA buffer and equivalent amounts of each fraction were analyzed by Western blotting using anti-HisG antibodies as above. UT, untreated with inhibitors. (B). Cells transiently expressing N-NSP5 were lysed 48 h posttransfection in PBS by three consecutive freeze-thaw cycles, and pellet fractions were sequentially solubilized using 1% NP-40, 1% Empigen, and 10% SDS as described in detail in the text. Equivalent amounts of each fraction were loaded on 15% PAGE and immunoblotted for the presence of His6G-NSP5, keratins 8 (K8) and 18 (K18), or vimentin as indicated. (C). Cells expressing His6G-NSP5 were incubated in the presence of 1 nM okadaic acid for 2 h, and NSP5 was analyzed following solubilization in PBS, NP-40, Empigen, and SDS as described for panel A. Equivalent amounts of each fraction were loaded on 15% PAGE and Western blotted for His6G-NSP5 or keratins 8 and 18. (D) BHK-21 cells were transfected and cell lysates were prepared 48 h later in 1% Triton X-100 for analysis of pellet and soluble fractions by Western blotting using anti-HisG antibody.
isoforms occurs predominantly in Triton X-100- or 0.2% SDSinsoluble cellular fractions. Nature of N-tagged NSP5 insolubility. We hypothesized that insoluble N-terminally tagged NSP5 (N-NSP5) may be associated with cytoskeletal structures. To examine whether N-NSP5 was associated with cytoskeletal elements, we used two classes of cytoskeletal inhibitors specific for actin (cytochalasin D and forskolin) and microtubules (colchicine). Treatment of cells with increasing amounts of cytoskeletal inhibitors increased the solubility of N-NSP5 slightly, but changes were not dose dependent and most NSP5 protein remained in insoluble fractions following treatment (Fig. 3A). These results do not suggest a specific association of insoluble NSP5 with actin filaments or microtubules. However, a small but consistent amount of soluble hyperphosphorylated NSP5 was observed in
these experiments at all concentrations of inhibitors used. Actin and microtubule inhibitors have been shown to affect the intermediate filament protein vimentin similarly and such changes are attributed to an indirect effect of actin/microtubule depolymerization on vimentin (23). Unfortunately, specific cell-permeating inhibitors of intermediate filaments are not currently available to test this directly. In order to examine whether N-NSP5 is associated with intermediate filaments, we compared the solubility of NSP5 with keratins 8 and 18, which are well-characterized intermediate filament proteins (14). A scheme for the purification of keratins 8 and 18 used earlier by Chou et al. was employed (13). In brief, cells were lysed in PBS, and the pellet fraction was sequentially extracted into NP-40, Empigen, and SDS buffers to yield cytosolic (PBS- and NP-40-soluble fractions) and
VOL. 80, 2006
HYPERPHOSPHORYLATION OF ROTAVIRUS NSP5 PROTEIN
insoluble (Empigen- and SDS-soluble fractions) cellular fractions. N-NSP5 was recovered only from the SDS-soluble fraction (Fig. 3B). This finding indicates that NSP5 is even more insoluble than keratins 8 and 18 or another intermediate filament protein, vimentin, which are substantially solubilized by Empigen (Fig. 3B). It has been reported that treatment of cells with the phosphatase inhibitor okadaic acid results in the solubilization of keratins 8 and 18 that is accompanied by a shift in the solubility profile of these proteins into PBS- and NP-40-soluble fractions (27). Like keratins 8 and 18, treatment of cells expressing N-NSP5 with 1 nM okadaic acid resulted in a significant shift of N-NSP5 into PBS-soluble fractions (Fig. 3C). These results revealed a similar affect of okadaic acid on the solubility of N-NSP5 and intermediate filaments, which may be significant for NSP5 to provide a structural platform for viroplasms or for NSP5 localization to viroplasms. Since BHK-21 cells are deficient in keratins 8 and 18 (26), we expressed N-NSP5 in BHK-21 cells and evaluated whether NSP5 insolubility was keratin 8 and 18 dependent. Figure 3D demonstrates that N-NSP5 remains insoluble when expressed in BHK-21 cells that lack keratins 8 and 18. This indicates that the insolubility of N-NSP5 is not dependent on the presence of keratins 8 and 18 in cells and instead suggests that N-NSP5 may have similar solubility properties to that of keratins. However, these findings do not rule out an essential role for other intermediate filaments in N-NSP5 insolubility. Modifying the NSP5 C terminus alters localization and hyperphosphorylation. A recent study has shown that N-tagged, but not C-tagged, NSP5 forms viroplasm-like structures following transient expression that are indistinguishable from authentic rotavirus viroplasms (32). Here, we examined the solubility and hyperphosphorylation of C-terminally tagged NSP5 (C-NSP5) in the presence of several detergents. Cells expressing N- and C-NSP5 were lysed in the presence of different detergents, and equivalent amounts of soluble or insoluble fractions were analyzed by Western blot. As shown in Fig. 4A, N-NSP5 is hyperphosphorylated and insoluble unless solubilized in 2% SDS. In contrast, C-tagged NSP5 is highly soluble, not detected in pellet fractions, and lacks high-molecularweight isoforms under all lysis conditions examined (Fig. 4B). These results demonstrate that modification of the NSP5 C terminus alters the fundamental insolubility of NSP5 and blocks the appearance of hyperphosphorylated NSP5 isoforms. Calyculin A directs the accumulation of hyperphosphorylated soluble isoforms of NSP5. Inhibition of cellular phosphatases with okadaic acid has demonstrated that hyperphosphorylated NSP5 can be found in Triton X-100-soluble fractions (6). Here we used a potent, cell-permeating inhibitor of PP1/ 2A, calyculin A, and assessed its effect on NSP5 solubility and hyperphosphorylation. Treatment of cells expressing N-NSP5 with calyculin A resulted in a significant shift towards soluble hyperphosphorylated NSP5 isoforms as early as 30 min after exposure (Fig. 5A). Five hours after exposure, most of the soluble protein was found in hyperphosphorylated isoforms (Fig. 5A), indicating that phosphatase inhibition resulted in the appearance of hyperphosphorylated soluble NSP5 in a timedependent manner. Interestingly, the shift to hyperphosphorylated isoforms occurred in both soluble and insoluble forms of N-NSP5, indicating that soluble N-NSP5 is intrinsically capable
1811
FIG. 4. Contrasting solubility and hyperphosphorylation of C-tagged (B) and N-tagged (A) NSP5. COS-7 cells were transfected with either N-His6G-NSP5 (N-NSP5) or C-Myc-tagged NSP5 (CNSP5) and lysed 48 h posttransfection using the indicated detergents. Equivalent amounts of soluble (S) and pellet (P) fractions from each lysate were separated by 15% PAGE and Western blotted using antiHisG or anti-c-Myc antibodies as above. The asterisk indicates a nonspecific cellular protein detected by the anti-Myc antibody.
of being hyperphosphorylated, provided dephosphorylation is blocked. Dose-dependent addition of calyculin A indicated that 25 nM calyculin A was sufficient to direct the shift of nearly all N-tagged NSP5 into hyperphosphorylated isoforms (Fig. 5B). These results indicate that soluble NSP5 is maintained in basal isoforms as a consequence of constitutive dephosphorylation. Our experiments suggested that dephosphorylation is an important parameter regulating NSP5 hyperphosphorylation. As a result, we examined the effect of the phosphatase inhibitor calyculin A on the phosphorylation of C-NSP5 (Fig. 6). Interestingly, C-NSP5, which is not hyperphosphorylated normally, was hyperphosphorylated as indicated by a shift of the protein into high-molecular-weight isoforms following calyculin A treatment (Fig. 6). Moreover, hyperphosphorylated C-tagged NSP5 isoforms were completely soluble and failed to accumulate in insoluble fractions. These findings indicate that hyperphosphorylation does not make NSP5 insoluble or direct the accumulation of NSP5 in insoluble fractions. Second, these results demonstrate that hyperphosphorylation is independent of N- or C-terminal modification of NSP5. Further, the appearance of soluble hyperphosphorylated NSP5 following calyculin A treatment indicates that soluble NSP5 is normally dephosphorylated in the absence of phosphatase inhibitors.
1812
SEN ET AL.
FIG. 5. Phosphatase inhibition results in the appearance of soluble hyperphosphorylated NSP5 isoforms. (A). COS-7 cells expressing His6G-NSP5 were treated with calyculin A (0.20 M) for the indicated times 48 h posttransfection, and lysed using 1% Triton X-100 lysis buffer. Equivalent amounts of soluble and pellet fractions were analyzed by SDS-PAGE and anti-HisG Western blotting. (B) His6GNSP5-transfected cells were treated with the indicated concentrations of calyculin A 48 h posttransfection for 1 h and lysed in 2% SDS. Equivalent amounts of lysates were separated by SDS-PAGE and N-NSP5 was detected by Western blotting using anti-HisG antibodies.
NSP5 C terminus confers insolubility to GFP and can form viroplasm-like structures. Mohan and coworkers recently reported that NSP5 residues 131 to 198 could form viroplasmlike structures in cells independently when fused to the C terminus of GFP (GFP-C68) (32). In contrast, a subsequent study suggested that viroplasm-like structures were obtained
FIG. 6. Calyculin A directs hyperphosphorylation of C-tagged NSP5 but not C-NSP5 insolubility. Forty-eight hours posttransfection, C-NSP5-transfected cells were treated with calyculin A (0.20 M) for the indicated times. Cells were lysed in 1% Triton X-100, and soluble and pellet fractions were analyzed by Western blot using anti-Myc specific antibodies. UT, untreated.
J. VIROL.
only when NSP5 mutants contained amino acids 1 to 33 (19). Since the solubility of NSP5 mutants was not previously evaluated and due to the potential relevance of our findings to viroplasm-like structures formation, we decided to examine the solubility and localization of GFP-C68 within cells. In agreement with Mohan et al. (32), we found that the GFP-C68 construct was capable of forming discrete punctate perinuclear structures described earlier as viroplasm-like structures (Fig. 7A, upper panel) and viroplasm-like structure formation did not require residues 1 to 33. Interestingly, addition of the last 68 amino acids of NSP5 to GFP resulted in a ⬎10-fold increase in the amount of GFP in insoluble fractions relative to soluble GFP, indicating that signals for localization to the insoluble fraction are present within the C-terminal 68 residues of NSP5 (Fig. 7B). GFP-C68 partitioned almost equally into both soluble and insoluble cellular fractions (Fig. 7B) and this is consistent with observations of both punctate and diffuse cytoplasmic localization of GFP-C68 within the same cell (Fig. 7A, upper panel). Compared to normal GFP, GFP-C68 did not show any additional isoforms suggestive of hyperphosphorylation. These findings further support our results that NSP5 phosphorylation does not correlate with its insolubility or localization to viroplasm-like structures. Earlier reports on NSP5 indicated that C-NSP5 is not localized into viroplasm-like structures unless expressed in cells infected with rotavirus (19). Consistent with this, we hypothesized that rotavirus infection may similarly direct C-NSP5 into the insoluble cellular fraction. Cells expressing the C-NSP5 protein were infected with RRV and lysed in Triton X-100 buffer. As shown in Fig. 7C, rotavirus infection resulted in the redistribution of C-NSP5 to insoluble fractions (lane 1), suggesting that an additional rotavirus protein likely regulates C-NSP5 viroplasm-like structure localization. Hyperphosphorylation of NSP5 does not depend on serine 67. A recent report concluded that serine 67 was required for NSP5 hyperphosphorylation and that mutating serine 67 to alanine blocked NSP5 hyperphosphorylation (18). Since only soluble NSP5 fractions were examined, we mutated serine 67 to alanine (S67A) or aspartic acid (S67D) and examined the importance of serine 67 on the hyperphosphorylation of the NSP5 mutants. As seen in Fig. 8A, S67D and S67A mutants displayed hyperphosphorylated isoforms indistinguishable from those of wild-type NSP5, and similarly hyperphosphorylated mutant NSP5 proteins were predominantly present in Triton X-100-insoluble fractions. The role of serine 67 in hyperphosphorylation was further tested by treating cells expressing S67A and S67D with calyculin A to allow accumulation of the protein into soluble hyperphosphorylated isoforms. As shown in Fig. 8B, calyculin A caused the appearance of hyperphosphorylated isoforms regardless of the serine 67 mutants used. These findings clearly indicate that serine 67 is not essential for hyperphosphorylation of NSP5. DISCUSSION Several studies have described NSP5 hyperphosphorylation and demonstrated that NSP5 is present in viroplasms (3, 4, 6, 19, 20, 22, 24, 30, 32, 34–38, 42, 43, 45, 47). However, the exact
VOL. 80, 2006
HYPERPHOSPHORYLATION OF ROTAVIRUS NSP5 PROTEIN
1813
FIG. 7. NSP5 C-terminal 68 residues direct GFP localization into viroplasm-like structures and protein insolubility. (A) COS-7 cells expressing either GFP fused to the 68 C-terminal NSP5 residues (GFP-C68, top panels) or GFP alone (lower panels) were observed by fluorescence microscopy 48 h posttransfection. Fluorescence, phase, and overlays of fluorescence and phase images are shown in adjacent panels. (B) Cells expressing GFP or GFP-C68 were lysed in 1% Triton X-100 and equivalent amounts of soluble and insoluble fractions were analyzed by PAGE and Western blot using anti-GFP antibodies. Densitometric analysis of band intensities by NIH Image was used to calculate the ratio of soluble to insoluble protein for each construct and is indicated as a ratio of soluble to pellet band densities (S/P ratio). (C) Cells expressing the C-NSP5 plasmid were infected with RRV for 6 h before lysis in 1% Triton X-100 and analysis of the soluble and insoluble fractions. The arrowhead indicates the position of the NSP5 protein detected in samples.
role of NSP5 in viroplasm formation remains to be defined. Towards an understanding of this process, a recently proposed model (18) summarized the state of knowledge on NSP5 hyperphosphorylation. First, full-length NSP5 reportedly requires coexpression of NSP2 for hyperphosphorylation. Second, specific NSP5 domains are suggested to serve as activators of phosphorylation by working in trans on discrete substrate domains of NSP5 to effect hyperphosphorylation. Third, phosphorylation of serine 67 by casein kinase 1 was reported to be essential for NSP5 hyperphosphorylation (18). However, the findings reported here provide a completely distinct model of NSP5 phosphorylation from that previously proposed primarily because we demonstrate that hyperphosphorylated NSP5 accumulates in 0.2% SDS-insoluble fractions that prior studies have not considered. Our findings also demonstrate that solu-
ble NSP5 is rapidly dephosphorylated, suggesting that analyzing soluble NSP5 does not reflect the state of NSP5 phosphorylation within the cell. Our results indicate that NSP5 is predominately insoluble and that hyperphosphorylated isoforms accumulate in insoluble, but not soluble, cellular fractions. The findings indicate that solubilization of 32- to 35-kDa hyperphosphorylated NSP5 requires the use of 2% SDS or 6 M guanidine hydrochloride, and therefore it seems likely that previous studies of NSP5 hyperphosphorylation and localization have analyzed only soluble NSP5. A single earlier study found that during rotavirus infection NSP5 was present in both Triton X-100-soluble and -insoluble fractions approximately 4 hours postinfection (6). However, the significance of the insoluble NSP5 was not examined further in this or other studies (5, 6). From the results
1814
SEN ET AL.
J. VIROL.
FIG. 8. Serine 67 is not essential for NSP5 hyperphosphorylation. (A) Serine 67 in N-His6G-NSP5 was mutated either to alanine (S67A) or to aspartic acid (S67D). Cells expressing wild-type N-His6G-NSP5 as well as the S67A and S67D N-NSP5 mutants were analyzed 48 h posttransfection for the appearance of hyperphosphorylated NSP5 isoforms. Soluble (S) and pellet (P) fractions from 1% Triton X-100 lysis of cells were analyzed as described for Fig. 2A by SDS-PAGE and anti-HisG Western blot. (B) S67A and S67D N-NSP5 mutants were expressed in cells and treated with calyculin A (0.20 M) for 30 min prior to 2% SDS lysis. Equivalent amounts of whole-cell lysates from calyculin A-treated and untreated cells were separated by 15% SDS-PAGE and Western blotted using anti-HisG antibodies.
presented here, other studies on NSP5 have reportedly used conditions which yield only soluble NSP5 by our analysis (6, 20, 22, 32, 37, 41, 43, 46). Our studies indicate that the innate insolubility of NSP5 and the primary localization of hyperphosphorylated NSP5 isoforms in insoluble fractions are fundamental aspects of NSP5 function. Interestingly, the hyperphosphorylation of NSP5 is not the exclusive property of insoluble NSP5 and tagging either the N or C terminus of NSP5 does not determine whether NSP5 is a substrate for phosphorylation. Through the use of phosphatase inhibitors, we found that soluble N- or C-tagged NSP5 also appear in high-molecular-weight hyperphosphorylated isoforms. This indicates that soluble NSP5 is constitutively hyperphosphorylated but that rapid dephosphorylation of soluble NSP5 prevents the appearance of hyperphosphorylated soluble isoforms. These findings demonstrate that both soluble and insoluble forms of NSP5 are substrates for cellular kinases and further suggest the prominent association of cellular phosphatases with soluble NSP5. Our results demonstrate that neither NSP2 coexpression nor deletion of NSP5 domains is required for NSP5 hyperphosphorylation and that serine 67 is completely dispensable for NSP5 hyperphosphorylation. Based on the insolubility of NSP5 and the dephosphorylation of soluble NSP5 reported here, there are several explanations for prior findings that were used to formulate a model of NSP5 hyperphosphorylation (2, 5, 6, 18–20, 22, 32, 37, 43). These principally relate to the insolubility of NSP5 and the lack of prior studies analyzing insoluble fractions. Although it was proposed that serine 67 was an essential requirement for NSP5 hyperphosphorylation (18), our findings demonstrate that serine 67 is completely dispensable for NSP5 hyperphosphorylation and the mutant protein is both insoluble and hyperphosphorylated like wild-type NSP5. Similarly, the presence of domains previously described as NSP5 phosphor-
ylation inhibitory domains (18) clearly does not prevent NSP5 phosphorylation when present in the full-length protein, as previously proposed (18). Additional findings previously interpreted as defining activation and substrate domains on NSP5 (18–20) may alternatively indicate that specific NSP5 domains determine the protein’s solubility or alternatively NSP5 interactions with cellular kinases or phosphatases. Similar to phosphatase inhibition, deletion of a domain required to recruit a cellular phosphatase would result in the appearance of hyperphosphorylated NSP5 isoforms. Findings presented here provide a strong rationale for analyzing phosphatase recruitment domains on NSP5 and analyzing the solubility and phosphorylation of previously described NSP5 deletion mutants. Tagging NSP5 at its C or N terminus has provided further insight into the functions of the protein and the role of endterminal domains in directing NSP5 to cellular compartments. Interestingly, N-tagged, but not C-tagged, NSP5 proteins accumulate in insoluble fractions. A recent study also showed that NSP5 fused upstream of a GFP tag is unable to form viroplasm-like structures when expressed in cells (32). The highly soluble nature of C-tagged NSP5 indicates that a modification of the NSP5 C terminus prevents its localization to insoluble fractions or viroplasms, suggesting that C-terminal protein-protein interactions are likely to direct NSP5 localization within cells. In contrast, it was recently shown that GFP present at the N terminus of NSP5 or placed upstream of 68 C-terminal NSP5 residues was sufficient to form viroplasm-like structures (32). We observed that addition of 68 NSP5 C-terminal residues to GFP (GFP-C68) conferred insolubility on GFP constructs and was also localized in a punctate perinuclear pattern characteristic of rotavirus viroplasms. These findings indicate that the ability of NSP5 to form viroplasm like structures is coincident with its insolubility and suggest that insoluble NSP5 is likely to be the relevant form of NSP5 within the cell. These results thus
VOL. 80, 2006
HYPERPHOSPHORYLATION OF ROTAVIRUS NSP5 PROTEIN
provide a beginning understanding of the biochemical nature of rotavirus viroplasms and suggest that they are highly insoluble structures formed intrinsically by NSP5. However, further work is required to understand the insolubility of NSP5 and its subcellular localization. Our findings also indicate that NSP5 insolubility depends on a blocked N terminus and suggest the importance of N-terminal NSP5 interactions in directing NSP5 insolubility. The terminal regions of NSP5 are known to interact with other proteins: the N terminus interacts with the NSP2 protein, whereas the C terminus interacts with NSP2 and NSP6, as well as with other NSP5 monomers (1, 20, 22, 24, 42, 43). Thus, a plethora of interactions with other rotavirus proteins could potentially regulate the insoluble localization and formation of viroplasms by blocking either the N or the C terminus of NSP5, similar to the function of epitope tags on the expressed NSP5 protein. Interestingly, expression of NSP2 reportedly enhances NSP5 hyperphosphorylation (1, 10, 20, 42, 46). Although this was proposed to be a result of a transfer of phosphate groups from NSP2 to NSP5 via the nucleoside triphosphatase activity of NSP2 (39, 40, 42, 46), it has since been reported that the nucleoside triphosphatase activity of NSP2 does not affect NSP5 phosphorylation (10). Although we have shown that NSP2 expression is not required for NSP5 hyperphosphorylation our results suggest an alternate mechanism for NSP2 enhancement of NSP5 hyperphosphorylation. NSP2 binding to NSP5 may prevent NSP5 interactions with cellular phosphatases or inhibit the dephosphorylation of soluble NSP5 resulting in the appearance of hyperphosphorylated soluble NSP5 isoforms. It will be interesting to determine whether NSP2 actually competes with cellular phosphatases for a binding site on soluble NSP5. Viroplasms are sites of rotavirus replication, genome assortment, and assembly, but are biochemically uncharacterized structures (3, 4, 9, 12, 15, 21, 29, 34–36, 38). Several viruses use cytoskeletal elements for virus assembly and replication (17). However, our results indicate that NSP5 is even more insoluble than intermediate filament proteins (keratins 8 and 18) but that NSP5 insolubility is not dependent on the presence of keratin 8 or 18 within cells. This suggests the potential for NSP5 to form insoluble intermediate filament-like structures within cells through its innate insolubility. Although dimerization of soluble NSP5 monomers has been documented (43), it is unknown whether NSP5 assembles into higher-order insoluble oligomeric structures. Future work on this aspect of NSP5 assembly should be of interest since intermediate filaments are known to oligomerize in a phosphorylation- and dephosphorylation-dependent manner (11). Although the insolubility of NSP5 is not determined by hyperphosphorylation, NSP5 similarities to keratins and its presence in viroplasm-like structures suggest the potential for NSP5 to fulfill similar virus-specific cytoskeleton-like functions during infection. A similar correlation between insolubility and localization into viroplasms is also emerging from recent studies on closely related reoviruses. The 721-amino-acid reovirus nonstructural protein NS is likely a functional NSP5 homologue since it independently forms viroplasms (7, 8) and since it is also present in Triton X-100-insoluble fractions (44). Although NS is not hyperphosphorylated like NSP5, a recent study demonstrated that C-terminal residues 421 to 721 are respon-
1815
sible for NS localization into viroplasms (7). The similarity between the insolubility of reovirus NS and rotavirus NSP5 proteins and their ability to form viroplasms suggest that the biochemical nature and the precise subcellular location of viroplasms may be closely related in these viruses despite dramatically different sequences, protein sizes, and posttranslational modifications. The findings presented in this study offer new insights into the nature of NSP5. Based on our results, we propose that NSP5 is localized in both the soluble and insoluble fractions and this process may depend on the interactions of the NSP5 N- and C-terminal domains. Further, insoluble NSP5 is coincident with discrete viroplasm-like structures formed by NSP5 and this property is intrinsic to the C-terminal 68 residues of NSP5. Hyperphosphorylation of NSP5 is also an intrinsic property of the protein that is independent of its insolubility. Soluble NSP5 readily accumulates in hyperphosphorylated isoforms when phosphatases are blocked, demonstrating that determinants of NSP5 phosphorylation are present in soluble forms but the protein is constitutively dephosphorylated. The roles of NSP2 and cellular kinases or phosphatases in regulating NSP5 phosphorylation need to be evaluated. Although a complete reevaluation of the various NSP5 mutants characterized in other studies is beyond the scope of this report, our findings underscore the importance of considering NSP5 insolubility and constitutive dephosphorylation in future studies on NSP5. In light of our findings, the cellular kinases and phosphatases that interact with NSP5 remain to be determined and their role in NSP5 functions within viroplasms disclosed. Discrete roles of NSP5 hyperphosphorylation and insolubility are apparent from our studies and warrant a further understanding of the function and regulation of NSP5 within rotavirus viroplasms. ACKNOWLEDGMENTS We thank Jim Bliska and the PPG for assistance with fluorescence imaging, Nandini Sen for helpful discussions and critical reading of the manuscript, and Karen Endriss for technical support. Research was supported in part by NIH PO1AI055621, NIH RCE Award, NIH RO1AI47873, and VA Merit Award to E.R.M. REFERENCES 1. Afrikanova, I., E. Fabbretti, M. C. Miozzo, and O. R. Burrone. 1998. Rotavirus NSP5 phosphorylation is up-regulated by interaction with NSP2. J. Gen. Virol. 79:2679–2686. 2. Afrikanova, I., M. C. Miozzo, S. Giambiagi, and O. Burrone. 1996. Phosphorylation generates different forms of rotavirus NSP5. J. Gen. Virol. 77: 2059–2065. 3. Aponte, C., D. Poncet, and J. Cohen. 1996. Recovery and characterization of a replicase complex in rotavirus-infected cells by using a monoclonal antibody against NSP2. J. Virol. 70:985–991. 4. Berois, M., C. Sapin, I. Erk, D. Poncet, and J. Cohen. 2003. Rotavirus nonstructural protein NSP5 interacts with major core protein VP2. J. Virol. 77:1757–1763. 5. Blackhall, J., A. Fuentes, K. Hansen, and G. Magnusson. 1997. Serine protein kinase activity associated with rotavirus phosphoprotein NSP5. J. Virol. 71:138–144. 6. Blackhall, J., M. Munoz, A. Fuentes, and G. Magnusson. 1998. Analysis of rotavirus nonstructural protein NSP5 phosphorylation. J. Virol. 72:6398– 6405. 7. Broering, T. J., M. M. Arnold, C. L. Miller, J. A. Hurt, P. L. Joyce, and M. L. Nibert. 2005. Carboxyl-proximal regions of reovirus nonstructural protein muNS necessary and sufficient for forming factory-like inclusions. J. Virol. 79:6194–6206. 8. Broering, T. J., J. S. Parker, P. L. Joyce, J. Kim, and M. L. Nibert. 2002. Mammalian reovirus nonstructural protein microNS forms large inclusions and colocalizes with reovirus microtubule-associated protein micro2 in transfected cells. J. Virol. 76:8285–8297.
1816
SEN ET AL.
9. Campagna, M., C. Eichwald, F. Vascotto, and O. R. Burrone. 2005. RNA interference of rotavirus segment 11 mRNA reveals the essential role of NSP5 in the virus replicative cycle. J. Gen. Virol. 86:1481–1487. 10. Carpio, R. V., F. D. Gonzalez-Nilo, H. Jayaram, E. Spencer, B. V. Prasad, J. T. Patton, and Z. F. Taraporewala. 2004. Role of the histidine triad-like motif in nucleotide hydrolysis by the rotavirus RNA-packaging protein NSP2. J. Biol. Chem. 279:10624–10633. 11. Chang, L., and R. D. Goldman. 2004. Intermediate filaments mediate cytoskeletal crosstalk. Nat. Rev. Mol. Cell. Biol. 5:601–613. 12. Chnaiderman Xiao, J., M. Barro, and E. Spencer. 2002. NSP5 phosphorylation regulates the fate of viral mRNA in rotavirus infected cells. Arch. Virol. 147:1899–1911. 13. Chou, C. F., C. L. Riopel, L. S. Rott, and M. B. Omary. 1993. A significant soluble keratin fraction in ‘simple’ epithelial cells. Lack of an apparent phosphorylation and glycosylation role in keratin solubility. J. Cell Sci. 105: 433–444. 14. Coulombe, P. A., and M. B. Omary. 2002. ‘Hard’ and ‘soft’ principles defining the structure, function and regulation of keratin intermediate filaments. Curr. Opin. Cell Biol. 14:110–122. 15. Dector, M. A., P. Romero, S. Lopez, and C. F. Arias. 2002. Rotavirus gene silencing by small interfering RNAs. EMBO Rep. 3:1175–1180. 16. Denisova, E., W. Dowling, R. LaMonica, R. Shaw, S. Scarlata, F. Ruggeri, and E. R. Mackow. 1999. Rotavirus capsid protein VP5ⴱ permeabilizes membranes. J. Virol. 73:3147–3153. 17. Dohner, K., and B. Sodeik. 2005. The role of the cytoskeleton during viral infection. Curr. Top. Microbiol. Immunol. 285:67–108. 18. Eichwald, C., G. Jacob, B. Muszynski, J. E. Allende, and O. R. Burrone. 2004. Uncoupling substrate and activation functions of rotavirus NSP5: phosphorylation of Ser-67 by casein kinase 1 is essential for hyperphosphorylation. Proc. Natl. Acad. Sci. USA 101:16304–16309. 19. Eichwald, C., J. F. Rodriguez, and O. R. Burrone. 2004. Characterization of rotavirus NSP2/NSP5 interactions and the dynamics of viroplasm formation. J. Gen. Virol. 85:625–634. 20. Eichwald, C., F. Vascotto, E. Fabbretti, and O. R. Burrone. 2002. Rotavirus NSP5: mapping phosphorylation sites and kinase activation and viroplasm localization domains. J. Virol. 76:3461–3470. 21. Estes, M. K. 2001. Rotaviruses and their replication, p. 1747–1785. In P. M. Howley and D. M. Knipe (ed.), Fields virology, 4th ed., vol. 2. Lippincott Williams & Wilkins, Philadelphia, Pa. 22. Fabbretti, E., I. Afrikanova, F. Vascotto, and O. R. Burrone. 1999. Two non-structural rotavirus proteins, NSP2 and NSP5, form viroplasm-like structures in vivo. J. Gen. Virol. 80:333–339. 23. Goldman, R. D. 1971. The role of three cytoplasmic fibers in BHK-21 cell motility. I. Microtubules and the effects of colchicine. J. Cell Biol. 51:752– 762. 24. Gonzalez, R. A., M. A. Torres-Vega, S. Lopez, and C. F. Arias. 1998. In vivo interactions among rotavirus nonstructural proteins. Arch. Virol. 143:981– 996. 25. Gonzalez, S. A., and O. R. Burrone. 1991. Rotavirus NS26 is modified by addition of single O-linked residues of N-acetylglucosamine. Virology 182: 8–16. 26. Ku, N. O., H. Fu, and M. B. Omary. 2004. Raf-1 activation disrupts its binding to keratins during cell stress. J. Cell Biol. 166:479–485. 27. Ku, N. O., J. Liao, and M. B. Omary. 1998. Phosphorylation of human keratin 18 serine 33 regulates binding to 14-3-3 proteins. EMBO J. 17:1892– 1906. 28. LaMonica, R., S. S. Kocer, J. Nazarova, W. Dowling, E. Geimonen, R. D. Shaw, and E. R. Mackow. 2001. VP4 differentially regulates TRAF2 signaling, disengaging JNK activation while directing NF-B to effect rotavirusspecific cellular responses. J. Biol. Chem. 276:19889–19896.
J. VIROL. 29. Lopez, T., M. Rojas, C. Ayala-Breton, S. Lopez, and C. F. Arias. 2005. Reduced expression of the rotavirus NSP5 gene has a pleiotropic effect on virus replication. J. Gen. Virol. 86:1609–1617. 30. McNulty, M. S., W. L. Curran, and J. B. McFerran. 1976. The morphogenesis of a cytopathic bovine rotavirus in Madin-Darby bovine kidney cells. J. Gen. Virol. 33:503–508. 31. Mohan, K. V., and C. D. Atreya. 2001. Nucleotide sequence analysis of rotavirus gene 11 from two tissue culture-adapted ATCC strains, RRV and Wa. Virus Genes 23:321–329. 32. Mohan, K. V., J. Muller, I. Som, and C. D. Atreya. 2003. The N- and C-terminal regions of rotavirus NSP5 are the critical determinants for the formation of viroplasm-like structures independent of NSP2. J. Virol. 77: 12184–12192. 33. O’Mahoney, J. V., and T. E. Adams. 1994. Optimization of experimental variables influencing reporter gene expression in hepatoma cells following calcium phosphate transfection. DNA Cell Biol. 13:1227–1232. 34. Patton, J. T. 2001. Rotavirus RNA replication and gene expression. Novartis Found Symp. 238:64–81. 35. Patton, J. T., and C. O. Gallegos. 1988. Structure and protein composition of the rotavirus replicase particle. Virology 166:358–365. 36. Petrie, B. L., H. B. Greenberg, D. Y. Graham, and M. K. Estes. 1984. Ultrastructural localization of rotavirus antigens using colloidal gold. Virus Res. 1:133–152. 37. Poncet, D., P. Lindenbaum, R. L’Haridon, and J. Cohen. 1997. In vivo and in vitro phosphorylation of rotavirus NSP5 correlates with its localization in viroplasms. J. Virol. 71:34–41. 38. Sandino, A. M., J. Pizarro, J. Fernandez, M. C. Fellay, and E. Spencer. 1988. Involvement of structural and nonstructural polypeptides on rotavirus RNA synthesis. Arch. Biol. Med. Exp. (Santiago) 21:381–392. 39. Taraporewala, Z., D. Chen, and J. T. Patton. 1999. Multimers formed by the rotavirus nonstructural protein NSP2 bind to RNA and have nucleoside triphosphatase activity. J. Virol. 73:9934–9943. 40. Taraporewala, Z. F., D. Chen, and J. T. Patton. 2001. Multimers of the bluetongue virus nonstructural protein, NS2, possess nucleotidyl phosphatase activity: similarities between NS2 and rotavirus NSP2. Virology 280: 221–231. 41. Taraporewala, Z. F., and J. T. Patton. 2001. Identification and characterization of the helix-destabilizing activity of rotavirus nonstructural protein NSP2. J. Virol. 75:4519–4527. 42. Taraporewala, Z. F., and J. T. Patton. 2004. Nonstructural proteins involved in genome packaging and replication of rotaviruses and other members of the Reoviridae. Virus Res. 101:57–66. 43. Torres-Vega, M. A., R. A. Gonzalez, M. Duarte, D. Poncet, S. Lopez, and C. F. Arias. 2000. The C-terminal domain of rotavirus NSP5 is essential for its multimerization, hyperphosphorylation and interaction with NSP6. J. Gen. Virol. 81:821–830. 44. Touris-Otero, F., M. Cortez-San Martin, J. Martinez-Costas, and J. Benavente. 2004. Avian reovirus morphogenesis occurs within viral factories and begins with the selective recruitment of sigmaNS and lambdaA to microNS inclusions. J. Mol. Biol. 341:361–374. 45. Vascotto, F., M. Campagna, M. Visintin, A. Cattaneo, and O. R. Burrone. 2004. Effects of intrabodies specific for rotavirus NSP5 during the virus replicative cycle. J. Gen. Virol. 85:3285–3290. 46. Vende, P., Z. F. Taraporewala, and J. T. Patton. 2002. RNA-binding activity of the rotavirus phosphoprotein NSP5 includes affinity for double-stranded RNA. J. Virol. 76:5291–5299. 47. Welch, S. K., S. E. Crawford, and M. K. Estes. 1989. Rotavirus SA11 genome segment 11 protein is a nonstructural phosphoprotein. J. Virol. 63:3974– 3982.
