Hypoxia Enhances Platelet-derived Growth Factor ... - ATS Journals

Hypoxia Enhances Platelet-derived Growth Factor Signaling in the Pulmonary Vasculature by Down-Regulation of Protein Tyrosine Phosphatases Henrik ten Freyhaus1,2, Markus Dagnell3, Maike Leuchs1, Marius Vantler1,2, Eva M. Berghausen1, Evren Caglayan1,2, ¨ stman3, Kai Kappert6, and Stephan Rosenkranz1,2 Norbert Weissmann4, Bhola K. Dahal4, Ralph T. Schermuly4,5, Arne O 1

Klinik III fu ¨ ln, Germany; 3Department of ¨ r Innere Medizin, and 2Center for Molecular Medicine Cologne, Universita¨t zu Ko¨ln, Ko 4 Oncology/Pathology, Karolinska Institute, Stockholm, Sweden; University of Giessen Lung Center, Giessen, Germany; 5Max-Planck-Institute for Heart and Lung Research, Bad Nauheim, Germany; and 6Center for Cardiovascular Research, Institut fu¨r Pharmakologie, Charite´-Universita¨tsmedizin Berlin, Germany

Rationale: Platelet-derived growth factor (PDGF) plays a pivotal role in the pathobiology of pulmonary hypertension (PH) because it promotes pulmonary vascular remodeling. PH is frequently associated with pulmonary hypoxia. Objectives: To investigate whether hypoxia alters PDGF b receptor (bPDGFR) signaling in the pulmonary vasculature. Methods: The impact of chronic hypoxia on signal transduction by the bPDGFR was measured in human pulmonary arterial smooth muscle cells (hPASMC) in vitro, and in mice with hypoxia-induced PH in vivo. Measurements and Main Results: Chronic hypoxia significantly enhanced PDGF-BB–dependent proliferation and chemotaxis of hPASMC. Pharmacologic inhibition of PI3 kinase (PI3K) and PLCg abrogated these events under both normoxia and hypoxia. Although hypoxia did not affect bPDGFR expression, it increased the ligand-induced tyrosine phosphorylation of the receptor, particularly at binding sites for PI3K (Y751) and PLCg (Y1021). The activated bPDGFR is dephosphorylated by protein tyrosine phosphatases (PTPs). Interestingly, hypoxia decreased expression of numerous PTPs (T cell PTP, density-enhanced phosphatase-1, PTP1B, and SH2 domain-containing phosphatase-2), resulting in reduced PTP activity. Hypoxia-inducible factor (HIF)-1a is involved in this regulation of gene expression, because hypoxia-induced bPDGFR hyperphosphorylation and PTP down-regulation were abolished by HIF-1a siRNA and by the HIF-1a inhibitor 2-methoxyestradiol. bPDGFR hyperphosphorylation and PTP down-regulation were also present in vivo in mice with chronic hypoxia-induced PH. Conclusions: Hypoxia reduces expression and activity of bPDGFRantagonizing PTPs in a HIF-1a–dependent manner, thereby enhancing receptor activation and proliferation and chemotaxis of hPASMC. Because hyperphosphorylation of the bPDGFR and down-regulation of PTPs occur in vivo, this mechanism likely has significant impact on the development and progression of PH and other hypoxia-associated diseases. Keywords: vascular remodeling; pulmonary hypertension; hypoxia; platelet-derived growth factor; protein tyrosine phosphatases

Pulmonary hypertension (PH) is a devastating disease harboring a poor prognosis. Although an imbalance between vasoconstrictive (e.g., endothelin) and vasodilatory (e.g., nitric oxide) factors contributes to pulmonary vasoconstriction and increased pul(Received in original form November 4, 2009; accepted in final form December 22, 2010) Supported by the Ko¨ln Fortune Program of the medical faculty of the University of Cologne (177/2005 and 180/2007 to H.t.F.); by the Deutsche Forschungsgemeinschaft (Ro-1306/2–2 and SFB 612, project B10, to S.R., and Ka 1820/2–1 to K.K.); and by the Center for Molecular Medicine Cologne (project A6 to S.R.). Correspondence and requests for reprints should be addressed to Stephan Rosenkranz, M.D., Klinik III fu¨r Innere Medizin, Herzzentrum der Universita¨t zu Ko¨ln, Kerpener Str. 62, 50924 Ko¨ln, Germany. E-mail: [email protected] Am J Respir Crit Care Med Vol 183. pp 1092–1102, 2011 Originally Published in Press as DOI: 10.1164/rccm.200911-1663OC on December 22, 2010 Internet address: www.atsjournals.org

AT A GLANCE COMMENTARY Scientific Knowledge on the Subject

Platelet-derived growth factor (PDGF) is an important contributor to pulmonary vascular remodeling and plays a pivotal role in the pathobiology of pulmonary hypertension (PH). What This Study Adds to the Field

Chronic hypoxia enhances PDGF-b receptor (bPDGFR) signaling and PDGF-dependent proliferation and chemotaxis in human pulmonary arterial smooth muscle cells, because it reduces the expression and activity of bPDGFRantagonizing protein tyrosine phosphatase. Protein tyrosine phosphatase down-regulation and increased bPDGFR activation also occur in the pulmonary vasculature under hypoxic conditions in vivo, and are linked to the development of PH. This mechanism likely has an impact on the onset and progression of PH.

monary vascular resistance, PH is increasingly recognized as a proliferative disease of the pulmonary arteries. The structural alterations within the vessel wall (vascular remodeling) are mainly caused by proliferation and migration of pulmonary arterial smooth muscle cells (PASMC), and adventitial fibroblasts (1–4). Platelet-derived growth factor (PDGF) represents one of the strongest mitogens and chemokines in these cells. PDGF exerts its actions via two transmembrane receptor subtypes, termed a and b, which belong to the family of receptor tyrosine kinases (RTK) (5–7). Of the two receptor subtypes, PDGF b receptor (bPDGFR)–mediated signals are particularly important for vascular development and remodeling (8, 9). On ligand binding, the bPDGFR autophosphorylates on tyrosine residues and subsequently recruits and activates SH-2 domain-containing signaling molecules, which associate with the receptor at specific binding sites (10). Inhibition of PDGF signaling by the tyrosine kinase inhibitor imatinib was recently shown to reverse pulmonary arterial remodeling and to improve survival in animal models of PH (2). These data highlight the importance of PDGF signaling in the pathobiology of PH. Imatinib treatment may, however, be complicated by significant cardiotoxicity, which may result in overt heart failure (11). Apparently, this effect is not caused by inhibition of PDGF signaling, but rather by interference with c-Abl. Therefore, it is crucial to thoroughly characterize PDGF signaling pathways to identify more specific targets for pharmacologic intervention in PH.

ten Freyhaus, Dagnell, Leuchs, et al.: Impact of Hypoxia on PDGF Signaling in the Lung

1093

TABLE 1. PRIMER SEQUENCES Name

Description

Forward

hDEP-1 hPTP-1B hTC-PTP hSHP-2 18s

Density-enhanced phosphatase-1 Protein tyrosine phosphatase-1B T cell protein tyrosine phosphatase Src homology domain 2-containing PTP2 18s rRNA

TCGTTCGTGACTACATGAAGCA GGTGTGGGAGCAGAAAAGCA TGAGAGAATCTGGCTCCTTGAAC CGGCTTATCATGTGCTTGGTAA CCGCAGCTAGGAATAATGGAATA

CCCCAGCACTGCAATGC TGTGCGCATTTTAACGAACCT TGCCAGAGCGCCCAAT CTGCCTGATTCCATCTCATGTAAA TCTAGCGGCGCAATACGAAT

mDEP-1 mPTP-1B mTC-PTP mSHP-2 18s

Density-enhanced phosphatase-1 Protein tyrosine phosphatase-1B T cell protein tyrosine phosphatase Src homology domain 2-containing PTP2 18s rRNA

GCAGTGTTTGGATGTATCTTTGGT CGGGAGGTCAGGGACCTT ACCTGCAGTGATCCATTGCA CCTCAACACAACTCGTATCAATGC ACCTGGTTGATCCTGCCAGTAG

CTTCATTATTCTTGGCATCTGTCCTT GGGTCTTTCCTCTTGTCCATCA ATCAGAACAAGACAGGTATCTACAAGAGA TGTTGCTGGAGCGTCTCAAA TTAATGAGCCATTCGCAGTTTC

Most studies on RTK action focused on the transcriptional up-regulation of RTKs or their ligands as major determinants of RTK activity. However, RTKs like the bPDGFR are dephosphorylated by protein tyrosine phosphatases (PTPs), which thereby alter or terminate their signals (12). The PTP family consists of a diversity of receptor-like and cytosolic proteins. Individual PTPs display high substrate specificity, because depletion of different PTPs specifically altered PDGF-, insulinlike growth factor-1–, and insulin-dependent signaling pathways (13–15). Recent studies have implicated that a number of PTPs, such as density-enhanced phosphatase (DEP)-1, PTP-1B, T cell (TC)-PTP, and SH-2 domain-containing phosphatase (SHP)-2 serve as negative regulators of PDGF signaling (14, 16–18). PH is associated with chronic hypoxia and vascular cell proliferation is enhanced under hypoxic conditions (18). Interestingly, presence of proliferative agents (e.g., growth factors, such as PDGF, or PKC activators, such as the phorbol ester phorbol 12-myristate 13-acetate) seems to be required in vitro (19–21), because hypoxia alone does not promote cellular growth (22). To clarify this issue, we investigated the impact of hypoxia on PDGFR signaling and PDGF-dependent cellular responses in hPASMCs. We found that chronic hypoxia enhanced the activation state of the bPDGFR, downstream signaling events, and PASMC proliferation and migration on PDGF stimulation. This was associated with decreased expression and activity of PTPs in vitro and in vivo by a mechanism that critically involves hypoxiainducible factor (HIF)-1a. Some of the results of these studies have been previously reported in the form of an abstract (23).

Reverse

right jugular vein with a custom-made silicone catheter, and right ventricular systolic pressure was monitored. The transducers were calibrated before every measurement. After exsanguination of the animal, the lungs and heart were isolated. The right ventricle was dissected from the left ventricle plus septum (LV 1 S), and the samples were dried and weighed to obtain the right to left ventricle plus septum ratio (RV/LV 1 S) as a measurement of right ventricular hypertrophy (RVH) (2, 24).

Tissue Processing and Histology The lungs were fixed by immersion in a 3.5% formalin solution. Following paraffin embedding of the tissue, sectioning was performed to obtain 3-mm thick sections. Double-immunostaining was performed

METHODS Cell Culture and Normoxic-Hypoxic Incubation Human PASMC were purchased from Lonza Biosciences (Verviers, Belgium) and maintained in the media recommended by the manufacturer smooth muscle growth medium-2 (SMGM-2) supplemented with 5% fetal calf serum, basic fibroblast growth factor (FGF) [2 ng/ml], epidermal growth factor (EGF) [0.5 ng/ml], insulin [5 mg/ml], gentamicin [50 mg/ml], and amphotericin-B [50 ng/ml]). Experiments were performed with cells from two different lots, giving reproducible results. Cells (passage 4–8) were exposed to normoxic conditions (5% CO2, 95% air, 378C) in a water-jacketed incubator or to hypoxic conditions (1% O2, 5% CO2, 378C) in modular incubation chambers (Billups-Rothenberg, Del Mar, CA).

Animals and Exposure to Hypoxia Exposure of C57Bl/6J mice to normobaric normoxia (21% O2) or hypoxia (10% O2) was performed as described (2). All experiments were performed according to national and international regulations.

Hemodynamics and Right Ventricular Hypertrophy Measurements Animals were anesthetized with ketamine-xylazine, tracheostomized, and artificially ventilated. The right ventricle was catheterized via the

Figure 1. Hypoxia enhances platelet-derived growth factor (PDGF)– dependent proliferation and chemotaxis of human pulmonary arterial smooth muscle cells. (A) Proliferation was assessed as bromo-deoxyuridine (BrdU) incorporation. Cells were kept under normoxia or hypoxia (1% O2) and stimulated with PDGF-BB as indicated. (B) Migration of cells was assessed using a modified Boyden chamber. Cells were treated as in A. Data represent means 6 SEM from five (proliferation) and three (migration) independent experiments. *P , 0.01 versus buffer (normoxia). †P , 0.001 versus buffer (normoxia). ‡P , 0.001 versus buffer (hypoxia). xP , 0.05 versus normoxia. kP , 0.001 versus normoxia.

1094

AMERICAN JOURNAL OF RESPIRATORY AND CRITICAL CARE MEDICINE

with an anti–a smooth muscle actin (dilution 1:900, clone 1A4; Sigma, St. Louis, MO) and antihuman von Willebrand factor antibody (dilution 1:900; Dako, Hamburg, Germany). Phosphorylation of the bPDGFR was monitored by an antibody that recognizes phosphorylated Y1021 (18). The degree of muscularization of small peripheral pulmonary arteries was assessed by using a computerized morphometric analysis system (QWin; Leica, Wetzlar, Germany), as described previously (2, 24). The QWin system computes the vessel size and categorizes the vessels as nonmuscularized (less than 5% a-SMC actin staining), partially muscularized (5–75% a-SMC actin staining) or fully muscularized (> 75% a-SMC actin staining). In each mouse, 80–100 intraacinar arteries (20–70 mm diameter) were analyzed.

VOL 183

2011

tion tubes with 5 ml of Ecoscint A (National Diagnostics, Atlanta, GA). Radioactivity was measured in a 2000CA Tri-Carb liquid scintillation analyzer (United Technologies Packard, Meriden, CT) (25).

siRNA Transfection The sense and antisense strands of HIF-1a siRNA were ACUUCUGG AUGCUGGUGAUdTdT and AUCACCAGCAUCCAGAAGUdTdT, directed against nucleotides 213–231 downstream of the translation start site (21). Control nonsilencing (n.s.) siRNA (‘‘All Star negative control’’) and HiPerfect transfection reagent were from Qiagen. Sufficient down-regulation of HIF-1a was achieved by transfection of 8 3 105 cells with 5 nM of siRNA for 48 hours.

Chemotaxis

Materials and Antibodies

The chemotactic response to PDGF was assessed by the modified Boyden chamber (NeuroProbe, Inc., Baltimore, MD), using collagencoated membrane filters, as described (5). Cells were incubated in serum- and growth factor–free media overnight before the experiment.

PDGF-BB was purchased from PromoCell (Heidelberg, Germany). The antibodies against RasGAP (69.3) and the bPDGFR (97A) were kind gifts from Andrius Kazlauskas (Harvard Medical School, Boston, MA). The phospho-specific p42/44 Erk, Src, and Akt antibodies were from Cell Signaling. The HIF-1a antibody was from BD Transduction

Proliferation DNA synthesis was analyzed by a 5-bromo-deoxyuridine–incorporation assay (Roche, Mannheim, Germany). Briefly, 5 3 104 cells were seeded in 96-well plates in SMGM-2. The next day, cells were incubated in serum- and growth factor–free media for 24 hours under normoxic or hypoxic (1% O2) conditions. PDGF-BB was added for 24 hours at the indicated concentrations in the absence or presence of inhibitors.

Immunoprecipitation of the bPDGFR and Western Blotting Cells were incubated in serum- and growth factor–free media overnight before the experiment. Then, hPASMC were kept under normoxic or hypoxic (1% O2) conditions and treated as indicated. The bPDGFR was immunoprecipitated as described (5). To analyze the protein levels of HIF-1a and the phosphorylation state of Erk 1/2, Akt, and the bPDGFR, similar amounts of total cell lysates were subjected to Western blot analysis using antibodies directed against RasGAP, phospho-Erk 1/2 (Thr202/Tyr204), phospho-Akt (Ser 473), phosphobPDGFR (directed against tyrosines 751 and 1021, respectively), and HIF-1a.

Quantitative Real-Time Polymerase Chain Reaction For ex vivo analyses, main pulmonary arteries were isolated from mice exposed to normoxia or hypoxia for 21 days followed by incubation in RNA-later (Qiagen, Hilden, Germany). For in vitro analyses, cells were incubated in serum- and growth factor–free media overnight and then subjected to hypoxia or normoxia. In both cases, RNA was isolated with RNeasy (Qiagen), transcribed to cDNA using random primers and Superscript II RT (Invitrogen, Carlsbad, CA), and then subjected to quantitative real-time polymerase chain reaction (SybrGreen Universal PCR Master Mix; Applied Biosystems, Foster City, CA). Primer sequences for human (top section of table) and mouse samples (bottom section) are listed in Table 1. The reaction was performed in triplicate with the Stratagene Mx3000P real-time polymerase chain reaction cycler (Stratagene; Agilent Technologies, La Jolla, CA). Expression of analyzed genes was normalized to 18 seconds.

PTP Activity Phosphatase activity was determined using a 32P-labeled src optimal peptide (sequence: AEEEIYGEFEAKKKK) as substrate and src as a kinase (in presence of ATP). Equal amounts of cells were exposed to hypoxia or normoxia for 24 hours. Cells were washed with degassed ice-cold phosphate-buffered saline and lysed with degassed PTP-assay lysis buffer (0.5 Triton X-100 [Sigma], 0.5% deoxycholic acid, 150 mM NaCl, 20 mM Tris pH 7.5) supplemented with 1 mM benzamidine and 1% Trasylol (Sigma). Lysates were centrifuged at 14,000 rpm at 48C for 20 minutes, followed by mixing with degassed PTP assay buffer supplemented with 10 mM dithiothreitol. Phosphatase activity was assessed by mixing equal amounts of cell lysates with peptide substrate in PTP assay buffer and allowing peptide dephosphorylation at 378C for 7 minutes. The reaction was terminated by addition of charcoal mixture. After separation of phosphorylated peptide from released phosphate by centrifugation, supernatants were transferred to scintilla-

Figure 2. PI3K and PLCg mediate platelet-derived growth factor (PDGF)–dependent proliferation and migration under normoxia and hypoxia. Proliferation (A) and migration (B) were assessed as described in the legend to Figure 1. Thirty minutes before PDGF treatment, cells were incubated with one of the following inhibitors: the PI3K inhibitor LY294002 (LY, 10 mM); the PLCg inhibitor U73122 (U73, 10 mM); the MEK kinase inhibitor U0126 (5 mM); or the p38 MAPK inhibitor SB203580 (SB, 10 mM). Data represent means 6 SEM from five (proliferation) and three (migration) independent experiments. *P , 0.01 versus buffer. †P , 0.01 versus PDGF (normoxia). ‡P , 0.05 versus PDGF (normoxia). xP , 0.05 versus PDGF (hypoxia). kP , 0.01 versus PDGF (hypoxia). #P , 0.05 versus normoxia.


Laboratories (San Diego, CA) and the phospho-specific bPDGFR antibodies were from Cell Signaling (Boston, MA) (phospho-Y751) and Abcam (Cambridge, UK) (phospho-Y1021). The anti-phosphotyrosine antibodies were from Santa Cruz (Santa Cruz, CA) (PY20) and Upstate Biotechnology (Waltham, MA) (4G10). LY294002, U0126, U73122, SB203580, and 2-methoxyestradiol (2ME2) were from Merck (Frankfurt, Germany).

Data Analysis All data are expressed as means 6 SEM. Statistical analysis was performed using one-way analysis of variance followed by NewmanKeuls post hoc test for multiple comparisons or Student t test, as appropriate. A P value less than 0.05 was considered significant.

RESULTS Hypoxia Enhances PDGF-dependent Proliferation and Migration

Because PDGF-dependent proliferation and migration of vascular smooth muscle cells are key events during pulmonary vascular remodeling, we assessed the impact of hypoxia on these cellular responses. Under normoxic conditions, PDGFBB concentration dependently induced proliferation and migration of hPASMCs to a maximal increase of 1.9 6 0.2 and 3.9 6 0.1 fold, respectively, at 30 ng/ml. Exposure of cells to hypoxia (1% O2) significantly enhanced the mitogenic and chemotactic response to PDGF-BB to maximally 2.8 6 0.3 and 5.2 6 0.3 fold, respectively (Figure 1).

1095

Using panels of chimeric receptor mutants (26), we identified PI3K and PLCg as critical mediators of bPDGFR-dependent proliferation and chemotaxis in aortic vascular smooth muscle cells. To assess if PI3K and PLCg are also involved in bPDGFR-mediated proliferation and chemotaxis of hPASMC, we applied pharmacologic inhibitors. As shown in Figure 2, PDGF-BB–dependent proliferation and migration are attenuated by inhibitors of PI3K (LY294002) and PLCg (U73122), whereas inhibition of other downstream mediators, such as MEKK (U0126) or p38MAPK (SB203580), had no effect. These data demonstrate that PI3K and PLCg are critical for PDGFinduced proliferation and migration of hPASMC. The fact that inhibition of PI3K and PLCg attenuated PDGF-dependent responses under both normoxic and hypoxic conditions indicates that hypoxia alters PDGF signaling more proximal in the signaling cascade, most likely by affecting receptor expression or activity. Hypoxia Mediates Hyperphosphorylation of the bPDGFR but Does Not Affect Receptor Expression

To assess the expression of the bPDGFR under normoxic and hypoxic conditions, hPASMCs were exposed to hypoxia for up to 48 hours, and bPDGFR protein levels were monitored by Western blot analysis. As shown in Figure 3A, hypoxia did not alter bPDGFR expression at any time point. In the next step, we investigated whether chronic hypoxia affects the ligandinduced tyrosine phosphorylation (activation) of the bPDGFR.

Figure 3. Hypoxia leads to hyperphosphorylation of the plateletderived growth factor b receptor (bPDGFR). (A) Hypoxia did not alter the protein expression of the bPDGFR. RasGAP represents the loading control. (B and D) Cells were exposed to normoxia or hypoxia (24 h) as indicated in serum-free and growth factor– free media, followed by treatment with PDGF-BB (10 ng/ml) for 5 minutes The bPDGFR was immunoprecipitated, followed by Western blotting for the bPDGFR (loading control) or phosphotyrosine (P-Y). (C and E ) Cells treated as in B and D were lysed and subjected to Western blotting for RasGAP (loading control), phospho-bPDGFR using site-specific antibodies (Y1021 or Y751), phospho-Akt, or phospho-Erk 1/2. Shown are representative Western blots (n 5 3–5 for each condition).

1096


To this end, the bPDGFR was immunoprecipitated, and receptor tyrosine phosphorylation was monitored by Western blotting. Hypoxia did not lead to detectable PDGFR phosphorylation or downstream signaling in unstimulated cells, whereas PDGF-BB gave a robust response (Figures 3B and 3C). As shown in Figure 3D, exposure of cells to hypoxia led to a significant increase of the receptor’s phosphotyrosine content on PDGF stimulation, indicating that hypoxia causes hyperactivation of the bPDGFR. PI3K and PLCg, which mediate the bPDGFR’s mitogenic and chemotactic signal in hPASMC, selectively associate with tyrosine residues Y751 and Y1021 in the cytoplasmic domain of the bPDGFR once these binding sites are phosphorylated. Therefore, we specifically monitored the phosphorylation of these critical binding sites using phosphoand site-specific antibodies (27). Figure 3E demonstrates that on PDGF stimulation Y751 and Y1021 were indeed hyperphosphorylated under hypoxic conditions. Consistently, hypoxia was also associated with enhanced phosphorylation of the downstream mediators Akt and Erk 1/2 (Figure 3E). Hypoxia Leads to Decreased PTP Expression and Activity

RTKs like the bPDGFR harbor an intrinsic tyrosine kinase activity that is induced by ligand-binding to the receptor. In addition, the phosphorylation state of the bPDGFR is determined by the modulating impact of PTPs. Based on the previously mentioned observation that the bPDGFR is hyperphosphorylated under hypoxic conditions, we hypothesized that

VOL 183

2011

hypoxia may either affect the expression level of the ligand or expression and activity of PTPs. Consequently, the expression levels of PDGF-B and bPDGFR-antagonizing PTPs, such as DEP-1, PTP-1B, TC-PTP, and SHP-2, were analyzed by quantitative real-time polymerase chain reaction under normoxia and hypoxia. Whereas hypoxia did not affect the expression level of PDGF-B, it caused a significant down-regulation of DEP-1, TCPTP, and PTP-1B to 0.80 6 0.04, 0.72 6 0.05, and 0.63 6 0.05 fold at 24 hours, respectively (Figure 4A). Furthermore, there was a trend toward down-regulation of SHP-2, which did not reach statistical significance. To investigate whether the reduced PTP expression results in a decrease of PTP activity, an in vitro PTP assay was performed. As shown in Figure 4B and in line with the data on PTP expression, hypoxia led to a significant decrease of total PTP activity to 68 6 9% of normoxic levels. Furthermore, the activity of individual PTPs including SHP-2, DEP-1, and PTP-1B was reduced to 62 6 3%, 66 6 8%, and 74 6 4%, respectively. To exclude the possibility that hypoxia exerted cytotoxic effects and thereby decreased PTP activity, we performed cytotoxicity assays, which demonstrated that cell viability was not impaired by hypoxia under the applied experimental conditions (not shown). Hence, the expression and activity of bPDGFR-antagonizing PTPs indeed show an inverse pattern to that of bPDGFR phosphorylation, and pharmacologic inhibition of PTPs by pervanadate led to hyperphosphorylation of the bPDGFR at tyrosine residues Y751 and Y1021 on PDGF stimulation (not shown).

Figure 4. Hypoxia induces down-regulation of protein tyrosine phosphatase (PTPs) transcripts and decreases PTP activity. (A) Cells were kept under normoxia or hypoxia (1% O2) for the indicated time points, followed by RNA isolation, cDNA synthesis, and quantitative real-time polymerase chain reaction analyses (n 5 4–7). DEP-1 5 density-enhanced phosphatase-1; TC-PTP 5 T cell PTP; SHP-2 5 SH2 domaincontaining phosphatase-2. (B) Total PTP activity and activity of SHP-2, DEP-1, and PTP-1B in cell lysates were determined using a peptide dephosphorylation assay. Results are from at least three independent experiments, each performed as duplicate. *P , 0.05 versus normoxia. †P , 0.01 versus normoxia.


HIF-1a Is Involved in Hypoxia-induced Down-Regulation of PTPs

To identify the subcellular mechanisms that are responsible for the down-regulation of PTPs, we focused on HIF-1a. Exposure of hPASMC to hypoxia led to a time-dependent and robust increase of HIF-1a protein expression with a maximum between 4 and 6 hours of hypoxia (Figure 5A). To investigate whether HIF-1a is causally involved in the regulation of PTPs and bPDGFR phosphorylation, we used RNA interference to block HIF-1a protein synthesis effectively. Transfection of hPASMC with HIF-1a siRNA completely abolished hypoxia-induced accumulation of HIF-1a protein, whereas a nonsilencing siRNA had no effect (Figure 5B). Furthermore, hypoxia-mediated hyperphosphorylation of the bPDGFR was also prevented by HIF-1a siRNA but not by nonsilencing siRNA (Figure 5C). It is important to note that bPDGFR phosphorylation was not completely abolished by HIF-1a siRNA but only decreased to the level observed in PDGF-treated cells under normoxia. Consistent with this observation, HIF-1a siRNA, but not nonsilencing siRNA, completely reversed the hypoxia-induced down-regulation of SHP-2, TC-PTP, DEP-1, and PTP-1B (Figure 5D). Interestingly, treatment with HIF-1a siRNA resulted in a significant up-regulation of DEP-1 transcript levels under hypoxic conditions. We finally tested whether pharmacologic inhibition of HIF-1a was also effective to abrogate the hypoxia-induced bPDGFR overactivity. To this end, we applied the small molecule HIF-1a inhibitor 2ME2 (28), which concentrationdependently blocked both the hypoxia-induced HIF-1a accumulation and hyperphosphorylation of the bPDGFR (Fig-

1097

ures 6A and 6B). In line with this observation, 2ME2 also reversed the enhanced PDGF-dependent proliferation and migration under hypoxic conditions (Figures 6C and 6D). Hyperphosphorylation of the bPDGFR and Down-Regulation of PTPs Occur In Vivo in Hypoxia-induced PH

To assess whether bPDGFR overactivity and down-regulation of PTPs under hypoxic conditions also occur in vivo, we took advantage of the established mouse model of hypoxia-induced PH. Exposure of C57Bl/6J mice to chronic hypoxia (10% O2 for 3 wk) led to the development of PH as indicated by an increase of right ventricular systolic pressure from 27.2 6 1.3 to 39.6 6 1.7 mm Hg. Furthermore, there was right ventricular hypertrophy, as indicated by an increase of the RV/LV 1 S from 0.23 6 0.01 to 0.33 6 0.01 (Figure 7A). As demonstrated in Figure 7B, these changes were accompanied by a significant increase of the number of partially and fully muscularized pulmonary arterioles from 47.3 6 0.6% to 54.3 6 2.3% and from 3 6 1.6% to 26.5 6 1.8%, respectively. Correspondingly, the number of nonmuscularized vessels decreased from 49.8 6 1.7% to 19.3 6 1.5%. Under hypoxic conditions, hematoxylin and eosin staining revealed a thickening of the vessel wall, which was accompanied by an increased content of vascular smooth muscle cells (a smooth muscle actin antibody staining). Importantly and in line with our observations in vitro, hypoxia-induced pulmonary vascular remodeling was associated with increased bPDGFR phosphorylation within the vascular wall (Figure 7C). Increased bPDGFR phosphorylation was also demonstrated by Western blotting in lung homogenates from hypoxic compared with normoxic mice (Figure 7D). To investigate whether hyper-

Figure 5. Hypoxia-inducible factor (HIF)-1a mediates hypoxia-induced down-regulation of protein tyrosine phosphatases (PTPs) and hyperphosphorylation of the platelet-derived growth factor b receptor (bPDGFR). (A) Cells were subjected to hypoxia for the indicated time points followed by Western blotting for RasGAP (loading control) or HIF-1a. (B) After transfection with HIF-1a–specific (H1a) or nonsilencing (n.s.) siRNA, cells were subjected to normoxia or hypoxia for 4 hours, followed by Western blot analysis of HIF-1a expression. (C) Cells transfected with HIF-1a or n.s. siRNA were subjected to hypoxia or kept under normoxic conditions for 24 hours, followed by Western blot analyses using phospho-specific antibodies targeting tyrosine residues required for binding of PLCg (Y1021) or PI3K (Y751). Shown are representative Western blots (n 5 3 for each condition). (D) Cells transfected with HIF-1a or n.s. siRNA were exposed to hypoxia/normoxia for 24 hours. RNA was isolated, cDNA synthesized, and subjected to quantitative real-time polymerase chain reaction analyses. Data represent means 6 SEM from three independent experiments, each performed in triplicate. DEP-1 5 density-enhanced phosphatase-1; TC-PTP 5 T cell PTP; SHP-2 5 SH2 domain-containing phosphatase-2. *P , 0.05 versus normoxia. †P , 0.05 versus H1a.

1098


VOL 183

2011

phosphorylation of the bPDGFR in pulmonary vessels correlates with down-regulation of PTPs under hypoxic conditions in vivo, gene expression of PTPs was monitored in pulmonary arteries of mice that were subjected to chronic hypoxia or normoxia for 3 days and 3 weeks. As shown in Figures 7E and 7F, hypoxia was associated with a down-regulation of the transcript levels of PTPs in vivo at both time points. At 3 weeks, there was a significant down-regulation of TC-PTP (0.64 6 0.09), DEP-1 (0.42 6 0.03), and PTP-1B (0.6 6 0.05) compared with normoxia (set as 1). As in the in vitro experiments, there was a trend toward regulation of SHP-2, which did not reach statistical significance. These data indicate that down-regulation of PTP expression, resulting in bPDGFR overactivity, also occurs in vivo in hypoxia-induced PH. Because the in vitro data link PTP expression and activity to the extent of bPDGFR phosphorylation, this mechanism is likely to have significant impact on the pathophysiology of pulmonary vascular remodeling. A schematic illustration of the proposed mechanism is given in Figure 8.

DISCUSSION

Figure 6. The hypoxia-inducible factor (HIF)-1a inhibitor 2-methoxyestradiol (2ME2) blocks hypoxia-induced overactivity of the plateletderived growth factor b receptor (bPDGFR). (A) Cells were treated with 2ME2 at the indicated concentrations, followed by exposure of cells to hypoxia or normoxia for 4 hours. Western blot analyses were performed as in Figure 5B. (B) Cells treated with 2ME2 in the indicated concentrations were subjected to normoxia/hypoxia for 24 hours. Western blot analyses were performed as in Figure 5C. Shown are representative Western blots (n 5 3 for each condition). (C and D) PDGF-dependent proliferation and migration were assessed as described in the legend to Figure 1. Shown are the effects of PDGF-BB in the absence or presence of 2ME2 under normoxic and hypoxic conditions. Data represent means 6 SEM from three independent experiments. *P , 0.05 versus buffer. xP , 0.05 versus normoxia. #P , 0.05 versus PDGF-BB alone.

Recent reports have demonstrated an important role of PDGF signaling for the development and progression of PH (1, 29, 30). PH is often caused or accompanied by chronic alveolar hypoxia and is characterized by hypertrophy and hyperplasia of PASMCs. It is well accepted that hypoxia causes pulmonary SMC growth, although the underlying mechanisms have remained elusive (31, 32). Our data show that PDGF-dependent proliferation and migration of hPASMC are substantially increased by hypoxia and is in line with earlier reports (20). Furthermore, we disclosed PI3K and PLCg as the critical signaling molecules mediating these responses. The importance of PI3K and PLCg for bPDGFR-driven proliferation has been shown previously in HepG2 cells (33) and is consistent with our findings in aortic SMC using panels of receptor mutants (Caglayan and Rosenkranz, unpublished). Because pharmacologic inhibition of PI3K and PLCg abolished PDGF-dependent responses under both normoxia and hypoxia, the hypoxia-sensitive signaling molecule seems to be located more proximal in the signaling cascade. Indeed, our data indicate that hypoxia increases the ligand-induced phosphorylation of the bPDGFR. These results are in line with data from animal models and human PH (2, 34). In contrast to these in vivo data, we did not detect a hypoxia-induced increase in bPDGFR expression in isolated cells. We believe that the defined cell count and cell population in vitro might account for this difference. Moreover, hypertrophy, hyperplasia, and migration of PASMC might have significant impact on RTK expression in vivo in remodeled compared with nonremodeled tissue that comprises a much smaller PASMC content. Interestingly, and in line with previous reports (35, 36), hypoxia alone did not promote PASMC proliferation or migration. In addition, hypoxia alone was not able to sufficiently phosphorylate the bPDGFR in our studies. Apparently, costimulation with growth factors is necessary for hypoxia-mediated mitogenesis (19–21). Because hypoxia alone (without ligand binding) did not result in adequate bPDGFR phosphorylation and PDGFdependent proliferation and migration, this suggested that hypoxia induced receptor activation and phosphorylation in an indirect fashion. We therefore sought to investigate endogenous regulators of bPDGFR phosphorylation. PTPs represent important negative regulators of RTK signaling, and their dysregulation has been associated with disease states, such as diabetes (13) and cancer (37, 38). Our data indicate that mRNA


1099

Figure 7. Hyperphosphorylation of the platelet-derived growth factor b receptor (bPDGFR) and down-regulation of protein tyrosine phosphatases (PTPs) occur in vivo in a mouse model of hypoxiainduced pulmonary hypertension (PH). (A) Right ventricular systolic pressure (RVSP), right ventricular hypertrophy, presented as the ratio of RV to LV plus septum weight (RV/LV 1 S), systolic arterial pressure (SAP), and hematocrit of mice subjected to normoxia or hypoxia (10% O2) for 3 weeks (n 5 5 in each group). *P , 0.01 versus normoxia. (B) Morphometric analysis of nonmuscularized, partially and fully muscularized pulmonary arteries (diameter 20–70 mm; n 5 5 in each group). *P , 0.01 versus normoxia. xP , 0.01 versus normoxia. (C ) Vascular remodeling and bPDGFR phosphorylation in small pulmonary vessels of mice subjected to normoxia or hypoxia for 3 weeks. Left panel: Hematoxylin-eosin (H/E) staining. Middle panel: Double staining for a smooth muscle actin (aSMA, purple) and the endothelial marker von Willebrand factor (vWF, brown). Right panel: PhosphobPDGFR (Y1021, brown). (D) Lung tissue from mice subjected to normoxia or hypoxia for 3 weeks was homogenized and subjected to Western blotting for RasGAP (loading control) and phospho-bPDGFR using phosphotyrosine antibodies (P-Y) or site-specific antibodies (Y1021 or Y751). Shown are representative Western blots (n 5 4 for each condition). (E and F) PTP expression. Pulmonary arteries were removed after exposure of mice to 3 days or 3 weeks of normoxia/hypoxia, followed by RNA isolation, cDNA synthesis, and quantitative real-time polymerase chain reaction (n 5 4 in each group). DEP-1 5 density-enhanced phosphatase-1; TC-PTP 5 T cell PTP; SHP-2 5 SH2 domain-containing phosphatase-2. *P , 0.001. †P , 0.05 versus normoxia.

expression of the PTPs TC-PTP, DEP-1, and PTP-1B is significantly decreased by hypoxia, whereas there was a nonsignificant trend for the down-regulation of SHP-2. This observation was consistent with decreased PTP activity under hypoxia. Decreased expression of various bPDGFR-antagonizing PTPs and its relevance for disease progression were recently demonstrated in a rat model of restenosis, where PTP expression also correlated inversely with bPDGFR activity (27). Although there is evidence for site-selective PDGFR dephosphorylation by PTPs, such as TC-PTP and DEP-1 (14, 39), other data indicate a more general attenuation of PDGFR signaling by PTPs (38). Future studies are necessary to clarify this issue. Our finding that hypoxia enhances cellular responses on PDGF stimulation raises the important question whether this effect also applies to other types of receptors. Schultz and

coworkers (21) recently reported an hypoxia-induced enhancement of the proliferative response toward three different RTKactivating growth factors (PDGF, FGF-2, and EGF), whereas this effect was not observed toward mitogens signaling via G protein–coupled receptors (thrombin and angiotensin II) or serine and threonine kinase receptors (transforming growth factor-b). This is of particular interest, because the respective receptors are also expressed in pulmonary vascular smooth muscle cells (40–42). Because RTKs, such as PDGFR but not other receptor classes are dephosphorylated and thus inactivated by PTPs, it seems likely that the enhancement of mitogenic and chemotactic responses by hypoxia is unique to peptide growth factors that signal through RTKs. Our data demonstrate that HIF-1a is critically involved in the down-regulation of PTPs and bPDGFR overactivity. It was

1100


Figure 8. Proposed model highlighting the impact of chronic hypoxia on platelet-derived growth factor b receptor (bPDGFR) signaling. In pulmonary arterial vascular smooth muscle cells chronic hypoxia induces hypoxia-inducible factor (HIF)-1a, leading to decreased expression and activity of bPDGFR-antagonizing protein tyrosine phosphatases (PTPs) by an unknown mechanism (dashed arrow). Because of the abolition of these crucial negative regulators, the ligand-induced bPDGFR phosphorylation is enhanced, as are cellular proliferation and migration. In vivo, these changes critically impact on pulmonary vascular remodeling and pulmonary vascular resistance (PVR), and therefore accelerate the progression of pulmonary hypertension.

not the aim of our study to identify the exact mechanisms how HIF-1a regulates PTP mRNA expression. However, transcriptional down-regulation of PTPs is most likely, because we identified putative HIF-1a binding sites in the promoter regions of the regulated PTPs. Because HIF-1a is known to recruit transcriptional coactivator (and corepressor) proteins to regulate target gene activity (43), these might also be involved in the regulation of PTP expression. Of high interest in this context is the finding that growth factors, such as PDGF, EGF, FGF-2, and thrombin, are able to induce HIF-1a protein expression even under normoxia (21). Because we show that knock-down of HIF-1a by RNA interference correlates with decreased PTP expression and activity, the probability of a vicious cycle arises. If this notion is true, it would have significant impact in situations of long-term exposure to growth factors as occurring in pathogenic states, such as PH, atherosclerosis, and cancer. Our findings that 2ME2 abolishes hypoxia-induced bPDGFR hyperphosphorylation suggest that 2ME2 may potentially reverse HIF-1a–dependent bPDGFR hyperactivation by hypoxia. 2ME2 is currently under investigation in clinical phase I (44) and II (45) trials for the treatment of solid tumors. In the context of pulmonary vascular disease, Tofovic and coworkers (46) have demonstrated that treatment with 2ME2 reverses monocrotaline-induced PH, although the authors did not provide a mechanism for their finding. The attenuation of bPDGFR activity could well be an explanation for the efficacy of 2ME2 in this context. Corroborating the in vitro data, our findings demonstrate that bPDGFR overactivity and down-regulation of PTPs also

VOL 183

2011

occur in vivo in a mouse model of hypoxia-induced PH. Reverse remodeling strategies represent a promising therapeutic concept for the treatment of PH, and inhibition of PDGF signaling was demonstrated to be effective to treat experimental (2) and human (47, 38) PH. As underscored by our findings that PTPs are major determinants of RTK phosphorylation and activity in hypoxic remodeled vessels, they may serve as potential additional targets to reverse vascular remodeling. As an example, PTP-1B was repeatedly suggested as therapeutic target (e.g., in diabetes and breast cancer) (38). This study has several limitations. First, we applied 1% oxygen in the in vitro experiments. Because it is currently not clear from the literature how best to mimic the hypoxic environment of PH, our approach may have caused rather severe hypoxia in cultured cells. Second, we specifically analyzed the effect of hypoxia on PASMCs in vitro. Because other cell types, such as fibroblasts, certainly play a major role in the pathogenesis of PH, further experiments in these cell types may be required to understand fully the interplay between hypoxia/ HIF-1a/PTPs in the context of PH. Third, we did not prove the direct connection between decreased PTP expression and bPDGFR phosphorylation in this study. However, experiments with the PTP inhibitor pervanadate (not shown) and earlier studies (14, 27, 39, 48) clearly demonstrated that decreased activity and expression of PTPs causes a ligand-dependent hyperphosphorylation of the bPDGFR. In summary, our data show that hypoxia increases PDGFmediated proliferation and migration of hPASMC caused by hyperphosphorylation of the bPDGFR, responses that critically involve PI3K and PLCg. Hypoxia stabilizes HIF-1a, which mediates a decrease in PTP expression and activity. bPDGFR overactivity and down-regulation of PTPs also occur in vivo in hypoxia-induced PH, pointing toward an important role of the described signaling pathway for the development and progression of pulmonary vascular remodeling. Consequently, inhibition of HIF-1a and restoration of PTP expression might represent novel therapeutic options in the treatment of PH. Our data indicate that the small molecule HIF-1a inhibitor 2ME2, which reverses hypoxia-induced bPDGFR overactivity, might be an interesting candidate that should be evaluated in future studies. Author Disclosure: H.F.’s institution received grants from the Ko¨ln Fortune Program of the medical faculty of the University of Cologne. M.D. has no financial relationship with a commercial entity that has an interest in the subject of this manuscript. M.L. has no financial relationship with a commercial entity that has an interest in the subject of this manuscript. M.V. has no financial relationship with a commercial entity that has an interest in the subject of this manuscript. E.M.B. has no financial relationship with a commercial entity that has an interest in the subject of this manuscript. E.C. has no financial relationship with a commercial entity that has an interest in the subject of this manuscript. N.W. has no financial relationship with a commercial entity that has an interest in the subject of this manuscript. B.K.D. has no financial relationship with a commercial entity that has an interest in the subject of this manuscript. R.T.S. has received consultancy fees from Solvay and Ergonex; he has received lecture fees from Actelion, Pfizer, and Bayer-Schering; he has received industrysponsored grants from Ergonex, Bayer-Schering, Solvay, and Pfizer. K.K. has been employed by Charite´-University Medicine Berlin, which has been supported by grants from Deutsche Forschungsgemeinschaft, Deutsche Stiftung fu¨r Herzforschung, Deutsche Diabetes Gesellschaft, and the European Commission; he has received royalties from the Ludwig Institute for Cancer Research. S.R.’s institution has received grants from the Ko¨ln Fortune Program, University of Cologne, Deutsche Forschungsgemeinschaft, and Zentrum fu¨r Molekulare Medizin Ko¨ln; he has received advisory board fees from Actelion, Pfizer, United Therapeutics, GlaxoSmithKline (GSK), and Lilly; he has received consultancy fees from Actelion, Pfizer, United Therapeutics, GSK, and Lilly; he has received lecture fees from Bayer Health Care, Actelion, Pfizer, GSK, United Therapeutics, and Lilly; he has received payment for development of educational presentations from Bayer Health Care and Actelion. Acknowledgment: The authors thank Andrius Kazlauskas (Harvard Medical School) for generously providing antibodies against the bPDGFR (97A) and RasGAP (69.3). This manuscript contains parts of a doctoral thesis by M.L.

ten Freyhaus, Dagnell, Leuchs, et al.: Impact of Hypoxia on PDGF Signaling in the Lung References 1. Perros F, Montani D, Dorfmuller P, Durand-Gasselin I, Tcherakian C, Le Pavec J, Mazmanian M, Fadel E, Mussot S, Mercier O, et al. Plateletderived growth factor expression and function in idiopathic pulmonary arterial hypertension. Am J Respir Crit Care Med 2008;178:81–88. 2. Schermuly RT, Dony E, Ghofrani HA, Pullamsetti S, Savai R, Roth M, Sydykov A, Lai YJ, Weissmann N, Seeger W, et al. Reversal of experimental pulmonary hypertension by PDGF inhibition. J Clin Invest 2005;115:2811–2821. 3. Gerasimovskaya EV, Tucker DA, Stenmark KR. Activation of phosphatidylinositol 3-kinase, Akt, and mammalian target of rapamycin is necessary for hypoxia-induced pulmonary artery adventitial fibroblast proliferation. J Appl Physiol 2005;98:722–731. 4. Das M, Burns N, Wilson SJ, Zawada WM, Stenmark KR. Hypoxia exposure induces the emergence of fibroblasts lacking replication repressor signals of PKCzeta in the pulmonary artery adventitia. Cardiovasc Res 2008;78:440–448. 5. Rosenkranz S, DeMali KA, Gelderloos JA, Bazenet C, Kazlauskas A. Identification of the receptor-associated signaling enzymes that are required for platelet-derived growth factor-AA-dependent chemotaxis and DNA synthesis. J Biol Chem 1999;274:28335–28343. 6. ten Freyhaus H, Huntgeburth M, Wingler K, Schnitker J, Baumer AT, Vantler M, Bekhite MM, Wartenberg M, Sauer H, Rosenkranz S. Novel Nox inhibitor VAS2870 attenuates PDGF-dependent smooth muscle cell chemotaxis, but not proliferation. Cardiovasc Res 2006;71:331–341. 7. Baumer AT, Ten Freyhaus H, Sauer H, Wartenberg M, Kappert K, Schnabel P, Konkol C, Hescheler J, Vantler M, Rosenkranz S. Pi3 kinase-dependent membrane recruitment of rac-1 and p47phox is critical for alpha PDGF receptor-induced production of reactive oxygen species. J Biol Chem 2007;283:7864–7876. 8. Sano H, Sudo T, Yokode M, Murayama T, Kataoka H, Takakura N, Nishikawa S, Nishikawa SI, Kita T. Functional blockade of plateletderived growth factor receptor-beta but not of receptor-alpha prevents vascular smooth muscle cell accumulation in fibrous cap lesions in apolipoprotein E-deficient mice. Circulation 2001;103:2955–2960. 9. Hart CE, Kraiss LW, Vergel S, Gilbertson D, Kenagy R, Kirkman T, Crandall DL, Tickle S, Finney H, Yarranton G, et al. PDGFbeta receptor blockade inhibits intimal hyperplasia in the baboon. Circulation 1999;99:564–569. 10. Heldin CH, Westermark B. Mechanism of action and in vivo role of platelet-derived growth factor. Physiol Rev 1999;79:1283–1316. 11. Kerkela R, Grazette L, Yacobi R, Iliescu C, Patten R, Beahm C, Walters B, Shevtsov S, Pesant S, Clubb FJ, et al. Cardiotoxicity of the cancer therapeutic agent imatinib mesylate. Nat Med 2006;12:908–916. 12. Kappert K, Peters KG, Bohmer FD, Ostman A. Tyrosine phosphatases in vessel wall signaling. Cardiovasc Res 2005;65:587–598. 13. Elchebly M, Payette P, Michaliszyn E, Cromlish W, Collins S, Loy AL, Normandin D, Cheng A, Himms-Hagen J, Chan CC, et al. Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 1999;283:1544–1548. 14. Persson C, Savenhed C, Bourdeau A, Tremblay ML, Markova B, Bohmer FD, Haj FG, Neel BG, Elson A, Heldin CH, et al. Siteselective regulation of platelet-derived growth factor beta receptor tyrosine phosphorylation by T-cell protein tyrosine phosphatase. Mol Cell Biol 2004;24:2190–2201. 15. Haj FG, Markova B, Klaman LD, Bohmer FD, Neel BG. Regulation of receptor tyrosine kinase signaling by protein tyrosine phosphatase1B. J Biol Chem 2003;278:739–744. 16. Jandt E, Denner K, Kovalenko M, Ostman A, Bohmer FD. The proteintyrosine phosphatase DEP-1 modulates growth factor-stimulated cell migration and cell-matrix adhesion. Oncogene 2003;22:4175–4185. 17. Nakata S, Fujita N, Kitagawa Y, Okamoto R, Ogita H, Takai Y. Regulation of platelet-derived growth factor receptor activation by afadin through SHP-2: implications for cellular morphology. J Biol Chem 2007;282:37815–37825. 18. Meyrick B, Reid L. Hypoxia and incorporation of 3H-thymidine by cells of the rat pulmonary arteries and alveolar wall. Am J Pathol 1979;96:51–70. 19. Dempsey EC, McMurtry IF, O’Brien RF. Protein kinase C activation allows pulmonary artery smooth muscle cells to proliferate to hypoxia. Am J Physiol 1991;260:L136–L145. 20. Xu Y, Stenmark KR, Das M, Walchak SJ, Ruff LJ, Dempsey EC. Pulmonary artery smooth muscle cells from chronically hypoxic neonatal calves retain fetal-like and acquire new growth properties. Am J Physiol 1997;273:L234–L245. 21. Schultz K, Fanburg BL, Beasley D. Hypoxia and hypoxia-inducible factor-1alpha promote growth factor-induced proliferation of human

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37. 38.

39.

40.

41.

1101

vascular smooth muscle cells. Am J Physiol Heart Circ Physiol 2006; 290:H2528–H2534. Benitz WE, Coulson JD, Lessler DS, Bernfield M. Hypoxia inhibits proliferation of fetal pulmonary arterial smooth muscle cells in vitro. Pediatr Res 1986;20:966–972. ten Freyhaus H, Leuchs M, Dagnell M, Vantler M, Caglayan E, ¨ stman A, Kappert K, et al. Weissmann N, Schermuly R, Dahal B, O Hypoxia enhances platelet-derived growth factor signaling in the pulmonary vasculature by HIF-1 -dependent downregulation of protein tyrosine phosphatases. Circulation 2009;120:S1146. Dahal BK, Cornitescu T, Tretyn A, Pullamsetti SS, Kosanovic D, Dumitrascu R, Ghofrani HA, Weissmann N, Voswinckel R, Banat GA, et al. Role of epidermal growth factor inhibition in experimental pulmonary hypertension. Am J Respir Crit Care Med 2009;181: 158–167. Sorby M, Sandstrom J, Ostman A. An extracellular ligand increases the specific activity of the receptor-like protein tyrosine phosphatase DEP-1. Oncogene 2001;20:5219–5224. Vantler M, Caglayan E, Zimmermann WH, Baumer AT, Rosenkranz S. Systematic evaluation of anti-apoptotic growth factor signaling in vascular smooth muscle cells. Only phosphatidylinositol 39-kinase is important. J Biol Chem 2005;280:14168–14176. Kappert K, Paulsson J, Sparwel J, Leppanen O, Hellberg C, Ostman A, Micke P. Dynamic changes in the expression of DEP-1 and other PDGF receptor-antagonizing PTPs during onset and termination of neointima formation. FASEB J 2007;21:523–534. Mabjeesh NJ, Escuin D, LaVallee TM, Pribluda VS, Swartz GM, Johnson MS, Willard MT, Zhong H, Simons JW, Giannakakou P. 2ME2 inhibits tumor growth and angiogenesis by disrupting microtubules and dysregulating HIF. Cancer Cell 2003;3:363–375. Katayose D, Ohe M, Yamauchi K, Ogata M, Shirato K, Fujita H, Shibahara S, Takishima T. Increased expression of PDGF A- and Bchain genes in rat lungs with hypoxic pulmonary hypertension. Am J Physiol 1993;264:L100–L106. Balasubramaniam V, Le Cras TD, Ivy DD, Grover TR, Kinsella JP, Abman SH. Role of platelet-derived growth factor in vascular remodeling during pulmonary hypertension in the ovine fetus. Am J Physiol Lung Cell Mol Physiol 2003;284:L826–L833. Pak O, Aldashev A, Welsh D, Peacock A. The effects of hypoxia on the cells of the pulmonary vasculature. Eur Respir J 2007;30: 364–372. Lanner MC, Raper M, Pratt WM, Rhoades RA. Heterotrimeric G proteins and the PDGFR-fbetag contribute to hypoxic proliferation of smooth muscle cells. Am J Respir Cell Mol Biol 2005;283:412–419. Valius M, Kazlauskas A. Phospholipase C-gamma 1 and phosphatidylinositol 3 kinase are the downstream mediators of the PDGF receptor’s mitogenic signal. Cell 1993;73:321–334. Liu Y, Li M, Warburton RR, Hill NS, Fanburg BL. The 5-HT transporter transactivates the PDGFbeta receptor in pulmonary artery smooth muscle cells. FASEB J 2007;21:2725–2734. Frid MG, Aldashev AA, Dempsey EC, Stenmark KR. Smooth muscle cells isolated from discrete compartments of the mature vascular media exhibit unique phenotypes and distinct growth capabilities. Circ Res 1997;81:940–952. Dempsey EC, Das M, Frid MG, Xu Y, Stenmark KR. Hypoxic growth of bovine pulmonary artery smooth muscle cells: dependence on synergy, heterogeneity, and injury-induced phenotypic change. Chest 1998;114:29S–30S. Ostman A, Hellberg C, Bohmer FD. Protein-tyrosine phosphatases and cancer. Nat Rev Cancer 2006;6:307–320. Tonks NK, Muthuswamy SK. A brake becomes an accelerator: PTP1B–a new therapeutic target for breast cancer. Cancer Cell 2007;11:214–216. Kovalenko M, Denner K, Sandstrom J, Persson C, Gross S, Jandt E, Vilella R, Bohmer F, Ostman A. Site-selective dephosphorylation of the platelet-derived growth factor beta-receptor by the receptor-like protein-tyrosine phosphatase DEP-1. J Biol Chem 2000;275:16219– 16226. Zakrzewicz A, Kouri FM, Nejman B, Kwapiszewska G, Hecker M, Sandu R, Dony E, Seeger W, Schermuly RT, Eickelberg O, et al. The transforming growth factor-beta/Smad2,3 signalling axis is impaired in experimental pulmonary hypertension. Eur Respir J 2007;29:1094– 1104. Morrell NW, Upton PD, Kotecha S, Huntley A, Yacoub MH, Polak JM, Wharton J. Angiotensin II activates MAPK and stimulates growth of

1102

42.

43. 44.

45.


human pulmonary artery smooth muscle via AT1 receptors. Am J Physiol 1999;277:L440–L448. Bonello S, Zahringer C, Bel Aiba RS, Djordjevic T, Hess J, Michiels C, Kietzmann T, Gorlach A. Reactive oxygen species activate the HIF1alpha promoter via a functional NFkappaB site. Arterioscler Thromb Vasc Biol 2007;27:755–761. Ruas JL, Lendahl U, Poellinger L. Modulation of vascular gene expression by hypoxia. Curr Opin Lipidol 2007;18:508–514. Dahut WL, Lakhani NJ, Gulley JL, Arlen PM, Kohn EC, Kotz H, McNally D, Parr A, Nguyen D, Yang SX, et al. Phase I clinical trial of oral 2-methoxyestradiol, an antiangiogenic and apoptotic agent, in patients with solid tumors. Cancer Biol Ther 2006;5:22–27. Sweeney C, Liu G, Yiannoutsos C, Kolesar J, Horvath D, Staab MJ, Fife K, Armstrong V, Treston A, Sidor C, et al. A phase II multicenter, ran-

VOL 183

2011

domized, double-blind, safety trial assessing the pharmacokinetics, pharmacodynamics, and efficacy of oral 2-methoxyestradiol capsules in hormone-refractory prostate cancer. Clin Cancer Res 2005;11:6625–6633. 46. Tofovic SP, Zhang X, Jackson EK, Dacic S, Petrusevska G. 2-Methoxyestradiol mediates the protective effects of estradiol in monocrotalineinduced pulmonary hypertension. Vascul Pharmacol 2006;45:358–367. 47. Ghofrani HA, Seeger W, Grimminger F. Imatinib for the treatment of pulmonary arterial hypertension. N Engl J Med 2005;353:1412–1413. 48. Chang Y, Ceacareanu B, Zhuang D, Zhang C, Pu Q, Ceacareanu AC, Hassid A. Counter-regulatory function of protein tyrosine phosphatase 1B in platelet-derived growth factor- or fibroblast growth factorinduced motility and proliferation of cultured smooth muscle cells and in neointima formation. Arterioscler Thromb Vasc Biol 2006;26: 501–507.